Starting /dee2/code/volunteer_pipeline.sh SRR28623272 current disk space = 3050490261504 free memory = 1459284516 SRR28623272 SRAfilesize 39944b75e81870a209353db2469f3097 SRR28623272.sra SRR28623272.sra file validated SRR28623272 is paired end SRR28623272 is conventional basespace SRR28623272 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623272_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3175 37.0 37.0 37.0 37.0 37.0 2 36.4425 37.0 37.0 37.0 37.0 37.0 3 36.622 37.0 37.0 37.0 37.0 37.0 4 36.6065 37.0 37.0 37.0 37.0 37.0 5 36.663 37.0 37.0 37.0 37.0 37.0 6 36.5725 37.0 37.0 37.0 37.0 37.0 7 36.627 37.0 37.0 37.0 37.0 37.0 8 36.434 37.0 37.0 37.0 37.0 37.0 9 36.4655 37.0 37.0 37.0 37.0 37.0 10-14 36.5361 37.0 37.0 37.0 37.0 37.0 15-19 36.5064 37.0 37.0 37.0 37.0 37.0 20-24 36.5457 37.0 37.0 37.0 37.0 37.0 25-29 36.4794 37.0 37.0 37.0 37.0 37.0 30-34 36.4674 37.0 37.0 37.0 37.0 37.0 35-39 36.4578 37.0 37.0 37.0 37.0 37.0 40-44 36.3738 37.0 37.0 37.0 37.0 37.0 45-49 36.3278 37.0 37.0 37.0 37.0 37.0 50-54 36.2779 37.0 37.0 37.0 37.0 37.0 55-59 36.264799999999994 37.0 37.0 37.0 37.0 37.0 60-64 36.2438 37.0 37.0 37.0 37.0 37.0 65-69 36.255900000000004 37.0 37.0 37.0 37.0 37.0 70-74 36.1515 37.0 37.0 37.0 37.0 37.0 75-79 36.193599999999996 37.0 37.0 37.0 37.0 37.0 80-84 36.1117 37.0 37.0 37.0 37.0 37.0 85-89 36.1349 37.0 37.0 37.0 37.0 37.0 90-94 36.1047 37.0 37.0 37.0 37.0 37.0 95-99 35.9218 37.0 37.0 37.0 37.0 37.0 100-104 35.9748 37.0 37.0 37.0 37.0 37.0 105-109 35.9365 37.0 37.0 37.0 37.0 37.0 110-114 35.882099999999994 37.0 37.0 37.0 37.0 37.0 115-119 35.922000000000004 37.0 37.0 37.0 37.0 37.0 120-124 35.7761 37.0 37.0 37.0 37.0 37.0 125-129 35.625 37.0 37.0 37.0 37.0 37.0 130-134 35.745400000000004 37.0 37.0 37.0 37.0 37.0 135-139 35.5321 37.0 37.0 37.0 37.0 37.0 140-144 35.15259999999999 37.0 37.0 37.0 27.4 37.0 145-149 34.90220000000001 37.0 37.0 37.0 25.0 37.0 150-151 34.725 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 2.0 20 1.0 21 1.0 22 2.0 23 0.0 24 1.0 25 6.0 26 4.0 27 9.0 28 11.0 29 26.0 30 26.0 31 43.0 32 78.0 33 107.0 34 135.0 35 401.0 36 2894.0 37 253.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.162568991470145 13.120923231309584 11.038635223281485 43.67787255393878 2 19.3 14.774999999999999 35.925000000000004 30.0 3 18.275 18.0 27.750000000000004 35.975 4 22.8 25.575 24.65 26.974999999999998 5 23.35 31.874999999999996 25.825 18.95 6 20.0 35.099999999999994 22.525000000000002 22.375 7 15.425 27.325 41.125 16.125 8 19.475 27.875 31.175000000000004 21.475 9 18.25 23.75 35.4 22.6 10-14 18.91 30.5 27.935 22.655 15-19 19.455 28.62 28.615000000000002 23.31 20-24 19.955000000000002 28.935 27.839999999999996 23.27 25-29 19.865 29.115000000000002 28.125 22.895 30-34 19.62 29.12 27.405 23.855 35-39 19.655 28.660000000000004 27.584999999999997 24.099999999999998 40-44 20.51 28.835 27.83 22.825 45-49 20.025000000000002 28.98 27.16 23.835 50-54 20.105 29.160000000000004 27.18 23.555 55-59 20.31 28.315 27.889999999999997 23.485 60-64 20.345 28.599999999999998 27.615000000000002 23.44 65-69 20.31 29.494999999999997 27.215 22.98 70-74 20.685000000000002 29.095 26.87 23.35 75-79 20.34 28.23 27.825 23.605 80-84 20.925 28.875 27.065 23.135 85-89 20.105 28.625 27.775 23.494999999999997 90-94 20.724999999999998 28.08 27.284999999999997 23.91 95-99 20.49 28.98 27.515 23.015 100-104 20.565 29.189999999999998 27.439999999999998 22.805 105-109 20.955 28.54 27.02 23.485 110-114 21.17 28.945 26.31 23.575 115-119 21.645 28.605000000000004 26.185000000000002 23.565 120-124 20.39 29.435 26.075 24.099999999999998 125-129 21.54 28.895 25.765 23.799999999999997 130-134 21.325 29.205 25.895000000000003 23.575 135-139 21.36 28.615000000000002 25.82 24.205 140-144 21.55 28.49 25.545 24.415 145-149 22.134999999999998 28.865000000000002 24.93 24.07 150-151 21.7875 28.075 25.224999999999998 24.9125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.5 5 1.0 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 1.0 21 1.5 22 1.0 23 1.0 24 2.5 25 4.0 26 3.5 27 6.5 28 13.5 29 16.0 30 15.0 31 30.5 32 46.0 33 57.0 34 64.0 35 81.5 36 105.0 37 117.5 38 138.5 39 162.0 40 193.0 41 231.0 42 246.5 43 251.0 44 253.5 45 242.0 46 240.5 47 226.0 48 223.5 49 206.0 50 160.5 51 131.5 52 105.5 53 93.0 54 78.0 55 58.5 56 42.0 57 32.5 58 32.5 59 28.0 60 20.0 61 11.5 62 4.5 63 3.0 64 1.5 65 1.5 66 2.0 67 1.5 68 1.5 69 1.5 70 1.5 71 0.5 72 1.0 73 1.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.35000000000000003 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 87.075 #Duplication Level Percentage of deduplicated Percentage of total 1 87.42463393626184 76.125 2 10.594315245478036 18.45 3 1.751363766867643 4.575 4 0.20097616996841805 0.7000000000000001 5 0.0 0.0 6 0.028710881424059722 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CATGAGATGTGATCAAAACCCTAACAATCTTACATCAAATTACAAGCACG 6 0.15 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.0625 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.16249999999999998 0.0 0.0 0.0 0.0 78-79 0.3125 0.0 0.0 0.0 0.0 80-81 0.5 0.0 0.0 0.0 0.0 82-83 0.6 0.0 0.0 0.0 0.0 84-85 0.7625 0.0 0.0 0.0 0.0 86-87 0.9750000000000001 0.0 0.0 0.0 0.0 88-89 1.3125 0.0 0.0 0.0 0.0 90-91 1.525 0.0 0.0 0.0 0.0 92-93 1.725 0.0 0.0 0.0 0.0 94-95 2.0125 0.0 0.0 0.0 0.0 96-97 2.575 0.0 0.0 0.0 0.0 98-99 3.0625 0.0 0.0 0.0 0.0 100-101 3.6375 0.0 0.0 0.0 0.0 102-103 3.9125 0.0 0.0 0.0 0.0 104-105 4.5375 0.0 0.0 0.0 0.0 106-107 5.35 0.0 0.0 0.0 0.0 108-109 5.862500000000001 0.0 0.0 0.0 0.0 110-111 6.55 0.0 0.0 0.0 0.0 112-113 7.3625 0.0 0.0 0.0 0.0 114-115 8.1 0.0 0.0 0.0 0.0 116-117 8.775 0.0 0.0 0.0 0.0 118-119 9.8125 0.0 0.0 0.0 0.0 120-121 10.675 0.0 0.0 0.0 0.0 122-123 11.2625 0.0 0.0 0.0 0.0 124-125 12.2625 0.0 0.0 0.0 0.0 126-127 13.3 0.0 0.0 0.0 0.0 128-129 14.075 0.0 0.0 0.0 0.0 130-131 14.6875 0.0 0.0 0.0 0.0 132-133 15.8 0.0 0.0 0.0 0.0 134-135 16.6125 0.0 0.0 0.0 0.0 136-137 17.525 0.0 0.0 0.0 0.0 138-139 18.5375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGTAGGT 10 0.006830828 145.0 7 >>END_MODULE SRR28623272 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623272_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.875 37.0 37.0 37.0 37.0 37.0 2 36.1505 37.0 37.0 37.0 37.0 37.0 3 36.212 37.0 37.0 37.0 37.0 37.0 4 36.2265 37.0 37.0 37.0 37.0 37.0 5 36.331 37.0 37.0 37.0 37.0 37.0 6 36.3305 37.0 37.0 37.0 37.0 37.0 7 36.2245 37.0 37.0 37.0 37.0 37.0 8 36.312 37.0 37.0 37.0 37.0 37.0 9 36.267 37.0 37.0 37.0 37.0 37.0 10-14 36.205400000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.1808 37.0 37.0 37.0 37.0 37.0 20-24 36.144400000000005 37.0 37.0 37.0 37.0 37.0 25-29 36.1244 37.0 37.0 37.0 37.0 37.0 30-34 36.021699999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.0623 37.0 37.0 37.0 37.0 37.0 40-44 36.0305 37.0 37.0 37.0 37.0 37.0 45-49 36.05239999999999 37.0 37.0 37.0 37.0 37.0 50-54 36.0647 37.0 37.0 37.0 37.0 37.0 55-59 35.8972 37.0 37.0 37.0 37.0 37.0 60-64 35.9054 37.0 37.0 37.0 37.0 37.0 65-69 35.9499 37.0 37.0 37.0 37.0 37.0 70-74 35.937799999999996 37.0 37.0 37.0 37.0 37.0 75-79 35.9248 37.0 37.0 37.0 37.0 37.0 80-84 35.822700000000005 37.0 37.0 37.0 37.0 37.0 85-89 35.8104 37.0 37.0 37.0 37.0 37.0 90-94 35.732099999999996 37.0 37.0 37.0 37.0 37.0 95-99 35.8041 37.0 37.0 37.0 37.0 37.0 100-104 35.6394 37.0 37.0 37.0 37.0 37.0 105-109 35.635 37.0 37.0 37.0 37.0 37.0 110-114 35.6925 37.0 37.0 37.0 37.0 37.0 115-119 35.5647 37.0 37.0 37.0 37.0 37.0 120-124 35.5976 37.0 37.0 37.0 37.0 37.0 125-129 35.188500000000005 37.0 37.0 37.0 32.2 37.0 130-134 35.4208 37.0 37.0 37.0 34.6 37.0 135-139 35.141000000000005 37.0 37.0 37.0 27.4 37.0 140-144 35.253499999999995 37.0 37.0 37.0 29.8 37.0 145-149 35.1468 37.0 37.0 37.0 27.4 37.0 150-151 34.808499999999995 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 0.0 14 2.0 15 3.0 16 4.0 17 4.0 18 0.0 19 1.0 20 0.0 21 2.0 22 9.0 23 12.0 24 8.0 25 8.0 26 5.0 27 8.0 28 20.0 29 23.0 30 33.0 31 39.0 32 60.0 33 94.0 34 200.0 35 647.0 36 2553.0 37 264.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.875 19.325 13.875000000000002 27.925 2 27.950000000000003 26.25 29.725 16.075 3 22.675 26.700000000000003 31.8 18.825 4 24.2 32.025 24.175 19.6 5 26.75 34.8 21.775 16.675 6 20.8 39.2 23.35 16.650000000000002 7 21.15 22.825 37.175000000000004 18.85 8 21.099999999999998 26.325 27.450000000000003 25.124999999999996 9 22.900000000000002 25.45 30.0 21.65 10-14 23.805 29.580000000000002 26.474999999999998 20.14 15-19 23.94 28.04 27.76 20.26 20-24 23.805 28.9 26.905 20.39 25-29 23.265 28.345 28.044999999999998 20.345 30-34 22.945 27.529999999999998 28.46 21.065 35-39 23.325000000000003 28.384999999999998 27.169999999999998 21.12 40-44 23.72 28.07 27.944999999999997 20.265 45-49 23.44 28.410000000000004 27.52 20.630000000000003 50-54 23.044999999999998 27.994999999999997 28.499999999999996 20.46 55-59 23.3 27.29 28.29 21.12 60-64 23.16 28.43 27.435 20.974999999999998 65-69 23.165 27.805000000000003 28.110000000000003 20.919999999999998 70-74 23.599999999999998 28.139999999999997 27.42 20.84 75-79 23.775 28.199999999999996 27.705000000000002 20.32 80-84 23.16 28.005000000000003 28.23 20.605 85-89 24.175 28.22 27.54 20.064999999999998 90-94 23.87 27.805000000000003 27.415 20.91 95-99 24.285 27.955000000000002 27.834999999999997 19.925 100-104 23.785 28.655 27.68 19.88 105-109 24.83 27.544999999999998 27.91 19.715 110-114 25.405 28.299999999999997 26.8 19.495 115-119 25.515 28.555000000000003 26.82 19.11 120-124 26.22 28.165000000000003 26.540000000000003 19.075 125-129 26.015 28.73 26.135 19.12 130-134 26.265 29.145 25.840000000000003 18.75 135-139 27.165 27.665 26.235000000000003 18.935 140-144 27.195000000000004 28.57 25.715 18.52 145-149 27.150000000000002 28.34 25.779999999999998 18.73 150-151 27.537499999999998 28.675 26.1 17.6875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 1.0 12 1.0 13 0.5 14 0.0 15 0.5 16 1.5 17 1.0 18 0.5 19 1.0 20 1.5 21 3.0 22 3.0 23 1.5 24 3.0 25 4.5 26 4.0 27 7.5 28 12.0 29 10.0 30 12.5 31 21.0 32 28.0 33 37.0 34 56.5 35 71.5 36 81.5 37 119.0 38 153.0 39 165.0 40 192.0 41 240.0 42 248.5 43 251.0 44 278.5 45 282.5 46 246.0 47 213.5 48 209.0 49 205.5 50 175.5 51 136.0 52 108.0 53 79.5 54 71.0 55 57.5 56 47.5 57 41.5 58 27.0 59 14.0 60 13.0 61 15.0 62 6.5 63 1.5 64 2.5 65 3.0 66 2.5 67 2.5 68 2.0 69 3.5 70 2.5 71 0.0 72 0.0 73 1.0 74 1.5 75 1.0 76 0.5 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.5 91 0.5 92 0.5 93 1.0 94 0.5 95 0.0 96 0.0 97 0.0 98 0.5 99 2.0 100 4.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 87.275 #Duplication Level Percentage of deduplicated Percentage of total 1 87.79719278143799 76.625 2 10.22629619020338 17.849999999999998 3 1.7473503294185047 4.575 4 0.14322543683758235 0.5 5 0.028645087367516472 0.125 6 0.028645087367516472 0.15 7 0.028645087367516472 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 7 0.17500000000000002 No Hit GCCAAGGAGAAGAAGGGACTACTCGAGAAGATCAAGGAGAAGTTACCTGG 6 0.15 No Hit GAGCAGATAAGATAGCAGACACAAATTGTTATTATAGGCTCTATCTTGCA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.0625 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.16249999999999998 0.0 0.0 0.0 0.0 78-79 0.3125 0.0 0.0 0.0 0.0 80-81 0.5 0.0 0.0 0.0 0.0 82-83 0.6 0.0 0.0 0.0 0.0 84-85 0.7625 0.0 0.0 0.0 0.0 86-87 0.9750000000000001 0.0 0.0 0.0 0.0 88-89 1.325 0.0 0.0 0.0 0.0 90-91 1.55 0.0 0.0 0.0 0.0 92-93 1.75 0.0 0.0 0.0 0.0 94-95 2.0375 0.0 0.0 0.0 0.0 96-97 2.5999999999999996 0.0 0.0 0.0 0.0 98-99 3.1125 0.0 0.0 0.0 0.0 100-101 3.725 0.0 0.0 0.0 0.0 102-103 4.025 0.0 0.0 0.0 0.0 104-105 4.6625 0.0 0.0 0.0 0.0 106-107 5.475 0.0 0.0 0.0 0.0 108-109 6.025 0.0 0.0 0.0 0.0 110-111 6.75 0.0 0.0 0.0 0.0 112-113 7.5375 0.0 0.0 0.0 0.0 114-115 8.287500000000001 0.0 0.0 0.0 0.0 116-117 9.0 0.0 0.0 0.0 0.0 118-119 10.0375 0.0 0.0 0.0 0.0 120-121 10.9375 0.0 0.0 0.0 0.0 122-123 11.625 0.0 0.0 0.0 0.0 124-125 12.7375 0.0 0.0 0.0 0.0 126-127 13.75 0.0 0.0 0.0 0.0 128-129 14.525 0.0 0.0 0.0 0.0 130-131 15.1375 0.0 0.0 0.0 0.0 132-133 16.2625 0.0 0.0 0.0 0.0 134-135 17.0625 0.0 0.0 0.0 0.0 136-137 17.975 0.0 0.0 0.0 0.0 138-139 18.95 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAAAGC 10 0.006830828 145.0 2 GGGGGGG 40 0.0076550315 18.125 140-144 >>END_MODULE Read 1589588 spots for SRR28623272.sra Written 1589588 spots for SRR28623272.sra Read 1589588 spots for SRR28623272.sra Written 1589588 spots for SRR28623272.sra Read 1589588 spots for SRR28623272.sra Written 1589588 spots for SRR28623272.sra Read 1589588 spots for SRR28623272.sra Written 1589588 spots for SRR28623272.sra Read 1589588 spots for SRR28623272.sra Written 1589588 spots for SRR28623272.sra Read 1589588 spots for SRR28623272.sra Written 1589588 spots for SRR28623272.sra Read 1589588 spots for SRR28623272.sra Written 1589588 spots for SRR28623272.sra Read 1589588 spots for SRR28623272.sra Written 1589588 spots for SRR28623272.sra Read 1589588 spots for SRR28623272.sra Written 1589588 spots for SRR28623272.sra Read 1589591 spots for SRR28623272.sra Written 1589591 spots for SRR28623272.sra Read 1589588 spots for SRR28623272.sra Written 1589588 spots for SRR28623272.sra Read 1589588 spots for SRR28623272.sra Written 1589588 spots for SRR28623272.sra Read 1589588 spots for SRR28623272.sra Written 1589588 spots for SRR28623272.sra Read 1589588 spots for SRR28623272.sra Written 1589588 spots for SRR28623272.sra Read 1589588 spots for SRR28623272.sra Written 1589588 spots for SRR28623272.sra Read 1589588 spots for SRR28623272.sra Written 1589588 spots for SRR28623272.sra Read 1589588 spots for SRR28623272.sra Written 1589588 spots for SRR28623272.sra Read 1589588 spots for SRR28623272.sra Written 1589588 spots for SRR28623272.sra Read 1589588 spots for SRR28623272.sra Written 1589588 spots for SRR28623272.sra Read 1589588 spots for SRR28623272.sra Written 1589588 spots for SRR28623272.sra SRR ids: ['SRR28623272.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_imik2z13 SRR28623272.sra spots: 31791763 blocks: [[1, 1589588], [1589589, 3179176], [3179177, 4768764], [4768765, 6358352], [6358353, 7947940], [7947941, 9537528], [9537529, 11127116], [11127117, 12716704], [12716705, 14306292], [14306293, 15895880], [15895881, 17485468], [17485469, 19075056], [19075057, 20664644], [20664645, 22254232], [22254233, 23843820], [23843821, 25433408], [25433409, 27022996], [27022997, 28612584], [28612585, 30202172], [30202173, 31791763]] SRR28623272 file size 11739223 SRR28623272 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR28623272 SRR28623272_1.fastq SRR28623272_2.fastq Input file: SRR28623272_1.fastq Paired file: SRR28623272_2.fastq trimmed: SRR28623272-trimmed-pair1.fastq, SRR28623272-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 13:19:05 2025 >> started Tue Feb 11 13:19:46 2025 >> done (41.078s) 31791763 read pairs processed; of these: 29 ( 0.00%) short read pairs filtered out after trimming by size control 37666 ( 0.12%) empty read pairs filtered out after trimming by size control 31754068 (99.88%) read pairs available; of these: 7208042 (22.70%) trimmed read pairs available after processing 24546026 (77.30%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 3 0.00% 20 3 0.00% 21 1 0.00% 22 3 0.00% 23 3 0.00% 24 8 0.00% 25 6 0.00% 26 4 0.00% 27 9 0.00% 28 10 0.00% 29 20 0.00% 30 10 0.00% 31 26 0.00% 32 24 0.00% 33 17 0.00% 34 25 0.00% 35 25 0.00% 36 40 0.00% 37 46 0.00% 38 49 0.00% 39 51 0.00% 40 70 0.00% 41 102 0.00% 42 118 0.00% 43 106 0.00% 44 116 0.00% 45 129 0.00% 46 151 0.00% 47 189 0.00% 48 265 0.00% 49 277 0.00% 50 360 0.00% 51 389 0.00% 52 447 0.00% 53 513 0.00% 54 574 0.00% 55 657 0.00% 56 709 0.00% 57 822 0.00% 58 1060 0.00% 59 1224 0.00% 60 1441 0.00% 61 1667 0.01% 62 1969 0.01% 63 2304 0.01% 64 2515 0.01% 65 2833 0.01% 66 3139 0.01% 67 3711 0.01% 68 4284 0.01% 69 4579 0.01% 70 5546 0.02% 71 6323 0.02% 72 7431 0.02% 73 8342 0.03% 74 9324 0.03% 75 10442 0.03% 76 11970 0.04% 77 13164 0.04% 78 14396 0.05% 79 16211 0.05% 80 18075 0.06% 81 20064 0.06% 82 22736 0.07% 83 25081 0.08% 84 28022 0.09% 85 30659 0.10% 86 33403 0.11% 87 35983 0.11% 88 37990 0.12% 89 40741 0.13% 90 43140 0.14% 91 46852 0.15% 92 49989 0.16% 93 53363 0.17% 94 57406 0.18% 95 61304 0.19% 96 64394 0.20% 97 67719 0.21% 98 70138 0.22% 99 72009 0.23% 100 74984 0.24% 101 77018 0.24% 102 80391 0.25% 103 83375 0.26% 104 87128 0.27% 105 90480 0.28% 106 94045 0.30% 107 96160 0.30% 108 97736 0.31% 109 100567 0.32% 110 101170 0.32% 111 103005 0.32% 112 105139 0.33% 113 106535 0.34% 114 109871 0.35% 115 114036 0.36% 116 115166 0.36% 117 117393 0.37% 118 119784 0.38% 119 121256 0.38% 120 121858 0.38% 121 121651 0.38% 122 122934 0.39% 123 123186 0.39% 124 126827 0.40% 125 126978 0.40% 126 130079 0.41% 127 131912 0.42% 128 132407 0.42% 129 132588 0.42% 130 135015 0.43% 131 133573 0.42% 132 133860 0.42% 133 134592 0.42% 134 135315 0.43% 135 135395 0.43% 136 137403 0.43% 137 137954 0.43% 138 139919 0.44% 139 141104 0.44% 140 139693 0.44% 141 141155 0.44% 142 140991 0.44% 143 140823 0.44% 144 141065 0.44% 145 141516 0.45% 146 141355 0.45% 147 141644 0.45% 148 143322 0.45% 149 143790 0.45% 150 143577 0.45% 151 24546026 77.30% 31754068 reads passed initial QC criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=1.92 fanout-score-rank=33 prefix-density=0.37 prefix-fanout=1.9 sequence=GTGTTGTCGAATCC criterion=fanout-score sequence-density=0.16 sequence-density-rank=25 fanout-score=16.71 fanout-score-rank=1 prefix-density=0.37 prefix-fanout=7.3 sequence=CCATTCTTGAGTTCCTTCACCTTCAACTCAGCGAATGC criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=2.12 fanout-score-rank=29 prefix-density=0.38 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.15 sequence-density-rank=25 fanout-score=15.31 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=5.6 sequence=GTGCCAAGGTCT SRR28623272 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 13:20:34 Started mapping on | Feb 11 13:20:34 Finished on | Feb 11 13:25:10 Mapping speed, Million of reads per hour | 414.18 Number of input reads | 31754068 Average input read length | 288 UNIQUE READS: Uniquely mapped reads number | 29463206 Uniquely mapped reads % | 92.79% Average mapped length | 287.29 Number of splices: Total | 25778686 Number of splices: Annotated (sjdb) | 25131919 Number of splices: GT/AG | 25228107 Number of splices: GC/AG | 451185 Number of splices: AT/AC | 18847 Number of splices: Non-canonical | 80547 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 2.79 Insertion rate per base | 0.03% Insertion average length | 2.34 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 781666 % of reads mapped to multiple loci | 2.46% Number of reads mapped to too many loci | 259182 % of reads mapped to too many loci | 0.82% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.69% % of reads unmapped: other | 0.25% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1509196 1509196 1509196 N_multimapping 781666 781666 781666 N_noFeature 1213101 29023293 1381529 N_ambiguous 475798 2372 202875 UnstrandedReadsAssigned:27774307 PositiveStrandReadsAssigned:437541 NegativeStrandReadsAssigned:27878802 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=143 echo kmer=139 SRR28623272 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR28623272-trimmed-pair1.fastq SRR28623272-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 31,754,068 reads, 28,219,170 reads pseudoaligned [quant] estimated average fragment length: 213.13 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,087 rounds 52401 SRR28623272.ke.tsv 34699 SRR28623272.se.tsv 87100 total ==> SRR28623272.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1805.87 1410 26.7212 Potri.005G024800.1.v4.1 1035 822.87 589 24.4967 Potri.004G059700.1.v4.1 961 748.889 167 7.63173 Potri.007G009000.2.v4.1 1416 1203.87 0 0 Potri.003G141000.2.v4.1 2943 2730.87 1630.17 20.4294 Potri.016G087400.1.v4.1 270 102.742 1418.44 472.484 Potri.015G069301.1.v4.1 564 357.001 0 0 Potri.010G195200.1.v4.1 1773 1560.87 41 0.898961 Potri.012G127500.1.v4.1 977 764.884 40 1.78973 ==> SRR28623272.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 177 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 422 Potri.001G212900.v4.1 146 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 71 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 56 SRR28623272 completed mapping pipeline successfully