Starting /dee2/code/volunteer_pipeline.sh SRR28623270 current disk space = 3088922394624 free memory = 1476626572 SRR28623270 SRAfilesize 6fe8a87f87c53a11289b503464f22994 SRR28623270.sra SRR28623270.sra file validated SRR28623270 is paired end SRR28623270 is conventional basespace SRR28623270 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623270_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.33375 37.0 37.0 37.0 37.0 37.0 2 36.428 37.0 37.0 37.0 37.0 37.0 3 36.586 37.0 37.0 37.0 37.0 37.0 4 36.6435 37.0 37.0 37.0 37.0 37.0 5 36.6775 37.0 37.0 37.0 37.0 37.0 6 36.6585 37.0 37.0 37.0 37.0 37.0 7 36.5745 37.0 37.0 37.0 37.0 37.0 8 36.4595 37.0 37.0 37.0 37.0 37.0 9 36.6805 37.0 37.0 37.0 37.0 37.0 10-14 36.6237 37.0 37.0 37.0 37.0 37.0 15-19 36.5701 37.0 37.0 37.0 37.0 37.0 20-24 36.5683 37.0 37.0 37.0 37.0 37.0 25-29 36.4807 37.0 37.0 37.0 37.0 37.0 30-34 36.46809999999999 37.0 37.0 37.0 37.0 37.0 35-39 36.4399 37.0 37.0 37.0 37.0 37.0 40-44 36.403 37.0 37.0 37.0 37.0 37.0 45-49 36.3442 37.0 37.0 37.0 37.0 37.0 50-54 36.353899999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.327999999999996 37.0 37.0 37.0 37.0 37.0 60-64 36.3002 37.0 37.0 37.0 37.0 37.0 65-69 36.2836 37.0 37.0 37.0 37.0 37.0 70-74 36.2383 37.0 37.0 37.0 37.0 37.0 75-79 36.1861 37.0 37.0 37.0 37.0 37.0 80-84 36.05929999999999 37.0 37.0 37.0 37.0 37.0 85-89 36.0972 37.0 37.0 37.0 37.0 37.0 90-94 36.0576 37.0 37.0 37.0 37.0 37.0 95-99 35.8854 37.0 37.0 37.0 37.0 37.0 100-104 36.000099999999996 37.0 37.0 37.0 37.0 37.0 105-109 35.98140000000001 37.0 37.0 37.0 37.0 37.0 110-114 35.873099999999994 37.0 37.0 37.0 37.0 37.0 115-119 35.838499999999996 37.0 37.0 37.0 37.0 37.0 120-124 35.737399999999994 37.0 37.0 37.0 37.0 37.0 125-129 35.6657 37.0 37.0 37.0 37.0 37.0 130-134 35.8381 37.0 37.0 37.0 37.0 37.0 135-139 35.671299999999995 37.0 37.0 37.0 37.0 37.0 140-144 35.4355 37.0 37.0 37.0 34.6 37.0 145-149 35.4593 37.0 37.0 37.0 34.6 37.0 150-151 35.31675 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 2.0 22 2.0 23 2.0 24 3.0 25 4.0 26 9.0 27 7.0 28 15.0 29 12.0 30 30.0 31 33.0 32 47.0 33 84.0 34 160.0 35 376.0 36 2964.0 37 249.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.990208385638965 13.005272407732866 10.39417524479036 43.61034396183781 2 18.125 14.774999999999999 37.15 29.95 3 18.8 17.125 28.325 35.75 4 22.0 24.975 25.45 27.575 5 24.525 32.5 23.575 19.400000000000002 6 22.375 34.1 22.15 21.375 7 15.0 28.125 39.475 17.4 8 16.85 29.175 31.424999999999997 22.55 9 17.775 24.675 34.825 22.725 10-14 19.855 30.235 27.435 22.475 15-19 20.06 28.035 28.33 23.575 20-24 20.119999999999997 28.315 28.155 23.41 25-29 19.759999999999998 29.104999999999997 27.88 23.255 30-34 19.46 28.910000000000004 27.68 23.95 35-39 19.775000000000002 29.220000000000002 27.455000000000002 23.549999999999997 40-44 19.855 29.349999999999998 26.795 24.0 45-49 20.205000000000002 28.410000000000004 28.03 23.355 50-54 20.755000000000003 28.27 27.565 23.41 55-59 20.03 28.945 27.07 23.955000000000002 60-64 20.935000000000002 27.865000000000002 27.529999999999998 23.669999999999998 65-69 20.880000000000003 28.485 27.24 23.395 70-74 20.325 28.904999999999998 27.395000000000003 23.375 75-79 20.09 29.03 27.275 23.605 80-84 20.69 28.115000000000002 27.825 23.369999999999997 85-89 20.435 28.749999999999996 27.310000000000002 23.505000000000003 90-94 20.18 28.439999999999998 27.689999999999998 23.69 95-99 20.31 27.99 27.63 24.07 100-104 20.525 28.365000000000002 27.515 23.595 105-109 20.990000000000002 29.175 27.105 22.73 110-114 21.14 28.689999999999998 26.790000000000003 23.380000000000003 115-119 20.86 29.12 27.07 22.95 120-124 21.37 28.275 26.985 23.369999999999997 125-129 21.445 28.67 25.825 24.060000000000002 130-134 21.32 28.84 26.41 23.43 135-139 21.709999999999997 28.175 26.884999999999998 23.23 140-144 21.695 28.185 26.1 24.02 145-149 21.9 27.525 26.435 24.14 150-151 22.475 27.8875 25.7625 23.875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 1.0 23 1.5 24 2.0 25 3.5 26 4.5 27 7.0 28 12.5 29 18.5 30 24.0 31 27.0 32 38.0 33 48.0 34 54.0 35 71.5 36 89.5 37 111.0 38 138.0 39 161.0 40 180.5 41 222.0 42 245.0 43 238.5 44 238.5 45 263.5 46 270.5 47 236.0 48 202.0 49 198.5 50 203.5 51 170.0 52 134.0 53 96.0 54 69.0 55 57.5 56 42.0 57 28.5 58 24.0 59 19.0 60 13.5 61 11.5 62 6.5 63 4.0 64 5.0 65 3.0 66 0.5 67 0.5 68 0.5 69 0.5 70 0.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.42500000000000004 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.375 #Duplication Level Percentage of deduplicated Percentage of total 1 83.92803598200899 69.975 2 13.043478260869565 21.75 3 2.39880059970015 6.0 4 0.4197901049475262 1.4000000000000001 5 0.2098950524737631 0.8750000000000001 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGTGCTTCACCATCTTCATAACTGAAATTTCTCTCTTGATTTGCTCCA 5 0.125 No Hit CGTCGAGTTATCTAGCCAGGGGCAACGATATGTTTTCAGTACTGATGTGT 5 0.125 No Hit AGCACCAAACACAGATCTCATAACCACATTTGCATGGCTTCAATTGCTGA 5 0.125 No Hit GTTGGTCTTTCCATGTAACTGTTTGAAGAGCACACGACCTCAACCAATGC 5 0.125 No Hit TTTTTTTTTCACAGTATGTGCACGAATCAGGTTTACAACGAATAATTTCA 5 0.125 No Hit GCCTGGATGACATGACTCGAGAGAGCAGCGACAAATTGACCCCTTCGAGT 5 0.125 No Hit CTTCAATCTCAAATCCATTAAATCCCTTGTAGGTCCACTATATAAATCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.21250000000000002 0.0 0.0 0.0 0.0 78-79 0.2625 0.0 0.0 0.0 0.0 80-81 0.4 0.0 0.0 0.0 0.0 82-83 0.45 0.0 0.0 0.0 0.0 84-85 0.5 0.0 0.0 0.0 0.0 86-87 0.5625 0.0 0.0 0.0 0.0 88-89 0.6375 0.0 0.0 0.0 0.0 90-91 0.8500000000000001 0.0 0.0 0.0 0.0 92-93 1.1625 0.0 0.0 0.0 0.0 94-95 1.3125 0.0 0.0 0.0 0.0 96-97 1.5125 0.0 0.0 0.0 0.0 98-99 1.8 0.0 0.0 0.0 0.0 100-101 2.1375 0.0 0.0 0.0 0.0 102-103 2.3875 0.0 0.0 0.0 0.0 104-105 2.7375 0.0 0.0 0.0 0.0 106-107 3.125 0.0 0.0 0.0 0.0 108-109 3.65 0.0 0.0 0.0 0.0 110-111 4.125 0.0 0.0 0.0 0.0 112-113 4.55 0.0 0.0 0.0 0.0 114-115 4.9125 0.0 0.0 0.0 0.0 116-117 5.675000000000001 0.0 0.0 0.0 0.0 118-119 6.2125 0.0 0.0 0.0 0.0 120-121 6.6875 0.0 0.0 0.0 0.0 122-123 7.375 0.0 0.0 0.0 0.0 124-125 7.862500000000001 0.0 0.0 0.0 0.0 126-127 8.125 0.0 0.0 0.0 0.0 128-129 8.725 0.0 0.0 0.0 0.0 130-131 9.45 0.0 0.0 0.0 0.0 132-133 10.2375 0.0 0.0 0.0 0.0 134-135 11.087499999999999 0.0 0.0 0.0 0.0 136-137 11.85 0.0 0.0 0.0 0.0 138-139 12.537500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCACGCT 20 0.00593511 29.0 135-139 >>END_MODULE SRR28623270 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623270_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.642 37.0 37.0 37.0 37.0 37.0 2 36.2335 37.0 37.0 37.0 37.0 37.0 3 36.228 37.0 37.0 37.0 37.0 37.0 4 36.357 37.0 37.0 37.0 37.0 37.0 5 36.3885 37.0 37.0 37.0 37.0 37.0 6 36.2835 37.0 37.0 37.0 37.0 37.0 7 36.3185 37.0 37.0 37.0 37.0 37.0 8 36.226 37.0 37.0 37.0 37.0 37.0 9 36.216 37.0 37.0 37.0 37.0 37.0 10-14 36.203100000000006 37.0 37.0 37.0 37.0 37.0 15-19 36.2 37.0 37.0 37.0 37.0 37.0 20-24 36.1382 37.0 37.0 37.0 37.0 37.0 25-29 36.1634 37.0 37.0 37.0 37.0 37.0 30-34 36.0476 37.0 37.0 37.0 37.0 37.0 35-39 36.0073 37.0 37.0 37.0 37.0 37.0 40-44 35.95720000000001 37.0 37.0 37.0 37.0 37.0 45-49 35.9995 37.0 37.0 37.0 37.0 37.0 50-54 35.923500000000004 37.0 37.0 37.0 37.0 37.0 55-59 35.8132 37.0 37.0 37.0 37.0 37.0 60-64 35.7494 37.0 37.0 37.0 37.0 37.0 65-69 35.8607 37.0 37.0 37.0 37.0 37.0 70-74 35.85029999999999 37.0 37.0 37.0 37.0 37.0 75-79 35.9062 37.0 37.0 37.0 37.0 37.0 80-84 35.7981 37.0 37.0 37.0 37.0 37.0 85-89 35.7753 37.0 37.0 37.0 37.0 37.0 90-94 35.6768 37.0 37.0 37.0 37.0 37.0 95-99 35.688 37.0 37.0 37.0 37.0 37.0 100-104 35.6512 37.0 37.0 37.0 37.0 37.0 105-109 35.5616 37.0 37.0 37.0 37.0 37.0 110-114 35.6318 37.0 37.0 37.0 37.0 37.0 115-119 35.528000000000006 37.0 37.0 37.0 37.0 37.0 120-124 35.5607 37.0 37.0 37.0 37.0 37.0 125-129 35.054100000000005 37.0 37.0 37.0 29.8 37.0 130-134 35.3772 37.0 37.0 37.0 37.0 37.0 135-139 35.1998 37.0 37.0 37.0 29.8 37.0 140-144 35.2654 37.0 37.0 37.0 32.2 37.0 145-149 35.117000000000004 37.0 37.0 37.0 29.8 37.0 150-151 34.81525 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 8.0 15 7.0 16 3.0 17 1.0 18 1.0 19 1.0 20 4.0 21 6.0 22 10.0 23 7.0 24 7.0 25 11.0 26 10.0 27 9.0 28 23.0 29 20.0 30 20.0 31 30.0 32 44.0 33 90.0 34 207.0 35 661.0 36 2575.0 37 243.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.025000000000006 19.625 15.225 28.125 2 26.724999999999998 25.4 31.324999999999996 16.55 3 22.400000000000002 27.200000000000003 31.35 19.05 4 24.4 33.575 23.425 18.6 5 25.6 36.875 20.8 16.725 6 21.05 38.824999999999996 22.5 17.625 7 20.424999999999997 22.175 38.275 19.125 8 22.725 25.5 28.275 23.5 9 22.75 23.974999999999998 30.15 23.125 10-14 23.115 29.665000000000003 26.450000000000003 20.77 15-19 23.235 28.33 27.284999999999997 21.15 20-24 23.29 28.02 27.435 21.255 25-29 23.03 27.855 27.72 21.395 30-34 23.155 27.91 28.065 20.87 35-39 22.7 28.575 27.860000000000003 20.865000000000002 40-44 22.855 27.685 28.199999999999996 21.26 45-49 22.650000000000002 27.900000000000002 28.325 21.125 50-54 23.195 27.955000000000002 28.115000000000002 20.735 55-59 23.215 27.939999999999998 27.605 21.240000000000002 60-64 22.625 27.76 28.18 21.435000000000002 65-69 22.015 28.494999999999997 28.199999999999996 21.29 70-74 23.169999999999998 28.535 27.525 20.77 75-79 22.919999999999998 27.800000000000004 28.15 21.13 80-84 22.95 27.884999999999998 27.839999999999996 21.325 85-89 23.455000000000002 29.099999999999998 26.669999999999998 20.775 90-94 22.994999999999997 27.939999999999998 28.33 20.735 95-99 23.674999999999997 28.62 26.790000000000003 20.915 100-104 23.075000000000003 28.595 27.134999999999998 21.195 105-109 23.915 28.565 27.63 19.89 110-114 24.025 28.144999999999996 27.32 20.51 115-119 23.925 29.005 27.18 19.89 120-124 24.025 28.705000000000002 26.640000000000004 20.630000000000003 125-129 25.085 27.985 26.529999999999998 20.4 130-134 25.374999999999996 27.375 27.325 19.925 135-139 24.865000000000002 28.294999999999998 26.919999999999998 19.919999999999998 140-144 25.535000000000004 27.62 27.365000000000002 19.48 145-149 25.985000000000003 27.694999999999997 27.089999999999996 19.23 150-151 26.7125 27.287499999999998 26.3 19.7 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.5 8 0.5 9 0.5 10 0.5 11 1.5 12 1.5 13 0.0 14 0.0 15 1.0 16 1.5 17 2.0 18 1.5 19 0.0 20 0.5 21 1.5 22 1.5 23 2.5 24 5.0 25 5.0 26 3.5 27 6.5 28 10.0 29 13.0 30 16.0 31 17.0 32 20.0 33 36.5 34 57.5 35 67.0 36 78.5 37 106.5 38 143.5 39 171.5 40 197.5 41 230.5 42 248.0 43 254.5 44 260.0 45 275.0 46 259.5 47 223.5 48 224.5 49 217.5 50 188.5 51 140.5 52 103.0 53 86.0 54 78.5 55 65.5 56 45.5 57 33.5 58 20.0 59 17.0 60 14.0 61 9.0 62 6.0 63 4.0 64 4.0 65 3.0 66 1.5 67 1.0 68 1.5 69 2.5 70 2.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.5 81 0.5 82 0.0 83 0.5 84 1.0 85 1.0 86 0.5 87 0.0 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 0.5 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.25 #Duplication Level Percentage of deduplicated Percentage of total 1 84.98516320474778 71.6 2 12.225519287833828 20.599999999999998 3 2.136498516320475 5.4 4 0.44510385756676557 1.5 5 0.17804154302670622 0.75 6 0.029673590504451036 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTAGCAGTACTCTAGCTGTAGCCATGGCTTCCGAGAAACTCACTGCCACC 6 0.15 No Hit GCTAACAGTCCTTCCAGTAAACATTGTTGTTGGAAGCTACATTAGTAACA 5 0.125 No Hit TGAAATGACCACGCTGTATCCATTTGTCAATGCAATCCATATGGAAGACG 5 0.125 No Hit TCTTATTCATATGATAAATCCATCTCCAGCAGAAATGAAGACATTAGAAC 5 0.125 No Hit TTTACAAGCAATCAAGTTCGTTCAGCAAGCTGTAGGCTTACGTGGCTATG 5 0.125 No Hit AGCTCAAAGCACATATTCCTTGCTCCACTTCTGCTTTTATCTTCCTCACT 5 0.125 No Hit GTTACTAGGCCATGGCACCTTCGCTAAAGTCTACCACGCGCGTAACTTGC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.21250000000000002 0.0 0.0 0.0 0.0 78-79 0.2625 0.0 0.0 0.0 0.0 80-81 0.4 0.0 0.0 0.0 0.0 82-83 0.475 0.0 0.0 0.0 0.0 84-85 0.55 0.0 0.0 0.0 0.0 86-87 0.6125 0.0 0.0 0.0 0.0 88-89 0.675 0.0 0.0 0.0 0.0 90-91 0.875 0.0 0.0 0.0 0.0 92-93 1.1875 0.0 0.0 0.0 0.0 94-95 1.3625 0.0 0.0 0.0 0.0 96-97 1.5625 0.0 0.0 0.0 0.0 98-99 1.85 0.0 0.0 0.0 0.0 100-101 2.2125 0.0 0.0 0.0 0.0 102-103 2.4625000000000004 0.0 0.0 0.0 0.0 104-105 2.8125 0.0 0.0 0.0 0.0 106-107 3.2 0.0 0.0 0.0 0.0 108-109 3.725 0.0 0.0 0.0 0.0 110-111 4.199999999999999 0.0 0.0 0.0 0.0 112-113 4.6375 0.0 0.0 0.0 0.0 114-115 5.0 0.0 0.0 0.0 0.0 116-117 5.7125 0.0 0.0 0.0 0.0 118-119 6.25 0.0 0.0 0.0 0.0 120-121 6.737500000000001 0.0 0.0 0.0 0.0 122-123 7.4125 0.0 0.0 0.0 0.0 124-125 7.887499999999999 0.0 0.0 0.0 0.0 126-127 8.149999999999999 0.0 0.0 0.0 0.0 128-129 8.75 0.0 0.0 0.0 0.0 130-131 9.475000000000001 0.0 0.0 0.0 0.0 132-133 10.274999999999999 0.0 0.0 0.0 0.0 134-135 11.162500000000001 0.0 0.0 0.0 0.0 136-137 11.95 0.0 0.0 0.0 0.0 138-139 12.625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAAAGG 10 0.006830828 145.0 3 CTGGATT 20 0.00593511 29.0 140-144 TGGATTG 20 0.00593511 29.0 140-144 TGTGCTG 35 1.1966578E-4 24.857143 135-139 GTGTGCT 40 0.0076550315 18.125 135-139 >>END_MODULE Read 1857050 spots for SRR28623270.sra Written 1857050 spots for SRR28623270.sra Read 1857050 spots for SRR28623270.sra Written 1857050 spots for SRR28623270.sra Read 1857050 spots for SRR28623270.sra Written 1857050 spots for SRR28623270.sra Read 1857050 spots for SRR28623270.sra Written 1857050 spots for SRR28623270.sra Read 1857050 spots for SRR28623270.sra Written 1857050 spots for SRR28623270.sra Read 1857050 spots for SRR28623270.sra Written 1857050 spots for SRR28623270.sra Read 1857050 spots for SRR28623270.sra Written 1857050 spots for SRR28623270.sra Read 1857050 spots for SRR28623270.sra Written 1857050 spots for SRR28623270.sra Read 1857050 spots for SRR28623270.sra Written 1857050 spots for SRR28623270.sra Read 1857050 spots for SRR28623270.sra Written 1857050 spots for SRR28623270.sra Read 1857050 spots for SRR28623270.sra Written 1857050 spots for SRR28623270.sra Read 1857050 spots for SRR28623270.sra Written 1857050 spots for SRR28623270.sra Read 1857052 spots for SRR28623270.sra Written 1857052 spots for SRR28623270.sra Read 1857050 spots for SRR28623270.sra Written 1857050 spots for SRR28623270.sra Read 1857050 spots for SRR28623270.sra Written 1857050 spots for SRR28623270.sra Read 1857050 spots for SRR28623270.sra Written 1857050 spots for SRR28623270.sra Read 1857050 spots for SRR28623270.sra Written 1857050 spots for SRR28623270.sra Read 1857050 spots for SRR28623270.sra Written 1857050 spots for SRR28623270.sra Read 1857050 spots for SRR28623270.sra Written 1857050 spots for SRR28623270.sra Read 1857050 spots for SRR28623270.sra Written 1857050 spots for SRR28623270.sra SRR ids: ['SRR28623270.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_hzldv67m SRR28623270.sra spots: 37141002 blocks: [[1, 1857050], [1857051, 3714100], [3714101, 5571150], [5571151, 7428200], [7428201, 9285250], [9285251, 11142300], [11142301, 12999350], [12999351, 14856400], [14856401, 16713450], [16713451, 18570500], [18570501, 20427550], [20427551, 22284600], [22284601, 24141650], [24141651, 25998700], [25998701, 27855750], [27855751, 29712800], [29712801, 31569850], [31569851, 33426900], [33426901, 35283950], [35283951, 37141002]] SRR28623270 file size 13716305 SRR28623270 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR28623270 SRR28623270_1.fastq SRR28623270_2.fastq Input file: SRR28623270_1.fastq Paired file: SRR28623270_2.fastq trimmed: SRR28623270-trimmed-pair1.fastq, SRR28623270-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 16:17:21 2025 >> started Thu Feb 13 16:18:11 2025 >> done (49.946s) 37141002 read pairs processed; of these: 26 ( 0.00%) short read pairs filtered out after trimming by size control 17413 ( 0.05%) empty read pairs filtered out after trimming by size control 37123563 (99.95%) read pairs available; of these: 6779453 (18.26%) trimmed read pairs available after processing 30344110 (81.74%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 2 0.00% 20 5 0.00% 21 3 0.00% 22 5 0.00% 23 6 0.00% 24 13 0.00% 25 6 0.00% 26 8 0.00% 27 7 0.00% 28 15 0.00% 29 19 0.00% 30 11 0.00% 31 20 0.00% 32 14 0.00% 33 18 0.00% 34 24 0.00% 35 20 0.00% 36 27 0.00% 37 36 0.00% 38 35 0.00% 39 58 0.00% 40 67 0.00% 41 66 0.00% 42 73 0.00% 43 74 0.00% 44 86 0.00% 45 102 0.00% 46 108 0.00% 47 149 0.00% 48 154 0.00% 49 203 0.00% 50 254 0.00% 51 289 0.00% 52 310 0.00% 53 364 0.00% 54 469 0.00% 55 444 0.00% 56 506 0.00% 57 561 0.00% 58 734 0.00% 59 828 0.00% 60 1031 0.00% 61 1107 0.00% 62 1373 0.00% 63 1472 0.00% 64 1818 0.00% 65 1958 0.01% 66 2182 0.01% 67 2473 0.01% 68 2833 0.01% 69 3369 0.01% 70 3884 0.01% 71 4543 0.01% 72 5324 0.01% 73 6159 0.02% 74 6829 0.02% 75 7639 0.02% 76 8861 0.02% 77 9485 0.03% 78 10897 0.03% 79 12031 0.03% 80 13499 0.04% 81 14860 0.04% 82 16509 0.04% 83 18552 0.05% 84 20957 0.06% 85 22738 0.06% 86 24818 0.07% 87 27416 0.07% 88 28955 0.08% 89 30939 0.08% 90 32646 0.09% 91 36115 0.10% 92 38792 0.10% 93 41674 0.11% 94 45537 0.12% 95 48139 0.13% 96 51331 0.14% 97 54045 0.15% 98 55680 0.15% 99 58465 0.16% 100 61288 0.17% 101 63093 0.17% 102 66001 0.18% 103 69792 0.19% 104 72418 0.20% 105 74876 0.20% 106 78238 0.21% 107 81032 0.22% 108 83679 0.23% 109 86878 0.23% 110 87942 0.24% 111 89198 0.24% 112 91961 0.25% 113 94473 0.25% 114 96759 0.26% 115 101078 0.27% 116 103417 0.28% 117 106357 0.29% 118 108595 0.29% 119 110513 0.30% 120 111941 0.30% 121 114912 0.31% 122 115584 0.31% 123 117762 0.32% 124 120432 0.32% 125 120858 0.33% 126 124687 0.34% 127 127843 0.34% 128 129209 0.35% 129 130481 0.35% 130 132824 0.36% 131 132557 0.36% 132 135071 0.36% 133 136142 0.37% 134 136607 0.37% 135 137624 0.37% 136 141616 0.38% 137 142199 0.38% 138 144960 0.39% 139 146831 0.40% 140 146429 0.39% 141 146584 0.39% 142 149625 0.40% 143 149710 0.40% 144 151665 0.41% 145 151162 0.41% 146 151731 0.41% 147 153451 0.41% 148 155288 0.42% 149 155997 0.42% 150 156949 0.42% 151 30344110 81.74% 37123563 reads passed initial QC criterion=sequence-density sequence-density=0.54 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=30 prefix-density=0.55 prefix-fanout=1.9 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=31 fanout-score=60.54 fanout-score-rank=1 prefix-density=0.53 prefix-fanout=2.1 sequence=TGAATGGTGCACATTACGGGTCCATGGCACAAAATCAGAGGATAACAATATCCATTCAAGACTATGCAACAATATAATTTGATTATCCTTAGAAAGTGCTTCTCCTTACACACCCACAAGCCTAGAAAAGGAATTAGAATTTGTAAGTGCAGCTTCCATCATCACTCCTTGCAGTTGGATCAAAGTTTGCTGCATTTGGATCAGTACAGCCTTCAGCGACAGGCACCTTTACTTGCTGTGCCGCTTGGCC criterion=sequence-density sequence-density=0.62 sequence-density-rank=1 fanout-score=2.84 fanout-score-rank=17 prefix-density=0.91 prefix-fanout=1.9 sequence=AACCGCACCCCGGCACA criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=40.26 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=3.9 sequence=ATTACAAAGCAAAAAGCTCCAGCTTCAACTCACTGGTAGTGATATTTCTTACTGAACGCTGCCTCTAGCATTCGAATAGCTTTCACAGTTTAGATATTGATTAAGTTTCTTAATCACAGATCGAGTGATAAACATTGTTCTAAGTGATGGCCACATCAACAGTCATGCAGACCGTCCTTGCATCTCCAGTGGCCAGTAGTCTGGTGAAAAACCGGTCTCGAGTGAGCAACTTGTTTTCTGCTACGTATGTGCCACGACTACGTGGCAGTGCTAGCAAACGGTTGCAGTGCAAGGCCGAGCTGGATGAGCAGAAAATGTCAGCAGAGCCAAGTCCTCCTCCTAAGCCAAAGGTCAGCACAAAATTCGCTGATGTGTTGGCATTTAGCGGACCCGCACCAGAGAGGATCAATGGCAGGCTTGCCATGATAGGCTTTGTCGCTGCAATGGCAGTGGAACTGTCCAAGGGCCAAGACCTTTTTTCTCAGATATCTAACGGTGGAGTCTCGTGGTT SRR28623270 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 16:18:56 Started mapping on | Feb 13 16:18:56 Finished on | Feb 13 16:22:58 Mapping speed, Million of reads per hour | 552.25 Number of input reads | 37123563 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 35033132 Uniquely mapped reads % | 94.37% Average mapped length | 290.74 Number of splices: Total | 32214143 Number of splices: Annotated (sjdb) | 31517888 Number of splices: GT/AG | 31546801 Number of splices: GC/AG | 546109 Number of splices: AT/AC | 27372 Number of splices: Non-canonical | 93861 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 3.07 Insertion rate per base | 0.02% Insertion average length | 2.34 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 953428 % of reads mapped to multiple loci | 2.57% Number of reads mapped to too many loci | 203394 % of reads mapped to too many loci | 0.55% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.34% % of reads unmapped: other | 0.17% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1137003 1137003 1137003 N_multimapping 953428 953428 953428 N_noFeature 1361735 34588365 1555740 N_ambiguous 454139 2810 201343 UnstrandedReadsAssigned:33217258 PositiveStrandReadsAssigned:441957 NegativeStrandReadsAssigned:33276049 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR28623270 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR28623270-trimmed-pair1.fastq SRR28623270-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 37,123,563 reads, 33,844,795 reads pseudoaligned [quant] estimated average fragment length: 222.372 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,271 rounds 52401 SRR28623270.ke.tsv 34699 SRR28623270.se.tsv 87100 total ==> SRR28623270.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1796.63 786 13.4698 Potri.005G024800.1.v4.1 1035 813.628 401 15.1745 Potri.004G059700.1.v4.1 961 739.663 153 6.36874 Potri.007G009000.2.v4.1 1416 1194.63 0 0 Potri.003G141000.2.v4.1 2943 2721.63 532 6.01838 Potri.016G087400.1.v4.1 270 96.2264 1641.44 525.202 Potri.015G069301.1.v4.1 564 347.586 0 0 Potri.010G195200.1.v4.1 1773 1551.63 0 0 Potri.012G127500.1.v4.1 977 755.628 8731 355.756 ==> SRR28623270.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 25 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 435 Potri.001G212900.v4.1 114 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 15 SRR28623270 completed mapping pipeline successfully