Starting /dee2/code/volunteer_pipeline.sh SRR28623269 current disk space = 3088778113024 free memory = 1449352904 SRR28623269 SRAfilesize cadf3dd049a5f930aeae9dc38722d7ac SRR28623269.sra SRR28623269.sra file validated SRR28623269 is paired end SRR28623269 is conventional basespace SRR28623269 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623269_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4005 37.0 37.0 37.0 37.0 37.0 2 36.3815 37.0 37.0 37.0 37.0 37.0 3 36.56 37.0 37.0 37.0 37.0 37.0 4 36.492 37.0 37.0 37.0 37.0 37.0 5 36.5475 37.0 37.0 37.0 37.0 37.0 6 36.562 37.0 37.0 37.0 37.0 37.0 7 36.54 37.0 37.0 37.0 37.0 37.0 8 36.3915 37.0 37.0 37.0 37.0 37.0 9 36.589 37.0 37.0 37.0 37.0 37.0 10-14 36.5383 37.0 37.0 37.0 37.0 37.0 15-19 36.48559999999999 37.0 37.0 37.0 37.0 37.0 20-24 36.496 37.0 37.0 37.0 37.0 37.0 25-29 36.4313 37.0 37.0 37.0 37.0 37.0 30-34 36.445299999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.3673 37.0 37.0 37.0 37.0 37.0 40-44 36.3606 37.0 37.0 37.0 37.0 37.0 45-49 36.3192 37.0 37.0 37.0 37.0 37.0 50-54 36.286199999999994 37.0 37.0 37.0 37.0 37.0 55-59 36.26050000000001 37.0 37.0 37.0 37.0 37.0 60-64 36.3019 37.0 37.0 37.0 37.0 37.0 65-69 36.2444 37.0 37.0 37.0 37.0 37.0 70-74 36.1733 37.0 37.0 37.0 37.0 37.0 75-79 36.083099999999995 37.0 37.0 37.0 37.0 37.0 80-84 36.01520000000001 37.0 37.0 37.0 37.0 37.0 85-89 36.0619 37.0 37.0 37.0 37.0 37.0 90-94 35.981199999999994 37.0 37.0 37.0 37.0 37.0 95-99 35.8649 37.0 37.0 37.0 37.0 37.0 100-104 35.991 37.0 37.0 37.0 37.0 37.0 105-109 35.8899 37.0 37.0 37.0 37.0 37.0 110-114 35.799 37.0 37.0 37.0 37.0 37.0 115-119 35.838499999999996 37.0 37.0 37.0 37.0 37.0 120-124 35.6836 37.0 37.0 37.0 37.0 37.0 125-129 35.5689 37.0 37.0 37.0 37.0 37.0 130-134 35.700599999999994 37.0 37.0 37.0 37.0 37.0 135-139 35.4505 37.0 37.0 37.0 37.0 37.0 140-144 35.1687 37.0 37.0 37.0 27.4 37.0 145-149 35.154999999999994 37.0 37.0 37.0 29.8 37.0 150-151 34.9665 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 1.0 23 2.0 24 2.0 25 5.0 26 8.0 27 16.0 28 16.0 29 23.0 30 35.0 31 42.0 32 51.0 33 111.0 34 171.0 35 410.0 36 2857.0 37 249.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.71399899648771 12.819869543401907 8.680381334671349 38.78575012543904 2 18.625 14.899999999999999 35.3 31.175000000000004 3 18.175 17.325 28.65 35.85 4 22.8 24.099999999999998 25.974999999999998 27.125 5 23.625 32.475 23.674999999999997 20.225 6 21.125 34.525 22.7 21.65 7 15.225 26.625 41.625 16.525000000000002 8 17.375 27.400000000000002 32.625 22.6 9 17.675 23.7 35.35 23.275000000000002 10-14 19.73 30.385 28.07 21.815 15-19 19.685 29.01 27.839999999999996 23.465 20-24 19.275000000000002 29.14 28.33 23.255 25-29 19.775000000000002 29.189999999999998 27.755000000000003 23.28 30-34 19.77 29.12 28.060000000000002 23.05 35-39 20.145 28.999999999999996 27.83 23.025000000000002 40-44 20.345 28.315 28.075 23.265 45-49 19.89 29.294999999999998 27.675 23.14 50-54 19.845 28.810000000000002 27.55 23.794999999999998 55-59 19.86 29.220000000000002 27.98 22.939999999999998 60-64 20.705000000000002 28.884999999999998 27.755000000000003 22.655 65-69 19.935 28.095 28.475 23.494999999999997 70-74 20.07 28.705000000000002 28.21 23.015 75-79 20.175 28.98 27.529999999999998 23.315 80-84 20.235 28.615000000000002 27.615000000000002 23.535 85-89 20.424999999999997 29.085 27.689999999999998 22.8 90-94 20.695 29.24 27.339999999999996 22.725 95-99 19.775000000000002 28.78 27.97 23.474999999999998 100-104 20.595 29.015 27.415 22.975 105-109 20.36 28.799999999999997 27.37 23.47 110-114 20.185 29.195 27.675 22.945 115-119 20.805 28.63 27.245 23.32 120-124 20.48 29.054999999999996 27.075 23.39 125-129 20.580000000000002 28.415000000000003 26.97 24.035 130-134 21.185000000000002 28.59 26.735 23.49 135-139 21.235 27.82 27.18 23.765 140-144 20.465 29.005 26.27 24.26 145-149 20.849999999999998 29.205 25.935000000000002 24.01 150-151 22.55 28.075 25.637500000000003 23.7375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.5 16 1.0 17 0.5 18 1.0 19 0.5 20 0.5 21 0.5 22 2.0 23 3.0 24 4.5 25 5.5 26 6.0 27 12.0 28 16.0 29 19.5 30 25.5 31 29.5 32 42.5 33 54.5 34 60.5 35 82.5 36 111.5 37 124.5 38 139.5 39 167.0 40 205.5 41 224.0 42 239.5 43 255.5 44 256.0 45 250.0 46 249.5 47 248.0 48 220.0 49 190.0 50 153.0 51 128.5 52 114.5 53 88.5 54 62.0 55 44.5 56 35.0 57 27.5 58 18.0 59 11.5 60 13.0 61 12.5 62 9.0 63 8.0 64 6.0 65 5.5 66 5.0 67 4.0 68 2.0 69 0.5 70 0.5 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.35000000000000003 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 86.97500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 87.38143144581775 76.0 2 10.60649611957459 18.45 3 1.7821212992239148 4.65 4 0.1724633515377982 0.6 5 0.028743891922966367 0.125 6 0.0 0.0 7 0.028743891922966367 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGAGAAAGTAGAGTTGGATGCAGAGGACGATTGGGGGACCCACTCACATT 7 0.17500000000000002 No Hit TGCTGCTGCTTCATATATACAATACATCACCATAGATATAGAGCTGAAAC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.07500000000000001 0.0 0.0 0.0 0.0 70-71 0.1125 0.0 0.0 0.0 0.0 72-73 0.16249999999999998 0.0 0.0 0.0 0.0 74-75 0.2375 0.0 0.0 0.0 0.0 76-77 0.3125 0.0 0.0 0.0 0.0 78-79 0.375 0.0 0.0 0.0 0.0 80-81 0.44999999999999996 0.0 0.0 0.0 0.0 82-83 0.5125 0.0 0.0 0.0 0.0 84-85 0.5874999999999999 0.0 0.0 0.0 0.0 86-87 0.7875 0.0 0.0 0.0 0.0 88-89 1.0125 0.0 0.0 0.0 0.0 90-91 1.1125 0.0 0.0 0.0 0.0 92-93 1.2999999999999998 0.0 0.0 0.0 0.0 94-95 1.65 0.0 0.0 0.0 0.0 96-97 1.975 0.0 0.0 0.0 0.0 98-99 2.1625 0.0 0.0 0.0 0.0 100-101 2.3 0.0 0.0 0.0 0.0 102-103 2.5 0.0 0.0 0.0 0.0 104-105 2.8125 0.0 0.0 0.0 0.0 106-107 3.1375 0.0 0.0 0.0 0.0 108-109 3.4124999999999996 0.0 0.0 0.0 0.0 110-111 3.9749999999999996 0.0 0.0 0.0 0.0 112-113 4.5375 0.0 0.0 0.0 0.0 114-115 4.8375 0.0 0.0 0.0 0.0 116-117 5.275 0.0 0.0 0.0 0.0 118-119 5.824999999999999 0.0 0.0 0.0 0.0 120-121 6.4 0.0 0.0 0.0 0.0 122-123 6.9625 0.0 0.0 0.0 0.0 124-125 7.65 0.0 0.0 0.0 0.0 126-127 8.3375 0.0 0.0 0.0 0.0 128-129 8.9875 0.0 0.0 0.0 0.0 130-131 9.6375 0.0 0.0 0.0 0.0 132-133 10.4 0.0 0.0 0.0 0.0 134-135 11.25 0.0 0.0 0.0 0.0 136-137 12.0625 0.0 0.0 0.0 0.0 138-139 12.775 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGTTAAG 10 0.006830828 145.0 7 >>END_MODULE SRR28623269 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623269_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.6695 37.0 37.0 37.0 37.0 37.0 2 36.225 37.0 37.0 37.0 37.0 37.0 3 36.181 37.0 37.0 37.0 37.0 37.0 4 36.2155 37.0 37.0 37.0 37.0 37.0 5 36.23 37.0 37.0 37.0 37.0 37.0 6 36.1725 37.0 37.0 37.0 37.0 37.0 7 36.2305 37.0 37.0 37.0 37.0 37.0 8 36.122 37.0 37.0 37.0 37.0 37.0 9 36.19 37.0 37.0 37.0 37.0 37.0 10-14 36.1411 37.0 37.0 37.0 37.0 37.0 15-19 36.083800000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.052299999999995 37.0 37.0 37.0 37.0 37.0 25-29 36.0303 37.0 37.0 37.0 37.0 37.0 30-34 35.9585 37.0 37.0 37.0 37.0 37.0 35-39 35.8858 37.0 37.0 37.0 37.0 37.0 40-44 35.8231 37.0 37.0 37.0 37.0 37.0 45-49 35.9019 37.0 37.0 37.0 37.0 37.0 50-54 35.9018 37.0 37.0 37.0 37.0 37.0 55-59 35.789 37.0 37.0 37.0 37.0 37.0 60-64 35.7449 37.0 37.0 37.0 37.0 37.0 65-69 35.76520000000001 37.0 37.0 37.0 37.0 37.0 70-74 35.831199999999995 37.0 37.0 37.0 37.0 37.0 75-79 35.789 37.0 37.0 37.0 37.0 37.0 80-84 35.6357 37.0 37.0 37.0 37.0 37.0 85-89 35.6244 37.0 37.0 37.0 37.0 37.0 90-94 35.6004 37.0 37.0 37.0 37.0 37.0 95-99 35.6354 37.0 37.0 37.0 37.0 37.0 100-104 35.52329999999999 37.0 37.0 37.0 37.0 37.0 105-109 35.446000000000005 37.0 37.0 37.0 37.0 37.0 110-114 35.43149999999999 37.0 37.0 37.0 37.0 37.0 115-119 35.3765 37.0 37.0 37.0 37.0 37.0 120-124 35.411699999999996 37.0 37.0 37.0 37.0 37.0 125-129 34.9482 37.0 37.0 37.0 27.4 37.0 130-134 35.2569 37.0 37.0 37.0 34.6 37.0 135-139 34.935500000000005 37.0 37.0 37.0 25.0 37.0 140-144 35.064 37.0 37.0 37.0 27.4 37.0 145-149 34.96849999999999 37.0 37.0 37.0 27.4 37.0 150-151 34.64775 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 3.0 14 11.0 15 7.0 16 4.0 17 1.0 18 0.0 19 4.0 20 3.0 21 5.0 22 6.0 23 11.0 24 12.0 25 8.0 26 13.0 27 17.0 28 10.0 29 21.0 30 24.0 31 53.0 32 54.0 33 112.0 34 208.0 35 661.0 36 2507.0 37 244.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.9 17.224999999999998 12.275 26.6 2 27.650000000000002 25.95 30.275000000000002 16.125 3 22.675 28.4 29.9 19.025 4 26.05 32.074999999999996 22.775000000000002 19.1 5 25.424999999999997 35.525 22.925 16.125 6 21.275 38.425 23.45 16.85 7 20.65 22.1 38.15 19.1 8 22.525000000000002 24.575 27.975 24.925 9 22.15 26.174999999999997 30.9 20.775 10-14 23.98 29.435 26.174999999999997 20.41 15-19 23.015 28.225 28.115000000000002 20.645 20-24 23.599999999999998 28.645 27.22 20.535 25-29 23.57 27.839999999999996 27.700000000000003 20.89 30-34 23.21 28.595 27.685 20.51 35-39 23.23 28.32 27.894999999999996 20.555 40-44 22.830000000000002 28.475 28.185 20.51 45-49 22.770000000000003 28.83 28.355000000000004 20.044999999999998 50-54 23.035 28.444999999999997 27.88 20.64 55-59 23.59 27.950000000000003 28.305000000000003 20.155 60-64 23.36 27.91 27.77 20.96 65-69 22.455 28.555000000000003 28.315 20.674999999999997 70-74 23.785 27.950000000000003 28.4 19.865 75-79 23.595 28.08 27.900000000000002 20.424999999999997 80-84 23.395 27.985 28.134999999999998 20.485 85-89 23.13 28.93 27.33 20.61 90-94 23.18 28.815 27.725 20.28 95-99 23.375 28.04 28.105000000000004 20.48 100-104 23.65 28.225 27.944999999999997 20.18 105-109 23.605 28.37 27.99 20.035 110-114 24.2 29.205 26.834999999999997 19.759999999999998 115-119 23.93 28.675 27.589999999999996 19.805 120-124 23.915 28.73 27.815 19.54 125-129 24.97 28.994999999999997 26.965 19.07 130-134 25.019999999999996 28.689999999999998 26.55 19.74 135-139 25.64 28.389999999999997 27.005000000000003 18.965 140-144 25.629999999999995 28.754999999999995 26.815 18.8 145-149 25.81 28.689999999999998 26.775 18.725 150-151 26.487500000000004 27.975 26.650000000000002 18.8875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 1.5 6 1.0 7 0.0 8 0.5 9 2.0 10 2.0 11 1.5 12 1.5 13 1.0 14 1.0 15 1.5 16 2.0 17 1.5 18 1.0 19 2.0 20 1.5 21 0.5 22 1.0 23 2.5 24 3.0 25 3.5 26 4.0 27 4.0 28 7.5 29 15.5 30 16.0 31 18.0 32 30.5 33 48.0 34 61.5 35 69.0 36 88.5 37 118.0 38 147.0 39 162.5 40 191.0 41 232.0 42 245.0 43 241.5 44 267.5 45 282.5 46 262.0 47 225.5 48 210.0 49 212.5 50 172.5 51 138.0 52 123.0 53 95.5 54 67.0 55 51.5 56 36.5 57 24.0 58 19.0 59 12.5 60 10.0 61 15.0 62 12.0 63 6.0 64 5.5 65 3.5 66 1.5 67 0.5 68 0.5 69 1.0 70 1.0 71 1.0 72 2.0 73 1.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.5 85 0.5 86 0.0 87 1.0 88 1.5 89 0.5 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 87.775 #Duplication Level Percentage of deduplicated Percentage of total 1 88.1800056963828 77.4 2 10.054115636570778 17.65 3 1.5380233551694675 4.05 4 0.1708914839077186 0.6 5 0.02848191398461977 0.125 6 0.0 0.0 7 0.02848191398461977 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCCCTCCACGTTTTACTATCTCTGCTTCTGATCTCCGTTTTTGCATCTC 7 0.17500000000000002 No Hit CCACCTCCAACACCAGCTAGTTACCGGACGGCAAAGCGAAGAAAGGGAAT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.1375 0.0 0.0 0.0 0.0 74-75 0.21250000000000002 0.0 0.0 0.0 0.0 76-77 0.2875 0.0 0.0 0.0 0.0 78-79 0.3625 0.0 0.0 0.0 0.0 80-81 0.44999999999999996 0.0 0.0 0.0 0.0 82-83 0.5125 0.0 0.0 0.0 0.0 84-85 0.5874999999999999 0.0 0.0 0.0 0.0 86-87 0.7875 0.0 0.0 0.0 0.0 88-89 1.0375 0.0 0.0 0.0 0.0 90-91 1.1375 0.0 0.0 0.0 0.0 92-93 1.3250000000000002 0.0 0.0 0.0 0.0 94-95 1.6875 0.0 0.0 0.0 0.0 96-97 2.025 0.0 0.0 0.0 0.0 98-99 2.2125 0.0 0.0 0.0 0.0 100-101 2.3625 0.0 0.0 0.0 0.0 102-103 2.6125 0.0 0.0 0.0 0.0 104-105 2.9625 0.0 0.0 0.0 0.0 106-107 3.2875 0.0 0.0 0.0 0.0 108-109 3.5625 0.0 0.0 0.0 0.0 110-111 4.125 0.0 0.0 0.0 0.0 112-113 4.675 0.0 0.0 0.0 0.0 114-115 4.9625 0.0 0.0 0.0 0.0 116-117 5.4 0.0 0.0 0.0 0.0 118-119 5.949999999999999 0.0 0.0 0.0 0.0 120-121 6.525 0.0 0.0 0.0 0.0 122-123 7.1 0.0 0.0 0.0 0.0 124-125 7.800000000000001 0.0 0.0 0.0 0.0 126-127 8.4625 0.0 0.0 0.0 0.0 128-129 9.1125 0.0 0.0 0.0 0.0 130-131 9.7625 0.0 0.0 0.0 0.0 132-133 10.525 0.0 0.0 0.0 0.0 134-135 11.399999999999999 0.0 0.0 0.0 0.0 136-137 12.212499999999999 0.0 0.0 0.0 0.0 138-139 12.95 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1485936 spots for SRR28623269.sra Written 1485936 spots for SRR28623269.sra Read 1485936 spots for SRR28623269.sra Written 1485936 spots for SRR28623269.sra Read 1485936 spots for SRR28623269.sra Written 1485936 spots for SRR28623269.sra Read 1485936 spots for SRR28623269.sra Written 1485936 spots for SRR28623269.sra Read 1485936 spots for SRR28623269.sra Written 1485936 spots for SRR28623269.sra Read 1485936 spots for SRR28623269.sra Written 1485936 spots for SRR28623269.sra Read 1485936 spots for SRR28623269.sra Written 1485936 spots for SRR28623269.sra Read 1485936 spots for SRR28623269.sra Written 1485936 spots for SRR28623269.sra Read 1485936 spots for SRR28623269.sra Written 1485936 spots for SRR28623269.sra Read 1485936 spots for SRR28623269.sra Written 1485936 spots for SRR28623269.sra Read 1485936 spots for SRR28623269.sra Written 1485936 spots for SRR28623269.sra Read 1485937 spots for SRR28623269.sra Written 1485937 spots for SRR28623269.sra Read 1485936 spots for SRR28623269.sra Written 1485936 spots for SRR28623269.sra Read 1485936 spots for SRR28623269.sra Written 1485936 spots for SRR28623269.sra Read 1485936 spots for SRR28623269.sra Written 1485936 spots for SRR28623269.sra Read 1485936 spots for SRR28623269.sra Written 1485936 spots for SRR28623269.sra Read 1485936 spots for SRR28623269.sra Written 1485936 spots for SRR28623269.sra Read 1485936 spots for SRR28623269.sra Written 1485936 spots for SRR28623269.sra Read 1485936 spots for SRR28623269.sra Written 1485936 spots for SRR28623269.sra Read 1485936 spots for SRR28623269.sra Written 1485936 spots for SRR28623269.sra SRR ids: ['SRR28623269.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_fqcd13sn SRR28623269.sra spots: 29718721 blocks: [[1, 1485936], [1485937, 2971872], [2971873, 4457808], [4457809, 5943744], [5943745, 7429680], [7429681, 8915616], [8915617, 10401552], [10401553, 11887488], [11887489, 13373424], [13373425, 14859360], [14859361, 16345296], [16345297, 17831232], [17831233, 19317168], [19317169, 20803104], [20803105, 22289040], [22289041, 23774976], [23774977, 25260912], [25260913, 26746848], [26746849, 28232784], [28232785, 29718721]] SRR28623269 file size 10973052 SRR28623269 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR28623269 SRR28623269_1.fastq SRR28623269_2.fastq Input file: SRR28623269_1.fastq Paired file: SRR28623269_2.fastq trimmed: SRR28623269-trimmed-pair1.fastq, SRR28623269-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 15:54:13 2025 >> started Thu Feb 13 15:54:46 2025 >> done (32.944s) 29718721 read pairs processed; of these: 32 ( 0.00%) short read pairs filtered out after trimming by size control 14377 ( 0.05%) empty read pairs filtered out after trimming by size control 29704312 (99.95%) read pairs available; of these: 5160010 (17.37%) trimmed read pairs available after processing 24544302 (82.63%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 3 0.00% 20 3 0.00% 21 8 0.00% 22 2 0.00% 23 3 0.00% 24 7 0.00% 25 10 0.00% 26 5 0.00% 27 8 0.00% 28 13 0.00% 29 6 0.00% 30 11 0.00% 31 8 0.00% 32 15 0.00% 33 19 0.00% 34 19 0.00% 35 20 0.00% 36 24 0.00% 37 29 0.00% 38 38 0.00% 39 24 0.00% 40 41 0.00% 41 54 0.00% 42 62 0.00% 43 73 0.00% 44 78 0.00% 45 97 0.00% 46 101 0.00% 47 136 0.00% 48 166 0.00% 49 179 0.00% 50 225 0.00% 51 257 0.00% 52 285 0.00% 53 355 0.00% 54 420 0.00% 55 521 0.00% 56 557 0.00% 57 685 0.00% 58 704 0.00% 59 844 0.00% 60 1083 0.00% 61 1279 0.00% 62 1441 0.00% 63 1745 0.01% 64 1890 0.01% 65 2193 0.01% 66 2598 0.01% 67 2884 0.01% 68 3354 0.01% 69 3943 0.01% 70 4524 0.02% 71 5212 0.02% 72 5900 0.02% 73 6932 0.02% 74 7689 0.03% 75 8611 0.03% 76 9541 0.03% 77 10346 0.03% 78 11698 0.04% 79 13107 0.04% 80 14271 0.05% 81 15916 0.05% 82 17516 0.06% 83 18747 0.06% 84 20792 0.07% 85 22233 0.07% 86 23342 0.08% 87 25203 0.08% 88 26906 0.09% 89 28509 0.10% 90 30264 0.10% 91 32606 0.11% 92 33732 0.11% 93 35797 0.12% 94 37868 0.13% 95 39912 0.13% 96 42104 0.14% 97 43116 0.15% 98 44836 0.15% 99 47219 0.16% 100 48471 0.16% 101 50235 0.17% 102 52069 0.18% 103 54614 0.18% 104 56118 0.19% 105 57763 0.19% 106 59850 0.20% 107 61248 0.21% 108 63794 0.21% 109 65058 0.22% 110 66155 0.22% 111 68219 0.23% 112 69472 0.23% 113 70857 0.24% 114 72890 0.25% 115 75185 0.25% 116 76731 0.26% 117 78256 0.26% 118 80132 0.27% 119 80944 0.27% 120 82584 0.28% 121 84838 0.29% 122 85528 0.29% 123 86891 0.29% 124 88513 0.30% 125 90404 0.30% 126 91472 0.31% 127 93119 0.31% 128 94418 0.32% 129 95495 0.32% 130 97781 0.33% 131 97930 0.33% 132 99201 0.33% 133 101446 0.34% 134 100559 0.34% 135 102663 0.35% 136 103424 0.35% 137 104553 0.35% 138 105011 0.35% 139 107047 0.36% 140 106783 0.36% 141 107661 0.36% 142 109339 0.37% 143 109545 0.37% 144 112373 0.38% 145 112557 0.38% 146 112185 0.38% 147 112725 0.38% 148 114391 0.39% 149 113615 0.38% 150 114923 0.39% 151 24544302 82.63% 29704312 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=14.69 fanout-score-rank=15 prefix-density=0.14 prefix-fanout=14.7 sequence=GGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGAATGCCATCTCGTATGCCGTCTTCTGCTTG criterion=fanout-score sequence-density=0.06 sequence-density-rank=24 fanout-score=415.42 fanout-score-rank=1 prefix-density=0.92 prefix-fanout=28.3 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=17.30 fanout-score-rank=10 prefix-density=0.17 prefix-fanout=16.1 sequence=GAGAGAGAGAGTTAAGACAATGGCCTCGAAGAAATCTGCAATCGTATTACCTGGTTCAAAGGTGTTGAAGCACATAGTTTTTGTACGGTTTAATGATGGGATCACTGATGAACAAATTGAGAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=464.69 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=23.7 sequence=ACAAGAAGATCAACTGTCTCTCTGCCTGGTTTGTATTCCAAGAAATGGAGAAAGTCCAAAAGCTCTTTTGTGTGGCTCTATTGCTTGCAGTACTAGCCATAGCAAGCAATATTGCGAATGCCCAGAGTACCATATGCAAAATGCCTGTTGCTGGCCTAATGTCATGCAAGCCTTCTGTAACTCCTCCTAACCCTACCGCACCCTCGGCAGACTGCTGCTCGGCACTTTCGCATGCTGACATAAACTGCCTTTGCTCCTACAAAAATTCCAACCTGCTCCCTTCCCTTGGAATCGACCCAAAACTTGCCATGCAGCTCCCTGGCAAGTGCAAGCTTCCTCACCCTGCTAATTGCTAGACTACCGATCGTAATCGATCCAA SRR28623269 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 15:55:33 Started mapping on | Feb 13 15:55:33 Finished on | Feb 13 15:58:56 Mapping speed, Million of reads per hour | 526.78 Number of input reads | 29704312 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 27562449 Uniquely mapped reads % | 92.79% Average mapped length | 290.51 Number of splices: Total | 24524397 Number of splices: Annotated (sjdb) | 23899594 Number of splices: GT/AG | 24083992 Number of splices: GC/AG | 339143 Number of splices: AT/AC | 26744 Number of splices: Non-canonical | 74518 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 3.04 Insertion rate per base | 0.03% Insertion average length | 2.42 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 694715 % of reads mapped to multiple loci | 2.34% Number of reads mapped to too many loci | 188429 % of reads mapped to too many loci | 0.63% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.00% % of reads unmapped: other | 0.24% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1447148 1447148 1447148 N_multimapping 694715 694715 694715 N_noFeature 1303421 27208164 1494137 N_ambiguous 313677 2465 148370 UnstrandedReadsAssigned:25945351 PositiveStrandReadsAssigned:351820 NegativeStrandReadsAssigned:25919942 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR28623269 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR28623269-trimmed-pair1.fastq SRR28623269-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 29,704,312 reads, 26,350,116 reads pseudoaligned [quant] estimated average fragment length: 225.845 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,110 rounds 52401 SRR28623269.ke.tsv 34699 SRR28623269.se.tsv 87100 total ==> SRR28623269.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1793.15 1022 21.5167 Potri.005G024800.1.v4.1 1035 810.155 567 26.4216 Potri.004G059700.1.v4.1 961 736.189 367 18.82 Potri.007G009000.2.v4.1 1416 1191.15 0 0 Potri.003G141000.2.v4.1 2943 2718.15 747.315 10.3794 Potri.016G087400.1.v4.1 270 96.7146 2077.66 811.01 Potri.015G069301.1.v4.1 564 344.668 0 0 Potri.010G195200.1.v4.1 1773 1548.15 38 0.926643 Potri.012G127500.1.v4.1 977 752.175 14943 750.002 ==> SRR28623269.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2366 Potri.001G233950.v4.1 3 Potri.001G122700.v4.1 521 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 46 Potri.001G452600.v4.1 2 SRR28623269 completed mapping pipeline successfully