Starting /dee2/code/volunteer_pipeline.sh SRR28623267 current disk space = 3050807029760 free memory = 1244801548 SRR28623267 SRAfilesize 26e482834f8197eb513e0d70f5231cd4 SRR28623267.sra SRR28623267.sra file validated SRR28623267 is paired end SRR28623267 is conventional basespace SRR28623267 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623267_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.35075 37.0 37.0 37.0 37.0 37.0 2 36.3755 37.0 37.0 37.0 37.0 37.0 3 36.586 37.0 37.0 37.0 37.0 37.0 4 36.62 37.0 37.0 37.0 37.0 37.0 5 36.568 37.0 37.0 37.0 37.0 37.0 6 36.6595 37.0 37.0 37.0 37.0 37.0 7 36.5965 37.0 37.0 37.0 37.0 37.0 8 36.4475 37.0 37.0 37.0 37.0 37.0 9 36.606 37.0 37.0 37.0 37.0 37.0 10-14 36.6134 37.0 37.0 37.0 37.0 37.0 15-19 36.576800000000006 37.0 37.0 37.0 37.0 37.0 20-24 36.5316 37.0 37.0 37.0 37.0 37.0 25-29 36.441199999999995 37.0 37.0 37.0 37.0 37.0 30-34 36.45119999999999 37.0 37.0 37.0 37.0 37.0 35-39 36.425399999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.3861 37.0 37.0 37.0 37.0 37.0 45-49 36.3164 37.0 37.0 37.0 37.0 37.0 50-54 36.284800000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.2467 37.0 37.0 37.0 37.0 37.0 60-64 36.3293 37.0 37.0 37.0 37.0 37.0 65-69 36.2929 37.0 37.0 37.0 37.0 37.0 70-74 36.1245 37.0 37.0 37.0 37.0 37.0 75-79 36.1931 37.0 37.0 37.0 37.0 37.0 80-84 36.1156 37.0 37.0 37.0 37.0 37.0 85-89 36.103899999999996 37.0 37.0 37.0 37.0 37.0 90-94 36.022999999999996 37.0 37.0 37.0 37.0 37.0 95-99 35.928200000000004 37.0 37.0 37.0 37.0 37.0 100-104 36.0441 37.0 37.0 37.0 37.0 37.0 105-109 36.021699999999996 37.0 37.0 37.0 37.0 37.0 110-114 35.9667 37.0 37.0 37.0 37.0 37.0 115-119 35.9803 37.0 37.0 37.0 37.0 37.0 120-124 35.7771 37.0 37.0 37.0 37.0 37.0 125-129 35.705799999999996 37.0 37.0 37.0 37.0 37.0 130-134 35.8769 37.0 37.0 37.0 37.0 37.0 135-139 35.6224 37.0 37.0 37.0 37.0 37.0 140-144 35.4378 37.0 37.0 37.0 37.0 37.0 145-149 35.4144 37.0 37.0 37.0 34.6 37.0 150-151 35.0785 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 1.0 21 2.0 22 0.0 23 2.0 24 5.0 25 2.0 26 10.0 27 8.0 28 13.0 29 21.0 30 21.0 31 39.0 32 47.0 33 93.0 34 164.0 35 386.0 36 2947.0 37 238.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.877858758482034 12.968082432772054 8.51972857501885 44.63433023372706 2 17.125 15.85 38.224999999999994 28.799999999999997 3 17.5 20.625 26.724999999999998 35.15 4 22.675 27.700000000000003 22.3 27.325 5 23.0 32.074999999999996 24.95 19.975 6 20.849999999999998 37.75 22.225 19.175 7 14.725 28.375 39.7 17.2 8 18.7 25.95 31.674999999999997 23.674999999999997 9 18.65 24.224999999999998 34.300000000000004 22.825 10-14 18.965 30.495 27.650000000000002 22.89 15-19 19.650000000000002 29.154999999999998 27.66 23.535 20-24 19.715 28.810000000000002 28.15 23.325000000000003 25-29 20.025000000000002 28.945 27.105 23.925 30-34 19.555 29.175 27.800000000000004 23.47 35-39 20.085 29.17 27.365000000000002 23.380000000000003 40-44 20.035 28.93 27.655 23.380000000000003 45-49 19.314999999999998 29.13 27.32 24.235 50-54 20.255000000000003 29.14 27.74 22.865 55-59 19.915 29.220000000000002 26.705000000000002 24.16 60-64 19.945 28.64 27.694999999999997 23.72 65-69 19.695 29.425 27.265 23.615 70-74 20.59 28.815 27.21 23.385 75-79 20.335 29.13 27.175 23.36 80-84 20.294999999999998 29.04 27.779999999999998 22.884999999999998 85-89 20.43 28.73 27.435 23.405 90-94 19.75 28.825 28.235 23.189999999999998 95-99 20.275000000000002 29.104999999999997 27.785 22.835 100-104 20.73 28.825 27.439999999999998 23.005 105-109 19.46 29.455 27.375 23.71 110-114 20.169999999999998 29.275000000000002 27.015 23.54 115-119 20.79 29.34 26.525 23.345 120-124 20.474999999999998 27.825 27.755000000000003 23.945 125-129 20.735 28.544999999999998 27.145000000000003 23.575 130-134 21.029999999999998 28.68 26.575 23.715 135-139 20.75 29.005 26.58 23.665 140-144 21.26 28.88 26.400000000000002 23.46 145-149 20.9 28.285 26.38 24.435000000000002 150-151 20.525 28.0875 27.375 24.0125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 1.5 21 2.0 22 4.0 23 5.0 24 4.0 25 5.5 26 6.0 27 8.5 28 11.0 29 17.0 30 23.0 31 27.0 32 33.0 33 42.0 34 52.5 35 70.5 36 100.5 37 127.5 38 156.0 39 179.0 40 196.0 41 229.0 42 237.0 43 231.5 44 258.0 45 267.5 46 256.5 47 248.0 48 236.5 49 194.0 50 166.0 51 148.5 52 112.0 53 85.0 54 64.0 55 51.5 56 37.0 57 28.5 58 19.5 59 14.0 60 11.0 61 6.5 62 6.0 63 4.0 64 3.0 65 3.5 66 2.0 67 2.5 68 2.0 69 1.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.525 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.0 #Duplication Level Percentage of deduplicated Percentage of total 1 85.52941176470588 72.7 2 11.794117647058822 20.05 3 2.264705882352941 5.775 4 0.3235294117647059 1.0999999999999999 5 0.08823529411764706 0.375 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TAATTTGCCACCAATCAAATAACGCAAGTGATCTTTGACCAAGTCACTTG 5 0.125 No Hit CTTGGATTGATGCTTTTGAGATCTCCTTTCTCAAGGCAGAGATATTGCAG 5 0.125 No Hit ATCGCAAGTTATAGAAAACTCATTCAAGGAAAATAAAAAAGCAATCCCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.3375 0.0 0.0 0.0 0.0 84-85 0.475 0.0 0.0 0.0 0.0 86-87 0.625 0.0 0.0 0.0 0.0 88-89 0.8500000000000001 0.0 0.0 0.0 0.0 90-91 1.125 0.0 0.0 0.0 0.0 92-93 1.35 0.0 0.0 0.0 0.0 94-95 1.5875 0.0 0.0 0.0 0.0 96-97 2.0125 0.0 0.0 0.0 0.0 98-99 2.2375 0.0 0.0 0.0 0.0 100-101 2.425 0.0 0.0 0.0 0.0 102-103 2.7125000000000004 0.0 0.0 0.0 0.0 104-105 3.1375 0.0 0.0 0.0 0.0 106-107 3.5625 0.0 0.0 0.0 0.0 108-109 3.8875 0.0 0.0 0.0 0.0 110-111 4.425 0.0 0.0 0.0 0.0 112-113 4.95 0.0 0.0 0.0 0.0 114-115 5.4375 0.0 0.0 0.0 0.0 116-117 5.95 0.0 0.0 0.0 0.0 118-119 6.5375 0.0 0.0 0.0 0.0 120-121 6.975 0.0 0.0 0.0 0.0 122-123 7.3625 0.0 0.0 0.0 0.0 124-125 7.8 0.0 0.0 0.0 0.0 126-127 8.2625 0.0 0.0 0.0 0.0 128-129 8.7125 0.0 0.0 0.0 0.0 130-131 9.4125 0.0 0.0 0.0 0.0 132-133 10.2625 0.0 0.0 0.0 0.0 134-135 10.9 0.0 0.0 0.0 0.0 136-137 11.55 0.0 0.0 0.0 0.0 138-139 12.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCAATTA 10 0.006830828 145.0 3 CCACTAT 10 0.006830828 145.0 2 TCAGAAT 10 0.006830828 145.0 8 CACTATC 10 0.006830828 145.0 3 GCTTCCC 10 0.006830828 145.0 5 ACTATCA 10 0.006830828 145.0 4 >>END_MODULE SRR28623267 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623267_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.837 37.0 37.0 37.0 37.0 37.0 2 36.278 37.0 37.0 37.0 37.0 37.0 3 36.314 37.0 37.0 37.0 37.0 37.0 4 36.1985 37.0 37.0 37.0 37.0 37.0 5 36.458 37.0 37.0 37.0 37.0 37.0 6 36.2705 37.0 37.0 37.0 37.0 37.0 7 36.316 37.0 37.0 37.0 37.0 37.0 8 36.332 37.0 37.0 37.0 37.0 37.0 9 36.325 37.0 37.0 37.0 37.0 37.0 10-14 36.120599999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.1252 37.0 37.0 37.0 37.0 37.0 20-24 36.1476 37.0 37.0 37.0 37.0 37.0 25-29 36.0951 37.0 37.0 37.0 37.0 37.0 30-34 36.0264 37.0 37.0 37.0 37.0 37.0 35-39 36.0564 37.0 37.0 37.0 37.0 37.0 40-44 35.9962 37.0 37.0 37.0 37.0 37.0 45-49 35.992399999999996 37.0 37.0 37.0 37.0 37.0 50-54 35.957 37.0 37.0 37.0 37.0 37.0 55-59 35.8689 37.0 37.0 37.0 37.0 37.0 60-64 35.8915 37.0 37.0 37.0 37.0 37.0 65-69 35.920899999999996 37.0 37.0 37.0 37.0 37.0 70-74 35.873000000000005 37.0 37.0 37.0 37.0 37.0 75-79 35.8849 37.0 37.0 37.0 37.0 37.0 80-84 35.7719 37.0 37.0 37.0 37.0 37.0 85-89 35.6813 37.0 37.0 37.0 37.0 37.0 90-94 35.6306 37.0 37.0 37.0 37.0 37.0 95-99 35.634100000000004 37.0 37.0 37.0 37.0 37.0 100-104 35.607 37.0 37.0 37.0 37.0 37.0 105-109 35.5703 37.0 37.0 37.0 37.0 37.0 110-114 35.6591 37.0 37.0 37.0 37.0 37.0 115-119 35.5299 37.0 37.0 37.0 37.0 37.0 120-124 35.5127 37.0 37.0 37.0 37.0 37.0 125-129 35.0724 37.0 37.0 37.0 32.2 37.0 130-134 35.45020000000001 37.0 37.0 37.0 37.0 37.0 135-139 35.1699 37.0 37.0 37.0 29.8 37.0 140-144 35.225100000000005 37.0 37.0 37.0 32.2 37.0 145-149 35.156699999999994 37.0 37.0 37.0 29.8 37.0 150-151 34.815250000000006 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 7.0 14 3.0 15 5.0 16 4.0 17 6.0 18 4.0 19 2.0 20 5.0 21 7.0 22 8.0 23 7.0 24 1.0 25 2.0 26 8.0 27 12.0 28 11.0 29 15.0 30 26.0 31 62.0 32 51.0 33 112.0 34 194.0 35 574.0 36 2580.0 37 294.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.975 20.150000000000002 13.450000000000001 26.424999999999997 2 28.675 24.925 30.349999999999998 16.05 3 21.875 28.299999999999997 30.775000000000002 19.05 4 25.6 33.050000000000004 22.35 19.0 5 25.1 35.375 22.025 17.5 6 20.125 39.4 22.425 18.05 7 19.875 21.625 38.975 19.525000000000002 8 21.099999999999998 24.9 29.325000000000003 24.675 9 20.9 24.875 30.225 24.0 10-14 23.330000000000002 29.01 27.05 20.61 15-19 23.305 28.455000000000002 28.17 20.07 20-24 23.445 29.044999999999998 27.279999999999998 20.23 25-29 23.635 27.955000000000002 27.97 20.44 30-34 23.18 28.389999999999997 27.785 20.645 35-39 22.595000000000002 28.865000000000002 28.075 20.465 40-44 23.415 28.494999999999997 28.110000000000003 19.98 45-49 22.67 29.195 27.900000000000002 20.235 50-54 22.63 28.565 28.565 20.24 55-59 23.345 28.389999999999997 27.98 20.285 60-64 23.09 28.115000000000002 28.265 20.53 65-69 22.5 27.435 29.404999999999998 20.66 70-74 22.845 27.860000000000003 28.435 20.86 75-79 22.625 28.475 28.355000000000004 20.544999999999998 80-84 22.720000000000002 28.815 27.794999999999998 20.669999999999998 85-89 23.155 28.075 28.205000000000002 20.565 90-94 23.565 27.83 27.915 20.69 95-99 23.380000000000003 27.650000000000002 28.32 20.65 100-104 23.885 28.105000000000004 27.92 20.09 105-109 24.02 27.63 27.96 20.39 110-114 24.34 27.715 27.750000000000004 20.195 115-119 24.575 28.18 27.755000000000003 19.49 120-124 25.39 28.335 27.05 19.225 125-129 24.85 28.349999999999998 27.605 19.195 130-134 24.95 28.58 27.625 18.845 135-139 25.935000000000002 28.64 26.674999999999997 18.75 140-144 25.55 28.23 27.18 19.040000000000003 145-149 26.055 27.450000000000003 27.165 19.33 150-151 25.874999999999996 28.6125 27.224999999999998 18.2875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 1.0 9 1.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 2.5 16 2.0 17 0.5 18 1.0 19 0.5 20 1.0 21 1.0 22 0.5 23 1.0 24 5.5 25 7.0 26 5.0 27 7.5 28 11.5 29 12.0 30 10.5 31 18.5 32 29.5 33 40.5 34 61.5 35 75.0 36 98.0 37 128.0 38 133.0 39 173.5 40 216.5 41 240.0 42 265.0 43 273.0 44 286.5 45 276.5 46 253.5 47 236.0 48 222.0 49 183.0 50 140.5 51 135.5 52 113.5 53 78.5 54 62.0 55 46.0 56 28.5 57 25.5 58 20.0 59 12.5 60 10.0 61 7.0 62 6.5 63 6.5 64 5.5 65 3.0 66 1.0 67 1.0 68 1.0 69 1.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.5 76 1.0 77 1.0 78 0.5 79 0.0 80 0.0 81 0.5 82 1.5 83 1.5 84 1.0 85 0.5 86 0.5 87 0.5 88 0.0 89 0.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.575 #Duplication Level Percentage of deduplicated Percentage of total 1 86.24014022787028 73.8 2 11.072158924919663 18.95 3 2.337131171487 6.0 4 0.292141396435875 1.0 5 0.05842827928717499 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTAAACATTTTTGTGAACTGGTAGGGCCTATGAATATCTCTGAGTTCAA 5 0.125 No Hit AAACAACTGGTCCAACTAAGAGTACTTCGAATGAACCTCAGCGATGAGAG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.3375 0.0 0.0 0.0 0.0 84-85 0.475 0.0 0.0 0.0 0.0 86-87 0.6499999999999999 0.0 0.0 0.0 0.0 88-89 0.875 0.0 0.0 0.0 0.0 90-91 1.15 0.0 0.0 0.0 0.0 92-93 1.375 0.0 0.0 0.0 0.0 94-95 1.6125 0.0 0.0 0.0 0.0 96-97 2.0375 0.0 0.0 0.0 0.0 98-99 2.2750000000000004 0.0 0.0 0.0 0.0 100-101 2.4749999999999996 0.0 0.0 0.0 0.0 102-103 2.7625 0.0 0.0 0.0 0.0 104-105 3.2125000000000004 0.0 0.0 0.0 0.0 106-107 3.6375 0.0 0.0 0.0 0.0 108-109 3.9625 0.0 0.0 0.0 0.0 110-111 4.5 0.0 0.0 0.0 0.0 112-113 5.025 0.0 0.0 0.0 0.0 114-115 5.512499999999999 0.0 0.0 0.0 0.0 116-117 6.05 0.0 0.0 0.0 0.0 118-119 6.6375 0.0 0.0 0.0 0.0 120-121 7.075 0.0 0.0 0.0 0.0 122-123 7.4375 0.0 0.0 0.0 0.0 124-125 7.9 0.0 0.0 0.0 0.0 126-127 8.3625 0.0 0.0 0.0 0.0 128-129 8.8375 0.0 0.0 0.0 0.0 130-131 9.55 0.0 0.0 0.0 0.0 132-133 10.4 0.0 0.0 0.0 0.0 134-135 11.025 0.0 0.0 0.0 0.0 136-137 11.675 0.0 0.0 0.0 0.0 138-139 12.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCCAAGG 10 0.006830828 145.0 9 GCAGCGT 10 0.006830828 145.0 2 GTCCCAA 10 0.006830828 145.0 7 GCGTCCC 10 0.006830828 145.0 5 CAGCGTC 10 0.006830828 145.0 3 AGCGTCC 10 0.006830828 145.0 4 GGGGACT 10 0.006830828 145.0 1 CGTCCCA 10 0.006830828 145.0 6 >>END_MODULE Read 1736084 spots for SRR28623267.sra Written 1736084 spots for SRR28623267.sra Read 1736084 spots for SRR28623267.sra Written 1736084 spots for SRR28623267.sra Read 1736084 spots for SRR28623267.sra Written 1736084 spots for SRR28623267.sra Read 1736084 spots for SRR28623267.sra Written 1736084 spots for SRR28623267.sra Read 1736084 spots for SRR28623267.sra Written 1736084 spots for SRR28623267.sra Read 1736084 spots for SRR28623267.sra Written 1736084 spots for SRR28623267.sra Read 1736084 spots for SRR28623267.sra Written 1736084 spots for SRR28623267.sra Read 1736084 spots for SRR28623267.sra Written 1736084 spots for SRR28623267.sra Read 1736084 spots for SRR28623267.sra Written 1736084 spots for SRR28623267.sra Read 1736084 spots for SRR28623267.sra Written 1736084 spots for SRR28623267.sra Read 1736084 spots for SRR28623267.sra Written 1736084 spots for SRR28623267.sra Read 1736084 spots for SRR28623267.sra Written 1736084 spots for SRR28623267.sra Read 1736084 spots for SRR28623267.sra Written 1736084 spots for SRR28623267.sra Read 1736084 spots for SRR28623267.sra Written 1736084 spots for SRR28623267.sra Read 1736084 spots for SRR28623267.sra Written 1736084 spots for SRR28623267.sra Read 1736084 spots for SRR28623267.sra Written 1736084 spots for SRR28623267.sra Read 1736084 spots for SRR28623267.sra Written 1736084 spots for SRR28623267.sra Read 1736103 spots for SRR28623267.sra Written 1736103 spots for SRR28623267.sra Read 1736084 spots for SRR28623267.sra Written 1736084 spots for SRR28623267.sra Read 1736084 spots for SRR28623267.sra Written 1736084 spots for SRR28623267.sra SRR ids: ['SRR28623267.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ahk8jvc0 SRR28623267.sra spots: 34721699 blocks: [[1, 1736084], [1736085, 3472168], [3472169, 5208252], [5208253, 6944336], [6944337, 8680420], [8680421, 10416504], [10416505, 12152588], [12152589, 13888672], [13888673, 15624756], [15624757, 17360840], [17360841, 19096924], [19096925, 20833008], [20833009, 22569092], [22569093, 24305176], [24305177, 26041260], [26041261, 27777344], [27777345, 29513428], [29513429, 31249512], [31249513, 32985596], [32985597, 34721699]] SRR28623267 file size 12822118 SRR28623267 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR28623267 SRR28623267_1.fastq SRR28623267_2.fastq Input file: SRR28623267_1.fastq Paired file: SRR28623267_2.fastq trimmed: SRR28623267-trimmed-pair1.fastq, SRR28623267-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 12:32:22 2025 >> started Tue Feb 11 12:33:03 2025 >> done (40.205s) 34721699 read pairs processed; of these: 40 ( 0.00%) short read pairs filtered out after trimming by size control 9178 ( 0.03%) empty read pairs filtered out after trimming by size control 34712481 (99.97%) read pairs available; of these: 5817800 (16.76%) trimmed read pairs available after processing 28894681 (83.24%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 7 0.00% 20 3 0.00% 21 9 0.00% 22 6 0.00% 23 12 0.00% 24 7 0.00% 25 12 0.00% 26 8 0.00% 27 9 0.00% 28 14 0.00% 29 19 0.00% 30 12 0.00% 31 24 0.00% 32 21 0.00% 33 18 0.00% 34 21 0.00% 35 25 0.00% 36 37 0.00% 37 43 0.00% 38 42 0.00% 39 58 0.00% 40 64 0.00% 41 68 0.00% 42 68 0.00% 43 64 0.00% 44 91 0.00% 45 109 0.00% 46 124 0.00% 47 160 0.00% 48 185 0.00% 49 224 0.00% 50 235 0.00% 51 257 0.00% 52 334 0.00% 53 368 0.00% 54 398 0.00% 55 516 0.00% 56 505 0.00% 57 605 0.00% 58 676 0.00% 59 822 0.00% 60 948 0.00% 61 1088 0.00% 62 1254 0.00% 63 1516 0.00% 64 1658 0.00% 65 1889 0.01% 66 2061 0.01% 67 2362 0.01% 68 2843 0.01% 69 3192 0.01% 70 3713 0.01% 71 4099 0.01% 72 4819 0.01% 73 5585 0.02% 74 6410 0.02% 75 6944 0.02% 76 7711 0.02% 77 8611 0.02% 78 9869 0.03% 79 11144 0.03% 80 12123 0.03% 81 13725 0.04% 82 15349 0.04% 83 16707 0.05% 84 18708 0.05% 85 20747 0.06% 86 22463 0.06% 87 23907 0.07% 88 25897 0.07% 89 27123 0.08% 90 29271 0.08% 91 31698 0.09% 92 34189 0.10% 93 36594 0.11% 94 39489 0.11% 95 42113 0.12% 96 44109 0.13% 97 46968 0.14% 98 48658 0.14% 99 50600 0.15% 100 52898 0.15% 101 54561 0.16% 102 57367 0.17% 103 59914 0.17% 104 62244 0.18% 105 65013 0.19% 106 67826 0.20% 107 69245 0.20% 108 71222 0.21% 109 74036 0.21% 110 74702 0.22% 111 77573 0.22% 112 79728 0.23% 113 80600 0.23% 114 84180 0.24% 115 86316 0.25% 116 87982 0.25% 117 90460 0.26% 118 93303 0.27% 119 94371 0.27% 120 96681 0.28% 121 97899 0.28% 122 98399 0.28% 123 100003 0.29% 124 101965 0.29% 125 104372 0.30% 126 106308 0.31% 127 108752 0.31% 128 109325 0.31% 129 111307 0.32% 130 113094 0.33% 131 113935 0.33% 132 114810 0.33% 133 116605 0.34% 134 116921 0.34% 135 118527 0.34% 136 120762 0.35% 137 120447 0.35% 138 123127 0.35% 139 124353 0.36% 140 124691 0.36% 141 126030 0.36% 142 127205 0.37% 143 127332 0.37% 144 128616 0.37% 145 129586 0.37% 146 128905 0.37% 147 130426 0.38% 148 131655 0.38% 149 132904 0.38% 150 134875 0.39% 151 28894681 83.24% 34712481 reads passed initial QC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=7.57 fanout-score-rank=22 prefix-density=0.23 prefix-fanout=4.2 sequence=TCCTTGTCCTGGATCTT criterion=fanout-score sequence-density=0.06 sequence-density-rank=19 fanout-score=493.93 fanout-score-rank=1 prefix-density=0.86 prefix-fanout=34.6 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=23.25 fanout-score-rank=7 prefix-density=0.16 prefix-fanout=16.5 sequence=GAGAGAGAGAGTTAAGACAATGGCCTCGAAGAAATCTGCAATCGTATTACCTGGTTCAAAGGTGTTGAAGCACATAGTTTTTGTACGGTTTAATGATGGGATCACTGATGAACAAATTGAGAA criterion=fanout-score sequence-density=0.06 sequence-density-rank=18 fanout-score=486.12 fanout-score-rank=1 prefix-density=0.91 prefix-fanout=33.0 sequence=AAGAAGAAGATG SRR28623267 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 12:33:43 Started mapping on | Feb 11 12:33:43 Finished on | Feb 11 12:37:11 Mapping speed, Million of reads per hour | 600.79 Number of input reads | 34712481 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 32624056 Uniquely mapped reads % | 93.98% Average mapped length | 291.26 Number of splices: Total | 29477689 Number of splices: Annotated (sjdb) | 28800388 Number of splices: GT/AG | 28954139 Number of splices: GC/AG | 403787 Number of splices: AT/AC | 26316 Number of splices: Non-canonical | 93447 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 2.99 Insertion rate per base | 0.03% Insertion average length | 2.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 907990 % of reads mapped to multiple loci | 2.62% Number of reads mapped to too many loci | 158709 % of reads mapped to too many loci | 0.46% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.75% % of reads unmapped: other | 0.19% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1180435 1180435 1180435 N_multimapping 907990 907990 907990 N_noFeature 1255910 32245227 1450155 N_ambiguous 373878 2650 187325 UnstrandedReadsAssigned:30994268 PositiveStrandReadsAssigned:376179 NegativeStrandReadsAssigned:30986576 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR28623267 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR28623267-trimmed-pair1.fastq SRR28623267-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 34,712,481 reads, 31,395,800 reads pseudoaligned [quant] estimated average fragment length: 227.439 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,206 rounds 52401 SRR28623267.ke.tsv 34699 SRR28623267.se.tsv 87100 total ==> SRR28623267.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1791.56 1546 28.6989 Potri.005G024800.1.v4.1 1035 808.561 573 23.5683 Potri.004G059700.1.v4.1 961 734.584 76 3.4408 Potri.007G009000.2.v4.1 1416 1189.56 0 0 Potri.003G141000.2.v4.1 2943 2716.56 1111.51 13.6076 Potri.016G087400.1.v4.1 270 95.5964 2613.52 909.226 Potri.015G069301.1.v4.1 564 343.468 0 0 Potri.010G195200.1.v4.1 1773 1546.56 56 1.20423 Potri.012G127500.1.v4.1 977 750.578 10739 475.833 ==> SRR28623267.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1534 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 626 Potri.001G212900.v4.1 7 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 3 Potri.001G452600.v4.1 1 SRR28623267 completed mapping pipeline successfully