Starting /dee2/code/volunteer_pipeline.sh SRR28623271 current disk space = 3050408427520 free memory = 1570684112 SRR28623271 SRAfilesize 9ef544b3cff6d00c23bf2f77917ffef2 SRR28623271.sra SRR28623271.sra file validated SRR28623271 is paired end SRR28623271 is conventional basespace SRR28623271 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623271_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.31175 37.0 37.0 37.0 37.0 37.0 2 36.353 37.0 37.0 37.0 37.0 37.0 3 36.486 37.0 37.0 37.0 37.0 37.0 4 36.521 37.0 37.0 37.0 37.0 37.0 5 36.5935 37.0 37.0 37.0 37.0 37.0 6 36.5955 37.0 37.0 37.0 37.0 37.0 7 36.4845 37.0 37.0 37.0 37.0 37.0 8 36.4095 37.0 37.0 37.0 37.0 37.0 9 36.5095 37.0 37.0 37.0 37.0 37.0 10-14 36.5662 37.0 37.0 37.0 37.0 37.0 15-19 36.511 37.0 37.0 37.0 37.0 37.0 20-24 36.508500000000005 37.0 37.0 37.0 37.0 37.0 25-29 36.4339 37.0 37.0 37.0 37.0 37.0 30-34 36.4414 37.0 37.0 37.0 37.0 37.0 35-39 36.4426 37.0 37.0 37.0 37.0 37.0 40-44 36.43140000000001 37.0 37.0 37.0 37.0 37.0 45-49 36.3363 37.0 37.0 37.0 37.0 37.0 50-54 36.3213 37.0 37.0 37.0 37.0 37.0 55-59 36.2128 37.0 37.0 37.0 37.0 37.0 60-64 36.2533 37.0 37.0 37.0 37.0 37.0 65-69 36.2094 37.0 37.0 37.0 37.0 37.0 70-74 36.11030000000001 37.0 37.0 37.0 37.0 37.0 75-79 36.073499999999996 37.0 37.0 37.0 37.0 37.0 80-84 36.0026 37.0 37.0 37.0 37.0 37.0 85-89 36.006299999999996 37.0 37.0 37.0 37.0 37.0 90-94 35.982600000000005 37.0 37.0 37.0 37.0 37.0 95-99 35.9061 37.0 37.0 37.0 37.0 37.0 100-104 35.8894 37.0 37.0 37.0 37.0 37.0 105-109 35.8711 37.0 37.0 37.0 37.0 37.0 110-114 35.8067 37.0 37.0 37.0 37.0 37.0 115-119 35.838 37.0 37.0 37.0 37.0 37.0 120-124 35.686299999999996 37.0 37.0 37.0 37.0 37.0 125-129 35.620099999999994 37.0 37.0 37.0 37.0 37.0 130-134 35.68 37.0 37.0 37.0 37.0 37.0 135-139 35.420399999999994 37.0 37.0 37.0 34.6 37.0 140-144 35.2364 37.0 37.0 37.0 29.8 37.0 145-149 35.1709 37.0 37.0 37.0 32.2 37.0 150-151 34.865750000000006 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 1.0 22 1.0 23 1.0 24 3.0 25 2.0 26 8.0 27 20.0 28 24.0 29 28.0 30 33.0 31 36.0 32 60.0 33 99.0 34 154.0 35 399.0 36 2876.0 37 254.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.70721286755466 12.490575521487811 9.901985423473235 42.90022618748429 2 18.6 15.85 36.225 29.325000000000003 3 17.625 19.25 27.500000000000004 35.625 4 22.425 26.075 23.7 27.800000000000004 5 23.3 33.225 24.375 19.1 6 19.900000000000002 36.05 23.175 20.875 7 16.150000000000002 28.15 38.675 17.025000000000002 8 17.549999999999997 27.275 31.025000000000002 24.15 9 17.299999999999997 25.35 33.800000000000004 23.549999999999997 10-14 18.285 31.064999999999998 28.025 22.625 15-19 19.79 28.720000000000002 27.88 23.61 20-24 19.405 29.28 27.685 23.630000000000003 25-29 19.91 29.220000000000002 27.54 23.330000000000002 30-34 19.91 28.815 27.72 23.555 35-39 19.195 29.035 27.96 23.810000000000002 40-44 19.689999999999998 29.225 27.43 23.655 45-49 20.424999999999997 29.62 26.735 23.22 50-54 19.375 28.71 27.955000000000002 23.96 55-59 19.875 29.659999999999997 27.05 23.415 60-64 19.575 29.25 27.779999999999998 23.395 65-69 19.35 29.56 27.560000000000002 23.53 70-74 20.105 29.145 27.1 23.65 75-79 20.41 29.054999999999996 27.139999999999997 23.395 80-84 20.335 29.160000000000004 26.69 23.815 85-89 19.675 28.849999999999998 27.85 23.625 90-94 20.095 28.9 27.13 23.875 95-99 20.064999999999998 29.03 27.325 23.580000000000002 100-104 20.575 28.999999999999996 26.68 23.745 105-109 20.435 29.38 26.784999999999997 23.400000000000002 110-114 20.44 29.005 27.13 23.425 115-119 20.865000000000002 28.87 26.38 23.885 120-124 20.544999999999998 29.515 26.035000000000004 23.905 125-129 21.060000000000002 28.615000000000002 26.784999999999997 23.54 130-134 21.055 28.615000000000002 26.255 24.075 135-139 20.535 29.725 25.724999999999998 24.015 140-144 21.17 29.165000000000003 26.179999999999996 23.485 145-149 20.465 28.194999999999997 26.534999999999997 24.805 150-151 20.325 28.712500000000002 26.35 24.6125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 1.0 21 0.5 22 1.0 23 3.0 24 5.0 25 7.0 26 9.5 27 8.0 28 7.5 29 13.5 30 22.5 31 28.0 32 38.0 33 52.0 34 60.5 35 80.0 36 111.0 37 136.5 38 149.0 39 163.5 40 178.0 41 212.0 42 244.5 43 248.0 44 269.5 45 274.5 46 258.0 47 252.5 48 238.5 49 188.0 50 154.0 51 137.5 52 98.5 53 72.5 54 61.5 55 53.5 56 39.5 57 29.0 58 21.5 59 17.0 60 13.5 61 9.5 62 8.0 63 6.0 64 4.5 65 3.5 66 3.0 67 2.0 68 1.5 69 1.0 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.525 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 82.89999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 83.53437876960193 69.25 2 13.088057901085644 21.7 3 2.6839565741857663 6.675000000000001 4 0.6332931242460796 2.1 5 0.030156815440289503 0.125 6 0.030156815440289503 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGGCCATGACATGGTTGCTGCATTTTTCTTTTGCGCGAGTTGCATTATT 6 0.15 No Hit CAACCAAAGAATCAAGATACTCCTGCAAGCCCTCCAGATCATCAAAGGTA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.2 0.0 0.0 0.0 0.0 76-77 0.32499999999999996 0.0 0.0 0.0 0.0 78-79 0.42500000000000004 0.0 0.0 0.0 0.0 80-81 0.48750000000000004 0.0 0.0 0.0 0.0 82-83 0.525 0.0 0.0 0.0 0.0 84-85 0.6125 0.0 0.0 0.0 0.0 86-87 0.8125 0.0 0.0 0.0 0.0 88-89 1.0125 0.0 0.0 0.0 0.0 90-91 1.1625 0.0 0.0 0.0 0.0 92-93 1.3624999999999998 0.0 0.0 0.0 0.0 94-95 1.575 0.0 0.0 0.0 0.0 96-97 1.85 0.0 0.0 0.0 0.0 98-99 2.175 0.0 0.0 0.0 0.0 100-101 2.4375 0.0 0.0 0.0 0.0 102-103 2.975 0.0 0.0 0.0 0.0 104-105 3.575 0.0 0.0 0.0 0.0 106-107 4.0875 0.0 0.0 0.0 0.0 108-109 4.775 0.0 0.0 0.0 0.0 110-111 5.1625 0.0 0.0 0.0 0.0 112-113 5.887499999999999 0.0 0.0 0.0 0.0 114-115 6.512499999999999 0.0 0.0 0.0 0.0 116-117 7.050000000000001 0.0 0.0 0.0 0.0 118-119 7.6875 0.0 0.0 0.0 0.0 120-121 8.3 0.0 0.0 0.0 0.0 122-123 9.1375 0.0 0.0 0.0 0.0 124-125 9.8625 0.0 0.0 0.0 0.0 126-127 10.7 0.0 0.0 0.0 0.0 128-129 11.8625 0.0 0.0 0.0 0.0 130-131 12.7625 0.0 0.0 0.0 0.0 132-133 13.5 0.0 0.0 0.0 0.0 134-135 14.3875 0.0 0.0 0.0 0.0 136-137 15.1125 0.0 0.0 0.0 0.0 138-139 15.775 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCCAGT 10 0.006830828 145.0 1 >>END_MODULE SRR28623271 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623271_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.9495 37.0 37.0 37.0 37.0 37.0 2 36.3385 37.0 37.0 37.0 37.0 37.0 3 36.249 37.0 37.0 37.0 37.0 37.0 4 36.238 37.0 37.0 37.0 37.0 37.0 5 36.373 37.0 37.0 37.0 37.0 37.0 6 36.2375 37.0 37.0 37.0 37.0 37.0 7 36.38 37.0 37.0 37.0 37.0 37.0 8 36.252 37.0 37.0 37.0 37.0 37.0 9 36.202 37.0 37.0 37.0 37.0 37.0 10-14 36.202 37.0 37.0 37.0 37.0 37.0 15-19 36.1758 37.0 37.0 37.0 37.0 37.0 20-24 36.174299999999995 37.0 37.0 37.0 37.0 37.0 25-29 36.0825 37.0 37.0 37.0 37.0 37.0 30-34 36.060300000000005 37.0 37.0 37.0 37.0 37.0 35-39 36.07 37.0 37.0 37.0 37.0 37.0 40-44 36.024699999999996 37.0 37.0 37.0 37.0 37.0 45-49 35.9645 37.0 37.0 37.0 37.0 37.0 50-54 35.980999999999995 37.0 37.0 37.0 37.0 37.0 55-59 35.76199999999999 37.0 37.0 37.0 37.0 37.0 60-64 35.787099999999995 37.0 37.0 37.0 37.0 37.0 65-69 35.8587 37.0 37.0 37.0 37.0 37.0 70-74 35.8113 37.0 37.0 37.0 37.0 37.0 75-79 35.8552 37.0 37.0 37.0 37.0 37.0 80-84 35.758300000000006 37.0 37.0 37.0 37.0 37.0 85-89 35.687599999999996 37.0 37.0 37.0 37.0 37.0 90-94 35.662099999999995 37.0 37.0 37.0 37.0 37.0 95-99 35.726800000000004 37.0 37.0 37.0 37.0 37.0 100-104 35.5812 37.0 37.0 37.0 37.0 37.0 105-109 35.533 37.0 37.0 37.0 37.0 37.0 110-114 35.5346 37.0 37.0 37.0 37.0 37.0 115-119 35.5 37.0 37.0 37.0 37.0 37.0 120-124 35.485 37.0 37.0 37.0 37.0 37.0 125-129 35.002300000000005 37.0 37.0 37.0 29.8 37.0 130-134 35.3082 37.0 37.0 37.0 32.2 37.0 135-139 35.0524 37.0 37.0 37.0 25.0 37.0 140-144 35.1759 37.0 37.0 37.0 29.8 37.0 145-149 35.0524 37.0 37.0 37.0 27.4 37.0 150-151 34.58175 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 4.0 15 5.0 16 3.0 17 4.0 18 3.0 19 2.0 20 6.0 21 3.0 22 5.0 23 6.0 24 9.0 25 12.0 26 10.0 27 15.0 28 18.0 29 21.0 30 38.0 31 34.0 32 57.0 33 117.0 34 205.0 35 597.0 36 2538.0 37 286.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.6 20.1 14.325 27.975 2 25.825 26.35 31.95 15.875 3 22.975 28.000000000000004 31.275 17.75 4 25.924999999999997 32.725 23.625 17.724999999999998 5 24.775 36.449999999999996 23.3 15.475 6 20.075000000000003 38.800000000000004 23.35 17.775 7 20.025000000000002 22.275 38.75 18.95 8 21.675 23.925 29.775000000000002 24.625 9 22.95 24.3 28.849999999999998 23.9 10-14 24.63 29.14 26.375 19.855 15-19 24.01 28.04 27.589999999999996 20.36 20-24 22.86 28.43 28.005000000000003 20.705000000000002 25-29 23.875 27.875 28.005000000000003 20.244999999999997 30-34 23.150000000000002 27.96 28.110000000000003 20.78 35-39 23.325000000000003 28.525 27.625 20.525 40-44 23.849999999999998 27.765 28.155 20.23 45-49 24.015 28.325 28.395 19.265 50-54 23.515 27.435 28.804999999999996 20.244999999999997 55-59 22.85 28.59 28.444999999999997 20.115 60-64 23.075000000000003 28.13 28.76 20.035 65-69 23.805 28.455000000000002 28.48 19.259999999999998 70-74 24.09 27.860000000000003 28.46 19.59 75-79 23.169999999999998 28.849999999999998 27.87 20.11 80-84 24.11 28.235 27.445000000000004 20.21 85-89 24.315 28.105000000000004 27.855 19.725 90-94 23.724999999999998 27.455000000000002 28.405 20.415 95-99 23.97 28.205000000000002 27.93 19.895 100-104 24.0 28.395 27.950000000000003 19.655 105-109 24.21 28.084999999999997 27.71 19.994999999999997 110-114 24.43 28.37 27.505000000000003 19.695 115-119 24.46 28.415000000000003 27.165 19.96 120-124 24.89 28.52 27.04 19.55 125-129 25.979999999999997 28.28 26.700000000000003 19.040000000000003 130-134 25.759999999999998 28.575 26.575 19.09 135-139 25.745 27.57 27.93 18.755 140-144 26.115 28.065 26.450000000000003 19.37 145-149 26.3 28.044999999999998 26.495 19.16 150-151 26.3625 27.9375 26.437500000000004 19.2625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 2.0 16 1.0 17 0.0 18 1.0 19 2.5 20 2.0 21 1.0 22 1.0 23 3.0 24 7.0 25 6.0 26 3.5 27 6.0 28 8.0 29 15.5 30 21.5 31 28.0 32 32.5 33 36.5 34 50.5 35 65.5 36 87.0 37 108.5 38 152.5 39 191.0 40 204.5 41 220.0 42 242.5 43 269.0 44 276.5 45 296.0 46 279.0 47 232.0 48 224.5 49 196.5 50 158.5 51 130.0 52 100.0 53 75.0 54 57.5 55 48.0 56 35.5 57 29.5 58 21.5 59 12.5 60 9.0 61 6.5 62 4.5 63 4.5 64 5.0 65 3.0 66 1.0 67 1.5 68 2.5 69 1.0 70 1.0 71 1.5 72 1.0 73 0.5 74 2.0 75 2.5 76 0.5 77 0.5 78 1.0 79 0.5 80 0.5 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.5 92 0.5 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 1.0 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.65 #Duplication Level Percentage of deduplicated Percentage of total 1 84.4590555887627 70.65 2 12.402869097429766 20.75 3 2.42080095636581 6.075 4 0.6276150627615062 2.1 5 0.059772863120143446 0.25 6 0.0 0.0 7 0.029886431560071723 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 7 0.17500000000000002 No Hit ATGGAGAAGAAATGCTATGGTCTTTTCTTGTTGCTGCTCATTGCCCTGGC 5 0.125 No Hit AAAGATATAGAGAGAAAGAAACAACATGTCGTCGACGACAAAACCAAAGG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.2 0.0 0.0 0.0 0.0 76-77 0.32499999999999996 0.0 0.0 0.0 0.0 78-79 0.42500000000000004 0.0 0.0 0.0 0.0 80-81 0.48750000000000004 0.0 0.0 0.0 0.0 82-83 0.525 0.0 0.0 0.0 0.0 84-85 0.625 0.0 0.0 0.0 0.0 86-87 0.8375 0.0 0.0 0.0 0.0 88-89 1.0375 0.0 0.0 0.0 0.0 90-91 1.1875 0.0 0.0 0.0 0.0 92-93 1.4 0.0 0.0 0.0 0.0 94-95 1.625 0.0 0.0 0.0 0.0 96-97 1.9 0.0 0.0 0.0 0.0 98-99 2.2249999999999996 0.0 0.0 0.0 0.0 100-101 2.4875 0.0 0.0 0.0 0.0 102-103 3.025 0.0 0.0 0.0 0.0 104-105 3.6875 0.0 0.0 0.0 0.0 106-107 4.3 0.0 0.0 0.0 0.0 108-109 5.05 0.0 0.0 0.0 0.0 110-111 5.4125 0.0 0.0 0.0 0.0 112-113 6.112500000000001 0.0 0.0 0.0 0.0 114-115 6.737500000000001 0.0 0.0 0.0 0.0 116-117 7.2625 0.0 0.0 0.0 0.0 118-119 7.875 0.0 0.0 0.0 0.0 120-121 8.475 0.0 0.0 0.0 0.0 122-123 9.3125 0.0 0.0 0.0 0.0 124-125 10.0375 0.0 0.0 0.0 0.0 126-127 10.8625 0.0 0.0 0.0 0.0 128-129 12.075 0.0 0.0 0.0 0.0 130-131 12.9875 0.0 0.0 0.0 0.0 132-133 13.725 0.0 0.0 0.0 0.0 134-135 14.6125 0.0 0.0 0.0 0.0 136-137 15.350000000000001 0.0 0.0 0.0 0.0 138-139 16.0375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGTGCCA 10 0.006830828 145.0 2 GTGCCAC 10 0.006830828 145.0 3 >>END_MODULE Read 1732247 spots for SRR28623271.sra Written 1732247 spots for SRR28623271.sra Read 1732247 spots for SRR28623271.sra Written 1732247 spots for SRR28623271.sra Read 1732247 spots for SRR28623271.sra Written 1732247 spots for SRR28623271.sra Read 1732247 spots for SRR28623271.sra Written 1732247 spots for SRR28623271.sra Read 1732247 spots for SRR28623271.sra Written 1732247 spots for SRR28623271.sra Read 1732247 spots for SRR28623271.sra Written 1732247 spots for SRR28623271.sra Read 1732247 spots for SRR28623271.sra Written 1732247 spots for SRR28623271.sra Read 1732247 spots for SRR28623271.sra Written 1732247 spots for SRR28623271.sra Read 1732247 spots for SRR28623271.sra Written 1732247 spots for SRR28623271.sra Read 1732247 spots for SRR28623271.sra Written 1732247 spots for SRR28623271.sra Read 1732247 spots for SRR28623271.sra Written 1732247 spots for SRR28623271.sra Read 1732247 spots for SRR28623271.sra Written 1732247 spots for SRR28623271.sra Read 1732251 spots for SRR28623271.sra Written 1732251 spots for SRR28623271.sra Read 1732247 spots for SRR28623271.sra Written 1732247 spots for SRR28623271.sra Read 1732247 spots for SRR28623271.sra Written 1732247 spots for SRR28623271.sra Read 1732247 spots for SRR28623271.sra Written 1732247 spots for SRR28623271.sra Read 1732247 spots for SRR28623271.sra Written 1732247 spots for SRR28623271.sra Read 1732247 spots for SRR28623271.sra Written 1732247 spots for SRR28623271.sra Read 1732247 spots for SRR28623271.sra Written 1732247 spots for SRR28623271.sra Read 1732247 spots for SRR28623271.sra Written 1732247 spots for SRR28623271.sra SRR ids: ['SRR28623271.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3gt7tsvn SRR28623271.sra spots: 34644944 blocks: [[1, 1732247], [1732248, 3464494], [3464495, 5196741], [5196742, 6928988], [6928989, 8661235], [8661236, 10393482], [10393483, 12125729], [12125730, 13857976], [13857977, 15590223], [15590224, 17322470], [17322471, 19054717], [19054718, 20786964], [20786965, 22519211], [22519212, 24251458], [24251459, 25983705], [25983706, 27715952], [27715953, 29448199], [29448200, 31180446], [31180447, 32912693], [32912694, 34644944]] SRR28623271 file size 12793742 SRR28623271 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR28623271 SRR28623271_1.fastq SRR28623271_2.fastq Input file: SRR28623271_1.fastq Paired file: SRR28623271_2.fastq trimmed: SRR28623271-trimmed-pair1.fastq, SRR28623271-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 13:41:45 2025 >> started Tue Feb 11 13:42:42 2025 >> done (57.235s) 34644944 read pairs processed; of these: 31 ( 0.00%) short read pairs filtered out after trimming by size control 11928 ( 0.03%) empty read pairs filtered out after trimming by size control 34632985 (99.97%) read pairs available; of these: 7227488 (20.87%) trimmed read pairs available after processing 27405497 (79.13%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 4 0.00% 20 5 0.00% 21 6 0.00% 22 3 0.00% 23 5 0.00% 24 11 0.00% 25 9 0.00% 26 4 0.00% 27 9 0.00% 28 15 0.00% 29 10 0.00% 30 15 0.00% 31 21 0.00% 32 29 0.00% 33 27 0.00% 34 34 0.00% 35 49 0.00% 36 26 0.00% 37 50 0.00% 38 52 0.00% 39 65 0.00% 40 56 0.00% 41 82 0.00% 42 92 0.00% 43 85 0.00% 44 128 0.00% 45 129 0.00% 46 150 0.00% 47 181 0.00% 48 195 0.00% 49 252 0.00% 50 297 0.00% 51 325 0.00% 52 379 0.00% 53 459 0.00% 54 489 0.00% 55 556 0.00% 56 581 0.00% 57 693 0.00% 58 864 0.00% 59 995 0.00% 60 1103 0.00% 61 1321 0.00% 62 1449 0.00% 63 1828 0.01% 64 2004 0.01% 65 2227 0.01% 66 2536 0.01% 67 2935 0.01% 68 3397 0.01% 69 3902 0.01% 70 4570 0.01% 71 5007 0.01% 72 5833 0.02% 73 6909 0.02% 74 7640 0.02% 75 8592 0.02% 76 9979 0.03% 77 10728 0.03% 78 12441 0.04% 79 13677 0.04% 80 14962 0.04% 81 16957 0.05% 82 18967 0.05% 83 20995 0.06% 84 23517 0.07% 85 26012 0.08% 86 28851 0.08% 87 31015 0.09% 88 33088 0.10% 89 35539 0.10% 90 38078 0.11% 91 40941 0.12% 92 43778 0.13% 93 47712 0.14% 94 50966 0.15% 95 53655 0.15% 96 58202 0.17% 97 60923 0.18% 98 63267 0.18% 99 66328 0.19% 100 69411 0.20% 101 71159 0.21% 102 74484 0.22% 103 77859 0.22% 104 81461 0.24% 105 84267 0.24% 106 88124 0.25% 107 91363 0.26% 108 93494 0.27% 109 95550 0.28% 110 97855 0.28% 111 100437 0.29% 112 103006 0.30% 113 104637 0.30% 114 107197 0.31% 115 110929 0.32% 116 113473 0.33% 117 116147 0.34% 118 119004 0.34% 119 120394 0.35% 120 121895 0.35% 121 124698 0.36% 122 124755 0.36% 123 126859 0.37% 124 128478 0.37% 125 129726 0.37% 126 132002 0.38% 127 135035 0.39% 128 136377 0.39% 129 137430 0.40% 130 140218 0.40% 131 139752 0.40% 132 141313 0.41% 133 142725 0.41% 134 141900 0.41% 135 144037 0.42% 136 145663 0.42% 137 146614 0.42% 138 148277 0.43% 139 150349 0.43% 140 149345 0.43% 141 150896 0.44% 142 152501 0.44% 143 151316 0.44% 144 152916 0.44% 145 152080 0.44% 146 152471 0.44% 147 153483 0.44% 148 153906 0.44% 149 154315 0.45% 150 156634 0.45% 151 27405497 79.13% 34632985 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=12.08 fanout-score-rank=17 prefix-density=0.10 prefix-fanout=12.1 sequence=GGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGACCATTATCTCGTATGCCGTCTTCTGCTTGAAA criterion=fanout-score sequence-density=0.07 sequence-density-rank=15 fanout-score=306.47 fanout-score-rank=1 prefix-density=1.02 prefix-fanout=21.1 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=14.44 fanout-score-rank=14 prefix-density=0.14 prefix-fanout=12.3 sequence=GAGAGAGAGAGTTAAGACAATGGCCTCGAAGAAATCTGCAATCGTATTACCTGGTTCAAAGGTGTTGAAGCACATAGTTTTTGTACGGTTTAATGATGGGATCACTGATGAACAAATTGAGAA criterion=fanout-score sequence-density=0.07 sequence-density-rank=18 fanout-score=342.62 fanout-score-rank=1 prefix-density=0.99 prefix-fanout=25.0 sequence=AAGAAGAAGAAA SRR28623271 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 13:44:26 Started mapping on | Feb 11 13:44:26 Finished on | Feb 11 13:47:59 Mapping speed, Million of reads per hour | 585.35 Number of input reads | 34632985 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 32510583 Uniquely mapped reads % | 93.87% Average mapped length | 288.84 Number of splices: Total | 28429202 Number of splices: Annotated (sjdb) | 27793563 Number of splices: GT/AG | 27944699 Number of splices: GC/AG | 367195 Number of splices: AT/AC | 27392 Number of splices: Non-canonical | 89916 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 2.94 Insertion rate per base | 0.03% Insertion average length | 2.40 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 954196 % of reads mapped to multiple loci | 2.76% Number of reads mapped to too many loci | 208031 % of reads mapped to too many loci | 0.60% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.57% % of reads unmapped: other | 0.20% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1168206 1168206 1168206 N_multimapping 954196 954196 954196 N_noFeature 1243810 32087419 1451427 N_ambiguous 408873 2836 191347 UnstrandedReadsAssigned:30857900 PositiveStrandReadsAssigned:420328 NegativeStrandReadsAssigned:30867809 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR28623271 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR28623271-trimmed-pair1.fastq SRR28623271-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 34,632,985 reads, 31,417,688 reads pseudoaligned [quant] estimated average fragment length: 211.563 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,094 rounds 52401 SRR28623271.ke.tsv 34699 SRR28623271.se.tsv 87100 total ==> SRR28623271.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1807.44 1489 25.8167 Potri.005G024800.1.v4.1 1035 824.437 1551 58.9555 Potri.004G059700.1.v4.1 961 750.437 122 5.09466 Potri.007G009000.2.v4.1 1416 1205.44 0 0 Potri.003G141000.2.v4.1 2943 2732.44 898.447 10.3042 Potri.016G087400.1.v4.1 270 99.6571 2530.96 795.878 Potri.015G069301.1.v4.1 564 357.271 0 0 Potri.010G195200.1.v4.1 1773 1562.44 48 0.962739 Potri.012G127500.1.v4.1 977 766.437 8330 340.595 ==> SRR28623271.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1469 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 557 Potri.001G212900.v4.1 8 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 5 SRR28623271 completed mapping pipeline successfully