Starting /dee2/code/volunteer_pipeline.sh SRR28623268 current disk space = 3050694037504 free memory = 1466684640 SRR28623268 SRAfilesize 941a8ed9d8d30b2277d5a32ea0c3b439 SRR28623268.sra SRR28623268.sra file validated SRR28623268 is paired end SRR28623268 is conventional basespace SRR28623268 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623268_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.428 37.0 37.0 37.0 37.0 37.0 2 36.4175 37.0 37.0 37.0 37.0 37.0 3 36.588 37.0 37.0 37.0 37.0 37.0 4 36.6645 37.0 37.0 37.0 37.0 37.0 5 36.593 37.0 37.0 37.0 37.0 37.0 6 36.717 37.0 37.0 37.0 37.0 37.0 7 36.5925 37.0 37.0 37.0 37.0 37.0 8 36.362 37.0 37.0 37.0 37.0 37.0 9 36.618 37.0 37.0 37.0 37.0 37.0 10-14 36.5993 37.0 37.0 37.0 37.0 37.0 15-19 36.56570000000001 37.0 37.0 37.0 37.0 37.0 20-24 36.5515 37.0 37.0 37.0 37.0 37.0 25-29 36.4727 37.0 37.0 37.0 37.0 37.0 30-34 36.5206 37.0 37.0 37.0 37.0 37.0 35-39 36.4341 37.0 37.0 37.0 37.0 37.0 40-44 36.3645 37.0 37.0 37.0 37.0 37.0 45-49 36.34009999999999 37.0 37.0 37.0 37.0 37.0 50-54 36.311 37.0 37.0 37.0 37.0 37.0 55-59 36.288 37.0 37.0 37.0 37.0 37.0 60-64 36.299099999999996 37.0 37.0 37.0 37.0 37.0 65-69 36.325599999999994 37.0 37.0 37.0 37.0 37.0 70-74 36.220299999999995 37.0 37.0 37.0 37.0 37.0 75-79 36.1539 37.0 37.0 37.0 37.0 37.0 80-84 36.05630000000001 37.0 37.0 37.0 37.0 37.0 85-89 36.067099999999996 37.0 37.0 37.0 37.0 37.0 90-94 36.0374 37.0 37.0 37.0 37.0 37.0 95-99 35.91369999999999 37.0 37.0 37.0 37.0 37.0 100-104 35.996900000000004 37.0 37.0 37.0 37.0 37.0 105-109 35.9283 37.0 37.0 37.0 37.0 37.0 110-114 35.7675 37.0 37.0 37.0 37.0 37.0 115-119 35.8494 37.0 37.0 37.0 37.0 37.0 120-124 35.7384 37.0 37.0 37.0 37.0 37.0 125-129 35.541399999999996 37.0 37.0 37.0 37.0 37.0 130-134 35.6806 37.0 37.0 37.0 37.0 37.0 135-139 35.517500000000005 37.0 37.0 37.0 34.6 37.0 140-144 35.1875 37.0 37.0 37.0 34.6 37.0 145-149 35.20569999999999 37.0 37.0 37.0 29.8 37.0 150-151 34.982749999999996 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 3.0 21 1.0 22 4.0 23 2.0 24 2.0 25 3.0 26 9.0 27 12.0 28 9.0 29 16.0 30 34.0 31 30.0 32 56.0 33 93.0 34 172.0 35 403.0 36 2916.0 37 235.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.18054162487462 12.437311935807422 10.055165496489469 42.326980942828484 2 19.675 14.7 36.225 29.4 3 16.55 19.625 28.15 35.675000000000004 4 22.275 26.275 25.124999999999996 26.325 5 24.0 32.725 23.849999999999998 19.425 6 20.325 37.15 22.55 19.975 7 15.35 27.950000000000003 39.4 17.299999999999997 8 17.075000000000003 27.450000000000003 31.775 23.7 9 17.625 24.349999999999998 34.5 23.525 10-14 19.03 30.745 27.505000000000003 22.720000000000002 15-19 19.34 28.9 28.365000000000002 23.395 20-24 19.585 29.959999999999997 27.150000000000002 23.305 25-29 19.0 29.94 27.425 23.635 30-34 19.665 29.59 27.589999999999996 23.155 35-39 19.71 29.38 27.639999999999997 23.27 40-44 19.755 29.67 27.16 23.415 45-49 20.09 28.599999999999998 27.689999999999998 23.62 50-54 19.735 29.575000000000003 27.625 23.064999999999998 55-59 19.665 29.825000000000003 27.13 23.380000000000003 60-64 20.349999999999998 28.865000000000002 27.37 23.415 65-69 19.555 28.835 27.575 24.035 70-74 19.775000000000002 29.26 27.24 23.724999999999998 75-79 19.61 28.804999999999996 27.73 23.855 80-84 20.080000000000002 28.749999999999996 27.875 23.294999999999998 85-89 20.349999999999998 29.23 27.205000000000002 23.215 90-94 19.715 29.915000000000003 27.075 23.294999999999998 95-99 20.369999999999997 28.910000000000004 27.169999999999998 23.549999999999997 100-104 20.39 29.439999999999998 27.185 22.985 105-109 20.580000000000002 29.12 27.089999999999996 23.21 110-114 20.865000000000002 28.895 27.205000000000002 23.035 115-119 20.105 29.325000000000003 26.96 23.61 120-124 20.865000000000002 28.444999999999997 26.645000000000003 24.044999999999998 125-129 20.7 29.23 26.515 23.555 130-134 20.549999999999997 28.37 26.71 24.37 135-139 20.294999999999998 28.754999999999995 26.52 24.43 140-144 20.075000000000003 27.845 27.084999999999997 24.995 145-149 20.505000000000003 27.975 26.369999999999997 25.15 150-151 20.4 27.237499999999997 26.674999999999997 25.687500000000004 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 1.0 19 1.0 20 0.0 21 0.0 22 2.5 23 5.0 24 5.5 25 5.0 26 9.5 27 11.5 28 9.0 29 17.0 30 30.0 31 39.0 32 43.0 33 46.5 34 63.0 35 88.0 36 101.5 37 108.5 38 139.0 39 179.5 40 212.5 41 215.0 42 225.5 43 250.5 44 283.0 45 289.5 46 254.0 47 240.5 48 206.5 49 171.0 50 163.0 51 134.0 52 101.5 53 79.0 54 65.5 55 57.0 56 37.0 57 26.5 58 20.5 59 14.0 60 9.0 61 6.5 62 5.0 63 5.0 64 7.0 65 5.5 66 1.5 67 0.5 68 0.5 69 1.5 70 1.0 71 0.0 72 0.5 73 1.0 74 2.0 75 1.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.3 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.725 #Duplication Level Percentage of deduplicated Percentage of total 1 86.17672790901138 73.875 2 11.519393409157189 19.75 3 1.8664333624963547 4.8 4 0.379119276757072 1.3 5 0.029163021289005542 0.125 6 0.029163021289005542 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTAGCTGCAACAGCATTTGCAGAAACATCAACAACATCAATTGTCCCAGA 6 0.15 No Hit GCCGTTATTACCGTTAGAAGAGCTCGAATGATTAGCGGCTGAAGAAGAAG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0125 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.1375 0.0 0.0 0.0 0.0 70-71 0.1875 0.0 0.0 0.0 0.0 72-73 0.23750000000000002 0.0 0.0 0.0 0.0 74-75 0.3125 0.0 0.0 0.0 0.0 76-77 0.4125 0.0 0.0 0.0 0.0 78-79 0.4625 0.0 0.0 0.0 0.0 80-81 0.575 0.0 0.0 0.0 0.0 82-83 0.8125 0.0 0.0 0.0 0.0 84-85 0.95 0.0 0.0 0.0 0.0 86-87 1.15 0.0 0.0 0.0 0.0 88-89 1.3375 0.0 0.0 0.0 0.0 90-91 1.675 0.0 0.0 0.0 0.0 92-93 1.8625 0.0 0.0 0.0 0.0 94-95 2.0 0.0 0.0 0.0 0.0 96-97 2.2 0.0 0.0 0.0 0.0 98-99 2.4875 0.0 0.0 0.0 0.0 100-101 2.7375 0.0 0.0 0.0 0.0 102-103 3.0875 0.0 0.0 0.0 0.0 104-105 3.7375 0.0 0.0 0.0 0.0 106-107 4.075 0.0 0.0 0.0 0.0 108-109 4.375 0.0 0.0 0.0 0.0 110-111 4.8375 0.0 0.0 0.0 0.0 112-113 5.3625 0.0 0.0 0.0 0.0 114-115 5.9625 0.0 0.0 0.0 0.0 116-117 6.675000000000001 0.0 0.0 0.0 0.0 118-119 7.4125 0.0 0.0 0.0 0.0 120-121 8.075 0.0 0.0 0.0 0.0 122-123 8.7375 0.0 0.0 0.0 0.0 124-125 9.45 0.0 0.0 0.0 0.0 126-127 10.3125 0.0 0.0 0.0 0.0 128-129 11.1875 0.0 0.0 0.0 0.0 130-131 11.850000000000001 0.0 0.0 0.0 0.0 132-133 12.662500000000001 0.0 0.0 0.0 0.0 134-135 13.45 0.0 0.0 0.0 0.0 136-137 14.2125 0.0 0.0 0.0 0.0 138-139 15.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR28623268 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623268_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.978 37.0 37.0 37.0 37.0 37.0 2 36.4465 37.0 37.0 37.0 37.0 37.0 3 36.436 37.0 37.0 37.0 37.0 37.0 4 36.367 37.0 37.0 37.0 37.0 37.0 5 36.4795 37.0 37.0 37.0 37.0 37.0 6 36.4275 37.0 37.0 37.0 37.0 37.0 7 36.4305 37.0 37.0 37.0 37.0 37.0 8 36.4545 37.0 37.0 37.0 37.0 37.0 9 36.3245 37.0 37.0 37.0 37.0 37.0 10-14 36.2976 37.0 37.0 37.0 37.0 37.0 15-19 36.2801 37.0 37.0 37.0 37.0 37.0 20-24 36.251799999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.2095 37.0 37.0 37.0 37.0 37.0 30-34 36.187599999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.2063 37.0 37.0 37.0 37.0 37.0 40-44 36.136799999999994 37.0 37.0 37.0 37.0 37.0 45-49 36.132600000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.1259 37.0 37.0 37.0 37.0 37.0 55-59 35.9975 37.0 37.0 37.0 37.0 37.0 60-64 35.9769 37.0 37.0 37.0 37.0 37.0 65-69 35.9847 37.0 37.0 37.0 37.0 37.0 70-74 36.0192 37.0 37.0 37.0 37.0 37.0 75-79 36.027100000000004 37.0 37.0 37.0 37.0 37.0 80-84 35.9067 37.0 37.0 37.0 37.0 37.0 85-89 35.88270000000001 37.0 37.0 37.0 37.0 37.0 90-94 35.8134 37.0 37.0 37.0 37.0 37.0 95-99 35.775099999999995 37.0 37.0 37.0 37.0 37.0 100-104 35.6827 37.0 37.0 37.0 37.0 37.0 105-109 35.6147 37.0 37.0 37.0 37.0 37.0 110-114 35.7122 37.0 37.0 37.0 37.0 37.0 115-119 35.68470000000001 37.0 37.0 37.0 37.0 37.0 120-124 35.699799999999996 37.0 37.0 37.0 37.0 37.0 125-129 35.237700000000004 37.0 37.0 37.0 32.2 37.0 130-134 35.497 37.0 37.0 37.0 37.0 37.0 135-139 35.3301 37.0 37.0 37.0 34.6 37.0 140-144 35.3198 37.0 37.0 37.0 34.6 37.0 145-149 35.2449 37.0 37.0 37.0 32.2 37.0 150-151 34.9255 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 4.0 14 3.0 15 2.0 16 5.0 17 1.0 18 2.0 19 1.0 20 2.0 21 3.0 22 2.0 23 3.0 24 9.0 25 6.0 26 8.0 27 13.0 28 15.0 29 20.0 30 26.0 31 35.0 32 51.0 33 103.0 34 161.0 35 620.0 36 2582.0 37 322.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.824999999999996 20.225 14.399999999999999 26.55 2 28.275 26.0 28.349999999999998 17.375 3 20.875 28.599999999999998 31.8 18.725 4 23.625 34.699999999999996 23.150000000000002 18.525 5 25.674999999999997 35.475 21.349999999999998 17.5 6 20.724999999999998 39.625 22.775000000000002 16.875 7 20.4 22.1 37.8 19.7 8 22.900000000000002 24.65 28.849999999999998 23.599999999999998 9 22.825 24.525 29.025000000000002 23.625 10-14 24.015 28.63 27.315 20.04 15-19 23.31 27.71 28.189999999999998 20.79 20-24 22.814999999999998 28.485 28.405 20.294999999999998 25-29 22.63 28.58 28.025 20.765 30-34 23.135 28.83 27.355 20.68 35-39 23.01 27.675 28.48 20.835 40-44 23.810000000000002 27.334999999999997 28.439999999999998 20.415 45-49 23.244999999999997 28.65 27.97 20.135 50-54 23.119999999999997 28.255000000000003 28.610000000000003 20.015 55-59 23.32 27.41 28.53 20.74 60-64 23.36 27.155 28.410000000000004 21.075 65-69 23.22 28.125 28.57 20.085 70-74 23.96 28.24 27.894999999999996 19.905 75-79 23.16 27.815 28.549999999999997 20.474999999999998 80-84 23.845 27.634999999999998 28.205000000000002 20.315 85-89 23.865 28.24 27.689999999999998 20.205000000000002 90-94 24.404999999999998 27.805000000000003 28.155 19.634999999999998 95-99 24.29 27.66 28.125 19.925 100-104 24.07 27.800000000000004 27.83 20.3 105-109 24.385 28.349999999999998 27.900000000000002 19.365 110-114 24.44 28.34 27.750000000000004 19.470000000000002 115-119 24.42 28.29 27.425 19.865 120-124 25.019999999999996 27.339999999999996 28.360000000000003 19.28 125-129 25.180000000000003 28.16 27.435 19.225 130-134 25.624999999999996 27.825 26.889999999999997 19.66 135-139 25.979999999999997 27.47 27.860000000000003 18.69 140-144 26.14 27.529999999999998 27.689999999999998 18.64 145-149 26.484999999999996 27.450000000000003 27.145000000000003 18.92 150-151 26.087500000000002 27.075 27.275 19.5625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 1.0 5 0.5 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 1.0 18 1.0 19 0.5 20 1.0 21 1.0 22 1.5 23 2.0 24 2.0 25 1.0 26 3.0 27 8.0 28 11.0 29 12.0 30 14.0 31 21.0 32 38.5 33 45.5 34 49.5 35 68.5 36 84.5 37 105.0 38 149.5 39 184.0 40 218.5 41 248.0 42 252.5 43 268.5 44 270.5 45 267.0 46 260.0 47 239.0 48 225.5 49 195.5 50 160.5 51 128.0 52 91.0 53 68.0 54 63.5 55 51.5 56 35.0 57 29.0 58 24.5 59 23.0 60 14.5 61 11.5 62 12.0 63 6.5 64 3.5 65 3.0 66 2.0 67 2.0 68 1.5 69 1.0 70 0.5 71 0.5 72 1.5 73 2.0 74 1.0 75 0.0 76 0.0 77 0.5 78 1.0 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.5 92 1.0 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 1.0 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.725 #Duplication Level Percentage of deduplicated Percentage of total 1 86.38086905803442 74.05000000000001 2 11.227763196267134 19.25 3 1.9247594050743655 4.95 4 0.379119276757072 1.3 5 0.029163021289005542 0.125 6 0.029163021289005542 0.15 7 0.029163021289005542 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 7 0.17500000000000002 No Hit CGTTTAAGATCAGTTTAGTTGGACAGCTGCAGCTTCTTTCTTCGACAGTT 6 0.15 No Hit CCGGTTTGAAAGTTATAATGGAAGGAGTCGGGGCACGGCTGGGGAGGTCT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0125 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.1375 0.0 0.0 0.0 0.0 70-71 0.1875 0.0 0.0 0.0 0.0 72-73 0.23750000000000002 0.0 0.0 0.0 0.0 74-75 0.3125 0.0 0.0 0.0 0.0 76-77 0.4375 0.0 0.0 0.0 0.0 78-79 0.48750000000000004 0.0 0.0 0.0 0.0 80-81 0.6 0.0 0.0 0.0 0.0 82-83 0.8375 0.0 0.0 0.0 0.0 84-85 0.975 0.0 0.0 0.0 0.0 86-87 1.175 0.0 0.0 0.0 0.0 88-89 1.3624999999999998 0.0 0.0 0.0 0.0 90-91 1.7 0.0 0.0 0.0 0.0 92-93 1.9375 0.0 0.0 0.0 0.0 94-95 2.075 0.0 0.0 0.0 0.0 96-97 2.2750000000000004 0.0 0.0 0.0 0.0 98-99 2.5625 0.0 0.0 0.0 0.0 100-101 2.7875 0.0 0.0 0.0 0.0 102-103 3.15 0.0 0.0 0.0 0.0 104-105 3.8125 0.0 0.0 0.0 0.0 106-107 4.1625 0.0 0.0 0.0 0.0 108-109 4.475 0.0 0.0 0.0 0.0 110-111 4.9125 0.0 0.0 0.0 0.0 112-113 5.4375 0.0 0.0 0.0 0.0 114-115 6.0625 0.0 0.0 0.0 0.0 116-117 6.775 0.0 0.0 0.0 0.0 118-119 7.512499999999999 0.0 0.0 0.0 0.0 120-121 8.1875 0.0 0.0 0.0 0.0 122-123 8.837499999999999 0.0 0.0 0.0 0.0 124-125 9.55 0.0 0.0 0.0 0.0 126-127 10.4125 0.0 0.0 0.0 0.0 128-129 11.287500000000001 0.0 0.0 0.0 0.0 130-131 11.95 0.0 0.0 0.0 0.0 132-133 12.7625 0.0 0.0 0.0 0.0 134-135 13.5125 0.0 0.0 0.0 0.0 136-137 14.2375 0.0 0.0 0.0 0.0 138-139 15.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1578406 spots for SRR28623268.sra Written 1578406 spots for SRR28623268.sra Read 1578406 spots for SRR28623268.sra Written 1578406 spots for SRR28623268.sra Read 1578406 spots for SRR28623268.sra Written 1578406 spots for SRR28623268.sra Read 1578406 spots for SRR28623268.sra Written 1578406 spots for SRR28623268.sra Read 1578406 spots for SRR28623268.sra Written 1578406 spots for SRR28623268.sra Read 1578406 spots for SRR28623268.sra Written 1578406 spots for SRR28623268.sra Read 1578406 spots for SRR28623268.sra Written 1578406 spots for SRR28623268.sra Read 1578406 spots for SRR28623268.sra Written 1578406 spots for SRR28623268.sra Read 1578406 spots for SRR28623268.sra Written 1578406 spots for SRR28623268.sra Read 1578406 spots for SRR28623268.sra Written 1578406 spots for SRR28623268.sra Read 1578406 spots for SRR28623268.sra Written 1578406 spots for SRR28623268.sra Read 1578406 spots for SRR28623268.sra Written 1578406 spots for SRR28623268.sra Read 1578406 spots for SRR28623268.sra Written 1578406 spots for SRR28623268.sra Read 1578406 spots for SRR28623268.sra Written 1578406 spots for SRR28623268.sra Read 1578410 spots for SRR28623268.sra Written 1578410 spots for SRR28623268.sra Read 1578406 spots for SRR28623268.sra Written 1578406 spots for SRR28623268.sra Read 1578406 spots for SRR28623268.sra Written 1578406 spots for SRR28623268.sra Read 1578406 spots for SRR28623268.sra Written 1578406 spots for SRR28623268.sra Read 1578406 spots for SRR28623268.sra Written 1578406 spots for SRR28623268.sra Read 1578406 spots for SRR28623268.sra Written 1578406 spots for SRR28623268.sra SRR ids: ['SRR28623268.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_drib84tb SRR28623268.sra spots: 31568124 blocks: [[1, 1578406], [1578407, 3156812], [3156813, 4735218], [4735219, 6313624], [6313625, 7892030], [7892031, 9470436], [9470437, 11048842], [11048843, 12627248], [12627249, 14205654], [14205655, 15784060], [15784061, 17362466], [17362467, 18940872], [18940873, 20519278], [20519279, 22097684], [22097685, 23676090], [23676091, 25254496], [25254497, 26832902], [26832903, 28411308], [28411309, 29989714], [29989715, 31568124]] SRR28623268 file size 11656576 SRR28623268 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR28623268 SRR28623268_1.fastq SRR28623268_2.fastq Input file: SRR28623268_1.fastq Paired file: SRR28623268_2.fastq trimmed: SRR28623268-trimmed-pair1.fastq, SRR28623268-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 12:46:45 2025 >> started Tue Feb 11 12:47:34 2025 >> done (49.588s) 31568124 read pairs processed; of these: 31 ( 0.00%) short read pairs filtered out after trimming by size control 10644 ( 0.03%) empty read pairs filtered out after trimming by size control 31557449 (99.97%) read pairs available; of these: 5977759 (18.94%) trimmed read pairs available after processing 25579690 (81.06%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 2 0.00% 20 2 0.00% 21 0 0.00% 22 5 0.00% 23 2 0.00% 24 7 0.00% 25 3 0.00% 26 2 0.00% 27 6 0.00% 28 13 0.00% 29 15 0.00% 30 20 0.00% 31 14 0.00% 32 15 0.00% 33 25 0.00% 34 24 0.00% 35 30 0.00% 36 27 0.00% 37 44 0.00% 38 39 0.00% 39 45 0.00% 40 57 0.00% 41 95 0.00% 42 99 0.00% 43 89 0.00% 44 100 0.00% 45 141 0.00% 46 134 0.00% 47 166 0.00% 48 160 0.00% 49 203 0.00% 50 283 0.00% 51 294 0.00% 52 373 0.00% 53 352 0.00% 54 418 0.00% 55 465 0.00% 56 557 0.00% 57 669 0.00% 58 818 0.00% 59 946 0.00% 60 1054 0.00% 61 1221 0.00% 62 1480 0.00% 63 1649 0.01% 64 1838 0.01% 65 2166 0.01% 66 2320 0.01% 67 2744 0.01% 68 3160 0.01% 69 3616 0.01% 70 4135 0.01% 71 4796 0.02% 72 5529 0.02% 73 6465 0.02% 74 7235 0.02% 75 8156 0.03% 76 8901 0.03% 77 10060 0.03% 78 11059 0.04% 79 12417 0.04% 80 13880 0.04% 81 15569 0.05% 82 17309 0.05% 83 19185 0.06% 84 21194 0.07% 85 23476 0.07% 86 24854 0.08% 87 26778 0.08% 88 28421 0.09% 89 30538 0.10% 90 33137 0.11% 91 35290 0.11% 92 37902 0.12% 93 40614 0.13% 94 44000 0.14% 95 46967 0.15% 96 48675 0.15% 97 50798 0.16% 98 52320 0.17% 99 54711 0.17% 100 56666 0.18% 101 58752 0.19% 102 61585 0.20% 103 64652 0.20% 104 67717 0.21% 105 70094 0.22% 106 72873 0.23% 107 74513 0.24% 108 76316 0.24% 109 78395 0.25% 110 78895 0.25% 111 81534 0.26% 112 83421 0.26% 113 85016 0.27% 114 87904 0.28% 115 91388 0.29% 116 93133 0.30% 117 94676 0.30% 118 96448 0.31% 119 97496 0.31% 120 98936 0.31% 121 99921 0.32% 122 100656 0.32% 123 102974 0.33% 124 105960 0.34% 125 106845 0.34% 126 109667 0.35% 127 110248 0.35% 128 110552 0.35% 129 112550 0.36% 130 113318 0.36% 131 113943 0.36% 132 115022 0.36% 133 116685 0.37% 134 117162 0.37% 135 118575 0.38% 136 119767 0.38% 137 121450 0.38% 138 122810 0.39% 139 123660 0.39% 140 123314 0.39% 141 124245 0.39% 142 125462 0.40% 143 124410 0.39% 144 126578 0.40% 145 126634 0.40% 146 127109 0.40% 147 127898 0.41% 148 128590 0.41% 149 128760 0.41% 150 130204 0.41% 151 25579690 81.06% 31557449 reads passed initial QC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=10.48 fanout-score-rank=21 prefix-density=0.08 prefix-fanout=10.5 sequence=GGATCGGAAGAGCACACGTCTGAACTCCAGTCACTCTCTTCCATCTCGTATGCCGTCTTCTGCTTGA criterion=fanout-score sequence-density=0.05 sequence-density-rank=26 fanout-score=487.18 fanout-score-rank=1 prefix-density=0.70 prefix-fanout=32.2 sequence=TCTTCTTCTTCCT criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=10.20 fanout-score-rank=15 prefix-density=0.19 prefix-fanout=6.3 sequence=GAAGGCAATGAGA criterion=fanout-score sequence-density=0.07 sequence-density-rank=10 fanout-score=295.41 fanout-score-rank=1 prefix-density=1.02 prefix-fanout=20.8 sequence=AAGAAGAAGAAA SRR28623268 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 12:48:39 Started mapping on | Feb 11 12:48:39 Finished on | Feb 11 12:51:34 Mapping speed, Million of reads per hour | 649.18 Number of input reads | 31557449 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 29692558 Uniquely mapped reads % | 94.09% Average mapped length | 289.78 Number of splices: Total | 25974866 Number of splices: Annotated (sjdb) | 25329666 Number of splices: GT/AG | 25519278 Number of splices: GC/AG | 351691 Number of splices: AT/AC | 26729 Number of splices: Non-canonical | 77168 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.04% Deletion average length | 3.05 Insertion rate per base | 0.03% Insertion average length | 2.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 724572 % of reads mapped to multiple loci | 2.30% Number of reads mapped to too many loci | 212504 % of reads mapped to too many loci | 0.67% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.72% % of reads unmapped: other | 0.22% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1140319 1140319 1140319 N_multimapping 724572 724572 724572 N_noFeature 1351810 29283309 1553541 N_ambiguous 391466 2850 181889 UnstrandedReadsAssigned:27949282 PositiveStrandReadsAssigned:406399 NegativeStrandReadsAssigned:27957128 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR28623268 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR28623268-trimmed-pair1.fastq SRR28623268-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 31,557,449 reads, 28,322,193 reads pseudoaligned [quant] estimated average fragment length: 221.595 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,154 rounds 52401 SRR28623268.ke.tsv 34699 SRR28623268.se.tsv 87100 total ==> SRR28623268.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1797.4 953 18.7511 Potri.005G024800.1.v4.1 1035 814.405 733 31.8305 Potri.004G059700.1.v4.1 961 740.439 125 5.97036 Potri.007G009000.2.v4.1 1416 1195.4 0 0 Potri.003G141000.2.v4.1 2943 2722.4 866 11.2498 Potri.016G087400.1.v4.1 270 98.4342 2296.63 825.135 Potri.015G069301.1.v4.1 564 349.15 0 0 Potri.010G195200.1.v4.1 1773 1552.4 106 2.4148 Potri.012G127500.1.v4.1 977 756.429 11514 538.316 ==> SRR28623268.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1048 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 505 Potri.001G212900.v4.1 6 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 3 Potri.001G452600.v4.1 4 SRR28623268 completed mapping pipeline successfully