Starting /dee2/code/volunteer_pipeline.sh SRR28623273 current disk space = 3050580787200 free memory = 1500192144 SRR28623273 SRAfilesize fe37fbedbd6d47213402960e33276d93 SRR28623273.sra SRR28623273.sra file validated SRR28623273 is paired end SRR28623273 is conventional basespace SRR28623273 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623273_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.43375 37.0 37.0 37.0 37.0 37.0 2 36.401 37.0 37.0 37.0 37.0 37.0 3 36.5765 37.0 37.0 37.0 37.0 37.0 4 36.591 37.0 37.0 37.0 37.0 37.0 5 36.662 37.0 37.0 37.0 37.0 37.0 6 36.656 37.0 37.0 37.0 37.0 37.0 7 36.6295 37.0 37.0 37.0 37.0 37.0 8 36.4255 37.0 37.0 37.0 37.0 37.0 9 36.533 37.0 37.0 37.0 37.0 37.0 10-14 36.593 37.0 37.0 37.0 37.0 37.0 15-19 36.5387 37.0 37.0 37.0 37.0 37.0 20-24 36.535700000000006 37.0 37.0 37.0 37.0 37.0 25-29 36.483399999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.4338 37.0 37.0 37.0 37.0 37.0 35-39 36.427600000000005 37.0 37.0 37.0 37.0 37.0 40-44 36.393100000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.3495 37.0 37.0 37.0 37.0 37.0 50-54 36.340700000000005 37.0 37.0 37.0 37.0 37.0 55-59 36.2511 37.0 37.0 37.0 37.0 37.0 60-64 36.275999999999996 37.0 37.0 37.0 37.0 37.0 65-69 36.24230000000001 37.0 37.0 37.0 37.0 37.0 70-74 36.149699999999996 37.0 37.0 37.0 37.0 37.0 75-79 36.1709 37.0 37.0 37.0 37.0 37.0 80-84 36.0253 37.0 37.0 37.0 37.0 37.0 85-89 36.0401 37.0 37.0 37.0 37.0 37.0 90-94 35.9804 37.0 37.0 37.0 37.0 37.0 95-99 35.873599999999996 37.0 37.0 37.0 37.0 37.0 100-104 35.9045 37.0 37.0 37.0 37.0 37.0 105-109 35.964099999999995 37.0 37.0 37.0 37.0 37.0 110-114 35.839099999999995 37.0 37.0 37.0 37.0 37.0 115-119 35.8156 37.0 37.0 37.0 37.0 37.0 120-124 35.777300000000004 37.0 37.0 37.0 37.0 37.0 125-129 35.596900000000005 37.0 37.0 37.0 37.0 37.0 130-134 35.745400000000004 37.0 37.0 37.0 37.0 37.0 135-139 35.609899999999996 37.0 37.0 37.0 37.0 37.0 140-144 35.355 37.0 37.0 37.0 37.0 37.0 145-149 35.3317 37.0 37.0 37.0 34.6 37.0 150-151 35.1305 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 2.0 22 2.0 23 1.0 24 5.0 25 7.0 26 5.0 27 7.0 28 17.0 29 33.0 30 28.0 31 48.0 32 44.0 33 82.0 34 140.0 35 379.0 36 2954.0 37 245.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.018551015292054 14.03860616695914 11.105540235648032 40.837302582100776 2 19.05 15.125 35.125 30.7 3 18.375 19.7 26.075 35.85 4 22.275 26.200000000000003 24.65 26.875 5 23.3 33.775 22.725 20.200000000000003 6 21.75 34.675 22.675 20.9 7 13.625000000000002 28.675 41.65 16.05 8 17.175 28.275 31.075000000000003 23.474999999999998 9 17.575 25.1 34.825 22.5 10-14 18.765 30.665 27.605 22.965 15-19 19.27 28.645 28.13 23.955000000000002 20-24 19.545 28.82 27.83 23.805 25-29 19.08 29.705 27.71 23.505000000000003 30-34 18.805 29.09 27.694999999999997 24.41 35-39 19.12 29.68 27.6 23.599999999999998 40-44 19.905 29.025000000000002 27.295 23.775 45-49 20.035 28.939999999999998 28.044999999999998 22.98 50-54 19.575 28.985 27.905 23.535 55-59 20.105 28.884999999999998 28.055000000000003 22.955000000000002 60-64 20.05 28.54 28.03 23.380000000000003 65-69 20.04 28.455000000000002 27.93 23.575 70-74 19.59 29.065 27.589999999999996 23.755000000000003 75-79 20.345 29.185 27.334999999999997 23.135 80-84 19.875 28.994999999999997 27.805000000000003 23.325000000000003 85-89 19.955000000000002 28.694999999999997 27.48 23.87 90-94 20.09 28.865000000000002 27.555000000000003 23.49 95-99 20.585 28.34 27.634999999999998 23.44 100-104 20.4 28.325 27.775 23.5 105-109 20.474999999999998 28.775000000000002 27.310000000000002 23.44 110-114 20.695 28.64 27.21 23.455000000000002 115-119 21.445 28.37 26.565 23.62 120-124 21.085 29.21 26.55 23.155 125-129 21.224999999999998 28.485 26.71 23.580000000000002 130-134 21.279999999999998 28.53 26.515 23.674999999999997 135-139 20.849999999999998 28.075 26.41 24.665 140-144 21.375 27.605 27.55 23.47 145-149 21.195 28.405 26.19 24.21 150-151 21.275 27.8875 27.2625 23.575 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.0 15 0.0 16 0.0 17 0.0 18 1.0 19 2.0 20 2.0 21 2.0 22 1.5 23 2.0 24 3.5 25 7.0 26 9.0 27 9.0 28 11.0 29 12.5 30 24.0 31 36.5 32 38.5 33 47.0 34 65.5 35 80.0 36 88.0 37 113.0 38 142.0 39 163.5 40 189.5 41 216.5 42 252.5 43 291.5 44 289.0 45 263.5 46 255.0 47 231.5 48 210.0 49 186.0 50 161.0 51 143.0 52 107.0 53 82.0 54 65.0 55 48.5 56 35.5 57 26.5 58 21.5 59 15.5 60 14.5 61 8.5 62 2.5 63 4.5 64 3.0 65 1.5 66 2.5 67 1.5 68 1.5 69 2.0 70 1.0 71 1.0 72 1.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.27499999999999997 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.65 #Duplication Level Percentage of deduplicated Percentage of total 1 85.23331364441819 72.15 2 12.079149438865919 20.45 3 2.12640283520378 5.4 4 0.47253396337861786 1.6 5 0.05906674542232723 0.25 6 0.029533372711163616 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTGGAGAATTTGGCCTGTTTTCAGGGTTTTGTTGCTTAAGACTGGCTTTG 6 0.15 No Hit GGCGACACCAAGACATTAAAAAGAGAGGAATAAAAGTAGCATAGGAAAGA 5 0.125 No Hit ATGGAGTCTCCATTGTTGTGCCAAGCAAAACCTCGTTAGCGATTGGGAGA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.21250000000000002 0.0 0.0 0.0 0.0 80-81 0.275 0.0 0.0 0.0 0.0 82-83 0.44999999999999996 0.0 0.0 0.0 0.0 84-85 0.6375 0.0 0.0 0.0 0.0 86-87 0.7875 0.0 0.0 0.0 0.0 88-89 0.925 0.0 0.0 0.0 0.0 90-91 1.2 0.0 0.0 0.0 0.0 92-93 1.475 0.0 0.0 0.0 0.0 94-95 1.7625000000000002 0.0 0.0 0.0 0.0 96-97 2.0625 0.0 0.0 0.0 0.0 98-99 2.5 0.0 0.0 0.0 0.0 100-101 2.7125 0.0 0.0 0.0 0.0 102-103 2.9625000000000004 0.0 0.0 0.0 0.0 104-105 3.3875 0.0 0.0 0.0 0.0 106-107 3.7249999999999996 0.0 0.0 0.0 0.0 108-109 4.0875 0.0 0.0 0.0 0.0 110-111 4.525 0.0 0.0 0.0 0.0 112-113 5.1875 0.0 0.0 0.0 0.0 114-115 5.725 0.0 0.0 0.0 0.0 116-117 6.074999999999999 0.0 0.0 0.0 0.0 118-119 6.6125 0.0 0.0 0.0 0.0 120-121 7.2625 0.0 0.0 0.0 0.0 122-123 7.8625 0.0 0.0 0.0 0.0 124-125 8.7 0.0 0.0 0.0 0.0 126-127 9.3 0.0 0.0 0.0 0.0 128-129 9.8125 0.0 0.0 0.0 0.0 130-131 10.4875 0.0 0.0 0.0 0.0 132-133 11.175 0.0 0.0 0.0 0.0 134-135 12.037500000000001 0.0 0.0 0.0 0.0 136-137 12.5875 0.0 0.0 0.0 0.0 138-139 13.2125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR28623273 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623273_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.9235 37.0 37.0 37.0 37.0 37.0 2 36.267 37.0 37.0 37.0 37.0 37.0 3 36.252 37.0 37.0 37.0 37.0 37.0 4 36.3215 37.0 37.0 37.0 37.0 37.0 5 36.4125 37.0 37.0 37.0 37.0 37.0 6 36.338 37.0 37.0 37.0 37.0 37.0 7 36.375 37.0 37.0 37.0 37.0 37.0 8 36.333 37.0 37.0 37.0 37.0 37.0 9 36.281 37.0 37.0 37.0 37.0 37.0 10-14 36.2512 37.0 37.0 37.0 37.0 37.0 15-19 36.2315 37.0 37.0 37.0 37.0 37.0 20-24 36.234300000000005 37.0 37.0 37.0 37.0 37.0 25-29 36.165400000000005 37.0 37.0 37.0 37.0 37.0 30-34 36.050799999999995 37.0 37.0 37.0 37.0 37.0 35-39 36.043099999999995 37.0 37.0 37.0 37.0 37.0 40-44 35.9926 37.0 37.0 37.0 37.0 37.0 45-49 36.01520000000001 37.0 37.0 37.0 37.0 37.0 50-54 35.9675 37.0 37.0 37.0 37.0 37.0 55-59 35.8358 37.0 37.0 37.0 37.0 37.0 60-64 35.841300000000004 37.0 37.0 37.0 37.0 37.0 65-69 35.9221 37.0 37.0 37.0 37.0 37.0 70-74 35.88000000000001 37.0 37.0 37.0 37.0 37.0 75-79 35.8693 37.0 37.0 37.0 37.0 37.0 80-84 35.78939999999999 37.0 37.0 37.0 37.0 37.0 85-89 35.7084 37.0 37.0 37.0 37.0 37.0 90-94 35.6834 37.0 37.0 37.0 37.0 37.0 95-99 35.6618 37.0 37.0 37.0 37.0 37.0 100-104 35.5984 37.0 37.0 37.0 37.0 37.0 105-109 35.5382 37.0 37.0 37.0 37.0 37.0 110-114 35.6095 37.0 37.0 37.0 37.0 37.0 115-119 35.5317 37.0 37.0 37.0 37.0 37.0 120-124 35.5182 37.0 37.0 37.0 37.0 37.0 125-129 35.0613 37.0 37.0 37.0 29.8 37.0 130-134 35.371300000000005 37.0 37.0 37.0 37.0 37.0 135-139 35.1713 37.0 37.0 37.0 29.8 37.0 140-144 35.1365 37.0 37.0 37.0 29.8 37.0 145-149 35.154399999999995 37.0 37.0 37.0 27.4 37.0 150-151 34.91475 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 3.0 14 8.0 15 5.0 16 10.0 17 1.0 18 3.0 19 2.0 20 2.0 21 5.0 22 6.0 23 4.0 24 4.0 25 6.0 26 12.0 27 13.0 28 16.0 29 14.0 30 37.0 31 40.0 32 46.0 33 100.0 34 186.0 35 597.0 36 2593.0 37 287.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.25 20.474999999999998 13.725000000000001 27.55 2 28.1 26.35 28.375 17.175 3 22.775000000000002 27.200000000000003 31.3 18.725 4 25.35 32.675 22.625 19.35 5 25.650000000000002 36.825 22.55 14.975 6 21.825 37.75 22.6 17.825 7 20.825 20.75 38.175 20.25 8 23.25 25.35 27.250000000000004 24.15 9 24.125 23.95 29.5 22.425 10-14 23.73 29.275000000000002 26.534999999999997 20.46 15-19 24.11 27.834999999999997 27.605 20.45 20-24 23.599999999999998 28.050000000000004 27.3 21.05 25-29 24.21 27.634999999999998 27.57 20.585 30-34 23.189999999999998 27.800000000000004 28.634999999999998 20.375 35-39 23.52 27.96 28.225 20.294999999999998 40-44 23.25 28.74 28.139999999999997 19.869999999999997 45-49 23.665 27.834999999999997 28.355000000000004 20.145 50-54 23.62 28.67 27.765 19.945 55-59 23.474999999999998 27.72 28.68 20.125 60-64 23.275000000000002 27.715 28.449999999999996 20.560000000000002 65-69 24.46 27.794999999999998 27.694999999999997 20.05 70-74 23.455000000000002 27.584999999999997 28.7 20.26 75-79 22.43 27.96 28.765 20.845 80-84 23.955000000000002 28.535 27.73 19.78 85-89 23.9 27.88 28.29 19.93 90-94 23.91 28.095 27.400000000000002 20.595 95-99 23.635 28.54 28.035 19.79 100-104 24.465 28.65 27.015 19.869999999999997 105-109 23.935000000000002 27.794999999999998 28.12 20.150000000000002 110-114 24.88 28.549999999999997 27.334999999999997 19.235 115-119 24.15 28.58 27.32 19.950000000000003 120-124 25.040000000000003 28.405 26.75 19.805 125-129 25.445 28.475 27.22 18.86 130-134 26.540000000000003 28.050000000000004 26.924999999999997 18.485 135-139 25.990000000000002 27.165 27.700000000000003 19.145 140-144 26.13 27.994999999999997 27.26 18.615000000000002 145-149 26.169999999999998 28.01 27.065 18.755 150-151 25.4875 28.275 27.525 18.712500000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.5 5 1.0 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.5 15 0.5 16 0.5 17 1.0 18 1.5 19 2.5 20 1.5 21 0.0 22 1.5 23 4.0 24 4.0 25 5.5 26 6.0 27 7.0 28 9.5 29 11.5 30 14.0 31 27.0 32 42.0 33 46.0 34 54.5 35 67.5 36 87.5 37 107.5 38 139.0 39 173.5 40 200.0 41 235.0 42 250.5 43 249.5 44 258.5 45 246.5 46 257.0 47 262.0 48 219.0 49 187.0 50 157.0 51 144.0 52 119.0 53 86.0 54 68.0 55 48.0 56 42.0 57 34.5 58 22.0 59 17.0 60 13.5 61 10.5 62 7.5 63 7.0 64 5.5 65 2.5 66 4.0 67 2.5 68 0.5 69 0.5 70 1.0 71 2.0 72 1.5 73 1.0 74 1.0 75 1.5 76 1.0 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.5 87 1.0 88 1.0 89 0.5 90 2.0 91 2.0 92 0.0 93 0.5 94 0.5 95 0.0 96 0.5 97 0.5 98 0.0 99 0.5 100 2.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.925 #Duplication Level Percentage of deduplicated Percentage of total 1 85.7815719752723 72.85000000000001 2 11.480718280836031 19.5 3 2.2667059169855754 5.775 4 0.3532528701795702 1.2 5 0.05887547836326171 0.25 6 0.029437739181630854 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.029437739181630854 0.27499999999999997 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 11 0.27499999999999997 No Hit CAGATCCCTCTCTAACCCTTATCTAATCCACCTCTTCTCTTCCTCTTCCA 6 0.15 No Hit GTTCATCGTATCCTTTGCTCGGTTACTATGGAGTATTATTTTTGTTTTCC 5 0.125 No Hit ATTAATTGGAAAATCTTGTTTTTTCTTCCTCGTCCTCAATTCCTCTCTCA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.21250000000000002 0.0 0.0 0.0 0.0 80-81 0.275 0.0 0.0 0.0 0.0 82-83 0.44999999999999996 0.0 0.0 0.0 0.0 84-85 0.6375 0.0 0.0 0.0 0.0 86-87 0.7875 0.0 0.0 0.0 0.0 88-89 0.925 0.0 0.0 0.0 0.0 90-91 1.225 0.0 0.0 0.0 0.0 92-93 1.5 0.0 0.0 0.0 0.0 94-95 1.7875 0.0 0.0 0.0 0.0 96-97 2.0875 0.0 0.0 0.0 0.0 98-99 2.5 0.0 0.0 0.0 0.0 100-101 2.725 0.0 0.0 0.0 0.0 102-103 2.9875 0.0 0.0 0.0 0.0 104-105 3.4124999999999996 0.0 0.0 0.0 0.0 106-107 3.7750000000000004 0.0 0.0 0.0 0.0 108-109 4.1375 0.0 0.0 0.0 0.0 110-111 4.5875 0.0 0.0 0.0 0.0 112-113 5.3 0.0 0.0 0.0 0.0 114-115 5.9 0.0 0.0 0.0 0.0 116-117 6.275 0.0 0.0 0.0 0.0 118-119 6.85 0.0 0.0 0.0 0.0 120-121 7.5 0.0 0.0 0.0 0.0 122-123 8.0875 0.0 0.0 0.0 0.0 124-125 8.95 0.0 0.0 0.0 0.0 126-127 9.55 0.0 0.0 0.0 0.0 128-129 10.0625 0.0 0.0 0.0 0.0 130-131 10.7125 0.0 0.0 0.0 0.0 132-133 11.399999999999999 0.0 0.0 0.0 0.0 134-135 12.212499999999999 0.0 0.0 0.0 0.0 136-137 12.7875 0.0 0.0 0.0 0.0 138-139 13.4125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCTTCTC 10 0.006830828 145.0 6 ACCTTCT 10 0.006830828 145.0 5 >>END_MODULE Read 1533657 spots for SRR28623273.sra Written 1533657 spots for SRR28623273.sra Read 1533657 spots for SRR28623273.sra Written 1533657 spots for SRR28623273.sra Read 1533657 spots for SRR28623273.sra Written 1533657 spots for SRR28623273.sra Read 1533657 spots for SRR28623273.sra Written 1533657 spots for SRR28623273.sra Read 1533657 spots for SRR28623273.sra Written 1533657 spots for SRR28623273.sra Read 1533657 spots for SRR28623273.sra Written 1533657 spots for SRR28623273.sra Read 1533657 spots for SRR28623273.sra Written 1533657 spots for SRR28623273.sra Read 1533657 spots for SRR28623273.sra Written 1533657 spots for SRR28623273.sra Read 1533657 spots for SRR28623273.sra Written 1533657 spots for SRR28623273.sra Read 1533657 spots for SRR28623273.sra Written 1533657 spots for SRR28623273.sra Read 1533657 spots for SRR28623273.sra Written 1533657 spots for SRR28623273.sra Read 1533657 spots for SRR28623273.sra Written 1533657 spots for SRR28623273.sra Read 1533657 spots for SRR28623273.sra Written 1533657 spots for SRR28623273.sra Read 1533657 spots for SRR28623273.sra Written 1533657 spots for SRR28623273.sra Read 1533657 spots for SRR28623273.sra Written 1533657 spots for SRR28623273.sra Read 1533671 spots for SRR28623273.sra Written 1533671 spots for SRR28623273.sra Read 1533657 spots for SRR28623273.sra Written 1533657 spots for SRR28623273.sra Read 1533657 spots for SRR28623273.sra Written 1533657 spots for SRR28623273.sra Read 1533657 spots for SRR28623273.sra Written 1533657 spots for SRR28623273.sra Read 1533657 spots for SRR28623273.sra Written 1533657 spots for SRR28623273.sra SRR ids: ['SRR28623273.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_10yzi38s SRR28623273.sra spots: 30673154 blocks: [[1, 1533657], [1533658, 3067314], [3067315, 4600971], [4600972, 6134628], [6134629, 7668285], [7668286, 9201942], [9201943, 10735599], [10735600, 12269256], [12269257, 13802913], [13802914, 15336570], [15336571, 16870227], [16870228, 18403884], [18403885, 19937541], [19937542, 21471198], [21471199, 23004855], [23004856, 24538512], [24538513, 26072169], [26072170, 27605826], [27605827, 29139483], [29139484, 30673154]] SRR28623273 file size 11325796 SRR28623273 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR28623273 SRR28623273_1.fastq SRR28623273_2.fastq Input file: SRR28623273_1.fastq Paired file: SRR28623273_2.fastq trimmed: SRR28623273-trimmed-pair1.fastq, SRR28623273-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 13:15:14 2025 >> started Tue Feb 11 13:15:50 2025 >> done (35.967s) 30673154 read pairs processed; of these: 29 ( 0.00%) short read pairs filtered out after trimming by size control 17548 ( 0.06%) empty read pairs filtered out after trimming by size control 30655577 (99.94%) read pairs available; of these: 5709153 (18.62%) trimmed read pairs available after processing 24946424 (81.38%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 6 0.00% 20 1 0.00% 21 2 0.00% 22 7 0.00% 23 5 0.00% 24 5 0.00% 25 11 0.00% 26 1 0.00% 27 7 0.00% 28 12 0.00% 29 16 0.00% 30 12 0.00% 31 15 0.00% 32 10 0.00% 33 20 0.00% 34 15 0.00% 35 13 0.00% 36 26 0.00% 37 47 0.00% 38 26 0.00% 39 44 0.00% 40 54 0.00% 41 63 0.00% 42 55 0.00% 43 91 0.00% 44 85 0.00% 45 113 0.00% 46 118 0.00% 47 125 0.00% 48 167 0.00% 49 210 0.00% 50 260 0.00% 51 244 0.00% 52 348 0.00% 53 380 0.00% 54 398 0.00% 55 453 0.00% 56 503 0.00% 57 599 0.00% 58 665 0.00% 59 799 0.00% 60 1030 0.00% 61 1157 0.00% 62 1368 0.00% 63 1573 0.01% 64 1782 0.01% 65 1945 0.01% 66 2206 0.01% 67 2425 0.01% 68 2820 0.01% 69 3402 0.01% 70 3812 0.01% 71 4375 0.01% 72 5143 0.02% 73 5864 0.02% 74 6775 0.02% 75 7492 0.02% 76 8425 0.03% 77 8989 0.03% 78 10290 0.03% 79 11269 0.04% 80 12538 0.04% 81 14112 0.05% 82 16101 0.05% 83 17854 0.06% 84 20264 0.07% 85 21960 0.07% 86 23527 0.08% 87 25214 0.08% 88 26929 0.09% 89 28879 0.09% 90 30425 0.10% 91 32947 0.11% 92 35406 0.12% 93 38281 0.12% 94 41348 0.13% 95 43966 0.14% 96 46166 0.15% 97 48663 0.16% 98 49823 0.16% 99 52573 0.17% 100 54348 0.18% 101 56533 0.18% 102 58730 0.19% 103 61345 0.20% 104 64651 0.21% 105 67084 0.22% 106 69982 0.23% 107 71890 0.23% 108 73234 0.24% 109 74349 0.24% 110 75632 0.25% 111 77565 0.25% 112 79450 0.26% 113 81339 0.27% 114 83272 0.27% 115 86309 0.28% 116 88964 0.29% 117 90699 0.30% 118 92678 0.30% 119 93425 0.30% 120 95151 0.31% 121 95395 0.31% 122 96269 0.31% 123 97803 0.32% 124 99929 0.33% 125 102319 0.33% 126 104524 0.34% 127 106468 0.35% 128 107085 0.35% 129 107934 0.35% 130 109554 0.36% 131 109687 0.36% 132 108978 0.36% 133 111077 0.36% 134 111567 0.36% 135 112939 0.37% 136 114568 0.37% 137 116380 0.38% 138 117190 0.38% 139 119215 0.39% 140 118239 0.39% 141 119681 0.39% 142 119619 0.39% 143 119735 0.39% 144 120571 0.39% 145 121959 0.40% 146 121040 0.39% 147 122095 0.40% 148 125580 0.41% 149 124574 0.41% 150 125396 0.41% 151 24946424 81.38% 30655577 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=12.35 fanout-score-rank=10 prefix-density=0.10 prefix-fanout=12.3 sequence=GGATCGGAAGAGCACACGTCTGAACTCCAGTCACTCGGTTACATCTCGTATGCCGTCTTCTGCTTGAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=54.83 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=7.6 sequence=TGATCAAAACCCTAACAATCTTACATCAAATTACAAGCACGTATGGTCTTGTAATATTTGCAGTAAACCGAGCTTTTTTTTCTAAAAAGGAAGAAAAACAGTAGATGGACATAACCAAACAAGCCACACATCAAGCATCATCATCACCGTTCTATAGAACACAAGAATACTGCCTGCTGCCCTACTGGGAAGCACTCTCCTTTTCTTTCTCCTTCTCTTCTT criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=5.30 fanout-score-rank=23 prefix-density=0.55 prefix-fanout=1.1 sequence=GCAATGGATGCGGTATGTACCCAGA criterion=fanout-score sequence-density=0.07 sequence-density-rank=17 fanout-score=282.15 fanout-score-rank=1 prefix-density=0.95 prefix-fanout=21.0 sequence=AAGAAGAAGAAA SRR28623273 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 13:16:33 Started mapping on | Feb 11 13:16:33 Finished on | Feb 11 13:19:57 Mapping speed, Million of reads per hour | 540.98 Number of input reads | 30655577 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 28462310 Uniquely mapped reads % | 92.85% Average mapped length | 290.04 Number of splices: Total | 24769418 Number of splices: Annotated (sjdb) | 24166275 Number of splices: GT/AG | 24335252 Number of splices: GC/AG | 334233 Number of splices: AT/AC | 26239 Number of splices: Non-canonical | 73694 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.04% Deletion average length | 3.03 Insertion rate per base | 0.03% Insertion average length | 2.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 701778 % of reads mapped to multiple loci | 2.29% Number of reads mapped to too many loci | 253159 % of reads mapped to too many loci | 0.83% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.75% % of reads unmapped: other | 0.29% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1491489 1491489 1491489 N_multimapping 701778 701778 701778 N_noFeature 1312092 28071269 1512748 N_ambiguous 381010 3020 188438 UnstrandedReadsAssigned:26769208 PositiveStrandReadsAssigned:388021 NegativeStrandReadsAssigned:26761124 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR28623273 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR28623273-trimmed-pair1.fastq SRR28623273-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 30,655,577 reads, 27,200,789 reads pseudoaligned [quant] estimated average fragment length: 221.502 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,130 rounds 52401 SRR28623273.ke.tsv 34699 SRR28623273.se.tsv 87100 total ==> SRR28623273.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1797.5 1116 23.34 Potri.005G024800.1.v4.1 1035 814.498 881 40.6622 Potri.004G059700.1.v4.1 961 740.529 95 4.82266 Potri.007G009000.2.v4.1 1416 1195.5 0 0 Potri.003G141000.2.v4.1 2943 2722.5 793.802 10.961 Potri.016G087400.1.v4.1 270 98.1459 1974.6 756.33 Potri.015G069301.1.v4.1 564 348.984 0 0 Potri.010G195200.1.v4.1 1773 1552.5 136 3.29316 Potri.012G127500.1.v4.1 977 756.509 10833 538.319 ==> SRR28623273.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 820 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 512 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 1 SRR28623273 completed mapping pipeline successfully