Starting /dee2/code/volunteer_pipeline.sh SRR28623274 current disk space = 3050619670528 free memory = 1258645360 SRR28623274 SRAfilesize c517f3f4a0d09abe1e42930fa5b39ed6 SRR28623274.sra SRR28623274.sra file validated SRR28623274 is paired end SRR28623274 is conventional basespace SRR28623274 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623274_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.59525 37.0 37.0 37.0 37.0 37.0 2 36.4575 37.0 37.0 37.0 37.0 37.0 3 36.6505 37.0 37.0 37.0 37.0 37.0 4 36.611 37.0 37.0 37.0 37.0 37.0 5 36.7115 37.0 37.0 37.0 37.0 37.0 6 36.6445 37.0 37.0 37.0 37.0 37.0 7 36.637 37.0 37.0 37.0 37.0 37.0 8 36.4965 37.0 37.0 37.0 37.0 37.0 9 36.702 37.0 37.0 37.0 37.0 37.0 10-14 36.6227 37.0 37.0 37.0 37.0 37.0 15-19 36.5586 37.0 37.0 37.0 37.0 37.0 20-24 36.583999999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.497 37.0 37.0 37.0 37.0 37.0 30-34 36.480599999999995 37.0 37.0 37.0 37.0 37.0 35-39 36.4517 37.0 37.0 37.0 37.0 37.0 40-44 36.3988 37.0 37.0 37.0 37.0 37.0 45-49 36.324200000000005 37.0 37.0 37.0 37.0 37.0 50-54 36.3251 37.0 37.0 37.0 37.0 37.0 55-59 36.2729 37.0 37.0 37.0 37.0 37.0 60-64 36.2668 37.0 37.0 37.0 37.0 37.0 65-69 36.278800000000004 37.0 37.0 37.0 37.0 37.0 70-74 36.157 37.0 37.0 37.0 37.0 37.0 75-79 36.1763 37.0 37.0 37.0 37.0 37.0 80-84 36.0781 37.0 37.0 37.0 37.0 37.0 85-89 36.1112 37.0 37.0 37.0 37.0 37.0 90-94 36.0083 37.0 37.0 37.0 37.0 37.0 95-99 35.9259 37.0 37.0 37.0 37.0 37.0 100-104 35.983999999999995 37.0 37.0 37.0 37.0 37.0 105-109 35.9337 37.0 37.0 37.0 37.0 37.0 110-114 35.7986 37.0 37.0 37.0 37.0 37.0 115-119 35.8683 37.0 37.0 37.0 37.0 37.0 120-124 35.7465 37.0 37.0 37.0 37.0 37.0 125-129 35.603 37.0 37.0 37.0 37.0 37.0 130-134 35.677499999999995 37.0 37.0 37.0 37.0 37.0 135-139 35.4851 37.0 37.0 37.0 37.0 37.0 140-144 35.234899999999996 37.0 37.0 37.0 27.4 37.0 145-149 35.2322 37.0 37.0 37.0 32.2 37.0 150-151 34.906499999999994 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 2.0 22 1.0 23 3.0 24 6.0 25 6.0 26 6.0 27 5.0 28 13.0 29 13.0 30 31.0 31 35.0 32 62.0 33 97.0 34 174.0 35 392.0 36 2922.0 37 231.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.870894961143144 15.69315617949361 9.501128102281275 39.93482075708197 2 20.525 15.45 33.875 30.15 3 17.75 18.725 27.474999999999998 36.05 4 22.85 25.3 23.925 27.925 5 24.375 32.300000000000004 23.65 19.675 6 23.275000000000002 34.175 20.925 21.625 7 14.524999999999999 29.825000000000003 39.35 16.3 8 17.549999999999997 27.675 31.624999999999996 23.150000000000002 9 18.975 23.775 32.85 24.4 10-14 19.46 31.28 27.165 22.095000000000002 15-19 19.595000000000002 29.104999999999997 27.305 23.995 20-24 20.599999999999998 29.25 26.06 24.09 25-29 19.595000000000002 28.685 27.644999999999996 24.075 30-34 19.814999999999998 28.810000000000002 26.805 24.57 35-39 20.0 29.26 27.36 23.380000000000003 40-44 19.965 29.110000000000003 26.99 23.935000000000002 45-49 20.085 29.294999999999998 26.185000000000002 24.435000000000002 50-54 20.075000000000003 29.07 26.150000000000002 24.705 55-59 19.45 28.585 27.639999999999997 24.325 60-64 20.165 29.12 27.045 23.669999999999998 65-69 20.3 29.455 26.41 23.835 70-74 20.625 29.134999999999998 26.840000000000003 23.400000000000002 75-79 20.385 28.720000000000002 26.939999999999998 23.955000000000002 80-84 20.7 28.435 26.884999999999998 23.98 85-89 20.19 29.5 26.590000000000003 23.72 90-94 20.849999999999998 28.660000000000004 26.895000000000003 23.595 95-99 20.06 28.970000000000002 26.565 24.404999999999998 100-104 20.745 28.65 26.855 23.75 105-109 21.05 28.87 25.77 24.310000000000002 110-114 20.32 29.604999999999997 25.53 24.545 115-119 21.11 28.634999999999998 25.465 24.79 120-124 21.315 28.884999999999998 25.180000000000003 24.62 125-129 21.195 28.455000000000002 25.419999999999998 24.93 130-134 21.33 28.735 25.595000000000002 24.34 135-139 21.47 28.04 25.259999999999998 25.230000000000004 140-144 21.415 27.845 25.405 25.335 145-149 21.044999999999998 27.584999999999997 25.805 25.564999999999998 150-151 20.849999999999998 26.2625 26.887499999999996 26.0 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 1.0 19 2.0 20 2.5 21 2.5 22 1.5 23 2.0 24 2.5 25 2.0 26 5.5 27 6.5 28 7.5 29 10.5 30 16.5 31 28.0 32 41.0 33 59.0 34 74.0 35 92.0 36 111.0 37 110.0 38 121.5 39 153.5 40 175.0 41 201.5 42 233.5 43 246.5 44 241.0 45 243.5 46 241.0 47 225.0 48 205.5 49 182.5 50 175.5 51 155.5 52 121.0 53 103.0 54 81.5 55 62.0 56 49.5 57 33.0 58 26.5 59 22.0 60 15.5 61 14.0 62 12.5 63 10.0 64 7.0 65 8.5 66 9.5 67 9.0 68 6.5 69 5.0 70 3.5 71 1.5 72 2.0 73 2.5 74 5.5 75 3.5 76 1.5 77 2.0 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.27499999999999997 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 85.77343981070689 72.5 2 11.239278320023661 19.0 3 2.2774327122153206 5.775 4 0.5028098195800059 1.7000000000000002 5 0.14788524105294293 0.625 6 0.02957704821058858 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02957704821058858 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CGATAGAACTCGCACCGAGCTCCAGCTATCCTGAGGGAAACTTCGGAGGG 10 0.25 No Hit GTCTAGACTTTCATATGGTAGAGCTTCCCCTGAAACTGCTTTTGCAAGAG 6 0.15 No Hit ATTCAGTCTAATGTACTCCCAGACACCAGGCCTCGGGCGCAGAGCAAGAG 5 0.125 No Hit GCTTCATTCACGGTGATGTTACGCCCATCAAGGTCTTGGCCGTTCATTCC 5 0.125 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACCACGTTGTATCTCGTAT 5 0.125 TruSeq Adapter, Index 7 (97% over 35bp) AACCTACGTCTACTAACAGGAATCTTAATAAATTCAGGGTAAAGCTTAGT 5 0.125 No Hit GCATGCGTCTTGTATGTCCTTCACCACAAGTTCCCAGTAAGCAGTTTCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.07500000000000001 0.0 0.0 0.0 0.0 66-67 0.15 0.0 0.0 0.0 0.0 68-69 0.175 0.0 0.0 0.0 0.0 70-71 0.2875 0.0 0.0 0.0 0.0 72-73 0.3 0.0 0.0 0.0 0.0 74-75 0.3125 0.0 0.0 0.0 0.0 76-77 0.375 0.0 0.0 0.0 0.0 78-79 0.5249999999999999 0.0 0.0 0.0 0.0 80-81 0.6375 0.0 0.0 0.0 0.0 82-83 0.8125 0.0 0.0 0.0 0.0 84-85 1.0375 0.0 0.0 0.0 0.0 86-87 1.25 0.0 0.0 0.0 0.0 88-89 1.725 0.0 0.0 0.0 0.0 90-91 2.1875 0.0 0.0 0.0 0.0 92-93 2.6625 0.0 0.0 0.0 0.0 94-95 3.075 0.0 0.0 0.0 0.0 96-97 3.5 0.0 0.0 0.0 0.0 98-99 4.05 0.0 0.0 0.0 0.0 100-101 4.65 0.0 0.0 0.0 0.0 102-103 5.262499999999999 0.0 0.0 0.0 0.0 104-105 6.012499999999999 0.0 0.0 0.0 0.0 106-107 6.575 0.0 0.0 0.0 0.0 108-109 7.1625 0.0 0.0 0.0 0.0 110-111 7.9624999999999995 0.0 0.0 0.0 0.0 112-113 8.8625 0.0 0.0 0.0 0.0 114-115 9.625 0.0 0.0 0.0 0.0 116-117 10.65 0.0 0.0 0.0 0.0 118-119 11.524999999999999 0.0 0.0 0.0 0.0 120-121 12.35 0.0 0.0 0.0 0.0 122-123 13.175 0.0 0.0 0.0 0.0 124-125 13.975 0.0 0.0 0.0 0.0 126-127 14.7125 0.0 0.0 0.0 0.0 128-129 15.524999999999999 0.0 0.0 0.0 0.0 130-131 16.799999999999997 0.0 0.0 0.0 0.0 132-133 17.75 0.0 0.0 0.0 0.0 134-135 18.75 0.0 0.0 0.0 0.0 136-137 19.700000000000003 0.0 0.0 0.0 0.0 138-139 20.725 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR28623274 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623274_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.789 37.0 37.0 37.0 37.0 37.0 2 36.3185 37.0 37.0 37.0 37.0 37.0 3 36.334 37.0 37.0 37.0 37.0 37.0 4 36.2975 37.0 37.0 37.0 37.0 37.0 5 36.3745 37.0 37.0 37.0 37.0 37.0 6 36.299 37.0 37.0 37.0 37.0 37.0 7 36.3005 37.0 37.0 37.0 37.0 37.0 8 36.2965 37.0 37.0 37.0 37.0 37.0 9 36.218 37.0 37.0 37.0 37.0 37.0 10-14 36.1689 37.0 37.0 37.0 37.0 37.0 15-19 36.21750000000001 37.0 37.0 37.0 37.0 37.0 20-24 36.1475 37.0 37.0 37.0 37.0 37.0 25-29 36.12910000000001 37.0 37.0 37.0 37.0 37.0 30-34 36.046800000000005 37.0 37.0 37.0 37.0 37.0 35-39 36.0709 37.0 37.0 37.0 37.0 37.0 40-44 36.043 37.0 37.0 37.0 37.0 37.0 45-49 36.0079 37.0 37.0 37.0 37.0 37.0 50-54 36.02290000000001 37.0 37.0 37.0 37.0 37.0 55-59 35.880199999999995 37.0 37.0 37.0 37.0 37.0 60-64 35.8621 37.0 37.0 37.0 37.0 37.0 65-69 35.893800000000006 37.0 37.0 37.0 37.0 37.0 70-74 35.9029 37.0 37.0 37.0 37.0 37.0 75-79 35.8605 37.0 37.0 37.0 37.0 37.0 80-84 35.7808 37.0 37.0 37.0 37.0 37.0 85-89 35.6889 37.0 37.0 37.0 37.0 37.0 90-94 35.690200000000004 37.0 37.0 37.0 37.0 37.0 95-99 35.6649 37.0 37.0 37.0 37.0 37.0 100-104 35.597899999999996 37.0 37.0 37.0 37.0 37.0 105-109 35.5433 37.0 37.0 37.0 37.0 37.0 110-114 35.6361 37.0 37.0 37.0 37.0 37.0 115-119 35.566 37.0 37.0 37.0 37.0 37.0 120-124 35.5326 37.0 37.0 37.0 37.0 37.0 125-129 35.05839999999999 37.0 37.0 37.0 32.2 37.0 130-134 35.3755 37.0 37.0 37.0 37.0 37.0 135-139 35.189 37.0 37.0 37.0 29.8 37.0 140-144 35.1994 37.0 37.0 37.0 29.8 37.0 145-149 35.0194 37.0 37.0 37.0 27.4 37.0 150-151 34.667 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 3.0 14 7.0 15 6.0 16 4.0 17 2.0 18 5.0 19 1.0 20 5.0 21 6.0 22 9.0 23 6.0 24 10.0 25 7.0 26 6.0 27 13.0 28 14.0 29 20.0 30 29.0 31 43.0 32 38.0 33 100.0 34 207.0 35 575.0 36 2572.0 37 312.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.225 22.175 13.4 25.2 2 29.675 24.725 28.475 17.125 3 21.6 27.775 32.775 17.849999999999998 4 26.075 32.125 23.599999999999998 18.2 5 26.674999999999997 34.4 22.400000000000002 16.525000000000002 6 22.85 38.1 23.150000000000002 15.9 7 22.775000000000002 20.7 37.475 19.05 8 24.375 24.5 27.400000000000002 23.724999999999998 9 24.0 24.125 29.025000000000002 22.85 10-14 25.115 28.43 25.724999999999998 20.73 15-19 24.62 27.700000000000003 27.229999999999997 20.45 20-24 23.655 28.52 27.22 20.605 25-29 24.755 27.865000000000002 27.205000000000002 20.175 30-34 24.959999999999997 27.46 27.215 20.365 35-39 23.810000000000002 27.6 28.17 20.419999999999998 40-44 24.04 28.365000000000002 27.74 19.855 45-49 23.765 27.21 28.24 20.785 50-54 23.830000000000002 28.084999999999997 27.589999999999996 20.495 55-59 24.165 27.560000000000002 28.04 20.235 60-64 24.685000000000002 27.150000000000002 27.96 20.205000000000002 65-69 23.755000000000003 27.63 28.325 20.29 70-74 24.345 27.045 27.950000000000003 20.66 75-79 24.54 27.255000000000003 28.075 20.13 80-84 24.18 28.194999999999997 27.075 20.549999999999997 85-89 24.66 27.615000000000002 27.634999999999998 20.09 90-94 24.83 27.189999999999998 28.34 19.64 95-99 24.69 27.894999999999996 28.09 19.325 100-104 25.685000000000002 27.215 27.27 19.830000000000002 105-109 25.28 27.735 27.575 19.41 110-114 25.840000000000003 27.91 27.46 18.790000000000003 115-119 26.515 28.065 26.52 18.9 120-124 26.63 28.005000000000003 26.44 18.925 125-129 26.75 27.41 26.595000000000002 19.245 130-134 26.534999999999997 28.355000000000004 26.529999999999998 18.58 135-139 27.915 26.86 27.125 18.099999999999998 140-144 27.644999999999996 27.345000000000002 26.615 18.395 145-149 28.13 26.36 27.365000000000002 18.145 150-151 28.3125 26.237500000000004 27.400000000000002 18.05 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 1.0 6 0.5 7 1.0 8 2.0 9 1.0 10 0.0 11 1.0 12 2.0 13 1.5 14 0.5 15 0.5 16 1.0 17 2.0 18 1.5 19 0.0 20 2.0 21 3.5 22 2.5 23 1.5 24 3.0 25 4.0 26 2.5 27 4.5 28 7.0 29 10.0 30 15.0 31 23.0 32 33.0 33 43.0 34 48.0 35 59.5 36 84.5 37 102.0 38 136.5 39 165.0 40 176.5 41 202.5 42 231.0 43 249.0 44 255.5 45 278.5 46 264.5 47 232.0 48 216.0 49 188.5 50 166.0 51 140.5 52 122.5 53 100.0 54 73.0 55 53.0 56 42.5 57 36.0 58 26.5 59 24.0 60 24.0 61 23.5 62 19.5 63 17.0 64 13.5 65 6.5 66 2.0 67 2.0 68 3.0 69 4.5 70 5.0 71 2.0 72 3.5 73 4.0 74 2.0 75 1.5 76 3.0 77 4.0 78 2.0 79 1.0 80 0.5 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.5 90 1.5 91 1.0 92 0.0 93 0.0 94 0.0 95 0.5 96 1.0 97 0.5 98 0.0 99 0.0 100 3.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.05 #Duplication Level Percentage of deduplicated Percentage of total 1 86.27278071722516 73.375 2 10.96413874191652 18.65 3 1.9988242210464433 5.1 4 0.6172839506172839 2.1 5 0.058788947677836566 0.25 6 0.058788947677836566 0.3 7 0.0 0.0 8 0.0 0.0 9 0.029394473838918283 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 9 0.22499999999999998 No Hit GGAGTCTGACATGTGTGCGAGTCAACGGGCGAGTAAACCCGTAAGGCGCA 6 0.15 No Hit CTATTGTAAGGAGGCCTACTGATGGGAAGCTGGTTGGTTATAATACAGAT 6 0.15 No Hit TGAGACTCTCAAGGCTCATCGCAATGAAATTGTTGCGTTACTCACAAGGA 5 0.125 No Hit ACTGCTTCTAATCTTTCTTTACCTTCTGATTATGCTGTTAGTATGGTTCT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.07500000000000001 0.0 0.0 0.0 0.0 66-67 0.15 0.0 0.0 0.0 0.0 68-69 0.175 0.0 0.0 0.0 0.0 70-71 0.2875 0.0 0.0 0.0 0.0 72-73 0.35 0.0 0.0 0.0 0.0 74-75 0.3875 0.0 0.0 0.0 0.0 76-77 0.44999999999999996 0.0 0.0 0.0 0.0 78-79 0.6125 0.0 0.0 0.0 0.0 80-81 0.7375 0.0 0.0 0.0 0.0 82-83 0.9125 0.0 0.0 0.0 0.0 84-85 1.1375 0.0 0.0 0.0 0.0 86-87 1.35 0.0 0.0 0.0 0.0 88-89 1.85 0.0 0.0 0.0 0.0 90-91 2.3 0.0 0.0 0.0 0.0 92-93 2.7625 0.0 0.0 0.0 0.0 94-95 3.175 0.0 0.0 0.0 0.0 96-97 3.5999999999999996 0.0 0.0 0.0 0.0 98-99 4.15 0.0 0.0 0.0 0.0 100-101 4.75 0.0 0.0 0.0 0.0 102-103 5.362500000000001 0.0 0.0 0.0 0.0 104-105 6.1375 0.0 0.0 0.0 0.0 106-107 6.7625 0.0 0.0 0.0 0.0 108-109 7.3625 0.0 0.0 0.0 0.0 110-111 8.175 0.0 0.0 0.0 0.0 112-113 9.0625 0.0 0.0 0.0 0.0 114-115 9.8375 0.0 0.0 0.0 0.0 116-117 10.85 0.0 0.0 0.0 0.0 118-119 11.774999999999999 0.0 0.0 0.0 0.0 120-121 12.6125 0.0 0.0 0.0 0.0 122-123 13.4875 0.0 0.0 0.0 0.0 124-125 14.325 0.0 0.0 0.0 0.0 126-127 15.100000000000001 0.0 0.0 0.0 0.0 128-129 15.875 0.0 0.0 0.0 0.0 130-131 17.174999999999997 0.0 0.0 0.0 0.0 132-133 18.1375 0.0 0.0 0.0 0.0 134-135 19.15 0.0 0.0 0.0 0.0 136-137 20.1375 0.0 0.0 0.0 0.0 138-139 21.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGTCCTC 10 0.006830828 145.0 7 GTCCTCA 10 0.006830828 145.0 8 TATTTTA 10 0.006830828 145.0 3 ATTTTAC 10 0.006830828 145.0 4 >>END_MODULE Read 1598380 spots for SRR28623274.sra Written 1598380 spots for SRR28623274.sra Read 1598380 spots for SRR28623274.sra Written 1598380 spots for SRR28623274.sra Read 1598380 spots for SRR28623274.sra Written 1598380 spots for SRR28623274.sra Read 1598380 spots for SRR28623274.sra Written 1598380 spots for SRR28623274.sra Read 1598380 spots for SRR28623274.sra Written 1598380 spots for SRR28623274.sra Read 1598380 spots for SRR28623274.sra Written 1598380 spots for SRR28623274.sra Read 1598380 spots for SRR28623274.sra Written 1598380 spots for SRR28623274.sra Read 1598395 spots for SRR28623274.sra Written 1598395 spots for SRR28623274.sra Read 1598380 spots for SRR28623274.sra Written 1598380 spots for SRR28623274.sra Read 1598380 spots for SRR28623274.sra Written 1598380 spots for SRR28623274.sra Read 1598380 spots for SRR28623274.sra Written 1598380 spots for SRR28623274.sra Read 1598380 spots for SRR28623274.sra Written 1598380 spots for SRR28623274.sra Read 1598380 spots for SRR28623274.sra Written 1598380 spots for SRR28623274.sra Read 1598380 spots for SRR28623274.sra Written 1598380 spots for SRR28623274.sra Read 1598380 spots for SRR28623274.sra Written 1598380 spots for SRR28623274.sra Read 1598380 spots for SRR28623274.sra Written 1598380 spots for SRR28623274.sra Read 1598380 spots for SRR28623274.sra Written 1598380 spots for SRR28623274.sra Read 1598380 spots for SRR28623274.sra Written 1598380 spots for SRR28623274.sra Read 1598380 spots for SRR28623274.sra Written 1598380 spots for SRR28623274.sra Read 1598380 spots for SRR28623274.sra Written 1598380 spots for SRR28623274.sra SRR ids: ['SRR28623274.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ua_ut5xu SRR28623274.sra spots: 31967615 blocks: [[1, 1598380], [1598381, 3196760], [3196761, 4795140], [4795141, 6393520], [6393521, 7991900], [7991901, 9590280], [9590281, 11188660], [11188661, 12787040], [12787041, 14385420], [14385421, 15983800], [15983801, 17582180], [17582181, 19180560], [19180561, 20778940], [20778941, 22377320], [22377321, 23975700], [23975701, 25574080], [25574081, 27172460], [27172461, 28770840], [28770841, 30369220], [30369221, 31967615]] SRR28623274 file size 11804216 SRR28623274 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR28623274 SRR28623274_1.fastq SRR28623274_2.fastq Input file: SRR28623274_1.fastq Paired file: SRR28623274_2.fastq trimmed: SRR28623274-trimmed-pair1.fastq, SRR28623274-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 13:02:37 2025 >> started Tue Feb 11 13:03:15 2025 >> done (37.796s) 31967615 read pairs processed; of these: 26 ( 0.00%) short read pairs filtered out after trimming by size control 73920 ( 0.23%) empty read pairs filtered out after trimming by size control 31893669 (99.77%) read pairs available; of these: 8181515 (25.65%) trimmed read pairs available after processing 23712154 (74.35%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 7 0.00% 20 2 0.00% 21 3 0.00% 22 6 0.00% 23 11 0.00% 24 13 0.00% 25 4 0.00% 26 13 0.00% 27 19 0.00% 28 11 0.00% 29 19 0.00% 30 18 0.00% 31 21 0.00% 32 36 0.00% 33 37 0.00% 34 31 0.00% 35 54 0.00% 36 51 0.00% 37 72 0.00% 38 84 0.00% 39 92 0.00% 40 117 0.00% 41 137 0.00% 42 153 0.00% 43 147 0.00% 44 170 0.00% 45 215 0.00% 46 232 0.00% 47 291 0.00% 48 333 0.00% 49 409 0.00% 50 540 0.00% 51 635 0.00% 52 699 0.00% 53 794 0.00% 54 835 0.00% 55 917 0.00% 56 1151 0.00% 57 1238 0.00% 58 1559 0.00% 59 1739 0.01% 60 2146 0.01% 61 2491 0.01% 62 2958 0.01% 63 3388 0.01% 64 3745 0.01% 65 4117 0.01% 66 4761 0.01% 67 5316 0.02% 68 5935 0.02% 69 6724 0.02% 70 7810 0.02% 71 9121 0.03% 72 10523 0.03% 73 12190 0.04% 74 13672 0.04% 75 15235 0.05% 76 16537 0.05% 77 18352 0.06% 78 19838 0.06% 79 22054 0.07% 80 24402 0.08% 81 27392 0.09% 82 30657 0.10% 83 33710 0.11% 84 37874 0.12% 85 41655 0.13% 86 43947 0.14% 87 47000 0.15% 88 49749 0.16% 89 51841 0.16% 90 55186 0.17% 91 59370 0.19% 92 62148 0.19% 93 68220 0.21% 94 72593 0.23% 95 76927 0.24% 96 81285 0.25% 97 83871 0.26% 98 86529 0.27% 99 88916 0.28% 100 90576 0.28% 101 93136 0.29% 102 96200 0.30% 103 100512 0.32% 104 104443 0.33% 105 107667 0.34% 106 110958 0.35% 107 113697 0.36% 108 113458 0.36% 109 116126 0.36% 110 116791 0.37% 111 118291 0.37% 112 121696 0.38% 113 121231 0.38% 114 125200 0.39% 115 128925 0.40% 116 131483 0.41% 117 132977 0.42% 118 134224 0.42% 119 134302 0.42% 120 134817 0.42% 121 135543 0.42% 122 136358 0.43% 123 137574 0.43% 124 139269 0.44% 125 141432 0.44% 126 142874 0.45% 127 144844 0.45% 128 145717 0.46% 129 147024 0.46% 130 147399 0.46% 131 146206 0.46% 132 145150 0.46% 133 147284 0.46% 134 145136 0.46% 135 146927 0.46% 136 148712 0.47% 137 150299 0.47% 138 151299 0.47% 139 151891 0.48% 140 150599 0.47% 141 151785 0.48% 142 151156 0.47% 143 149450 0.47% 144 151462 0.47% 145 150727 0.47% 146 148520 0.47% 147 151221 0.47% 148 152461 0.48% 149 151433 0.47% 150 151953 0.48% 151 23712154 74.35% 31893669 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=15.84 fanout-score-rank=5 prefix-density=0.20 prefix-fanout=15.8 sequence=GGATCGGAAGAGCACACGTCTGAACTCCAGTCACCACGTTGTATCTCGTATGCCGTCTTCTGCTTGAAAA criterion=fanout-score sequence-density=0.02 sequence-density-rank=32 fanout-score=126.06 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=13.4 sequence=GAGAAGAAATCATAGATTGCAACCAATAGATAAGGGTTGATTGTACTCCAACATCTCCTGATCGGTTCACTTGGCACTGGCAAGTTGGGTGCGGAGGAGCTTGGCAGCATCAACCATGTTCTTGAGAGCTGGCTTCACCTCAGAGTACTTGCGAGTTTTGAGTCCACAGTCAGGGTTAACCCACAATATGTTTGTCTCAAGCACTGCAAGCATCTTGTTGATTCTATCAGCAATCTC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=33 prefix-density=0.15 prefix-fanout=2.0 sequence=AATAGGTTCTTGAAGACAGC criterion=fanout-score sequence-density=0.06 sequence-density-rank=26 fanout-score=30.66 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=4.2 sequence=TCTTGAAGAATGGTGATGCTGGGTTTGTGAAGATGATTCCCACCAAGCCTATGGTTGTTGAGACCTTTTCTGCCTATCCTCCTCTTGGTCGTTTTGCAGTGAGGGACATGCGTCAGACCGTGGCGGTTGGTGTCATTAAGAGTGTTGAGAAGAAGGATCCATCTGGTGCCAAGGTCACCAAGTCTGCAGTAAAGAAAAAGTGAAGTGTTTGCTTAGTTACAGTTTAGACTAGTTTATGTCTGCTTTTCTGCCTGTTTGATTTTATCTTCTCTTCAAGTTTTG SRR28623274 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 13:03:57 Started mapping on | Feb 11 13:03:58 Finished on | Feb 11 13:07:25 Mapping speed, Million of reads per hour | 554.67 Number of input reads | 31893669 Average input read length | 286 UNIQUE READS: Uniquely mapped reads number | 28376249 Uniquely mapped reads % | 88.97% Average mapped length | 284.75 Number of splices: Total | 20294695 Number of splices: Annotated (sjdb) | 19802997 Number of splices: GT/AG | 19938386 Number of splices: GC/AG | 264682 Number of splices: AT/AC | 21008 Number of splices: Non-canonical | 70619 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.04% Deletion average length | 2.94 Insertion rate per base | 0.03% Insertion average length | 2.25 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 658393 % of reads mapped to multiple loci | 2.06% Number of reads mapped to too many loci | 1580136 % of reads mapped to too many loci | 4.95% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.09% % of reads unmapped: other | 0.92% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2859027 2859027 2859027 N_multimapping 658393 658393 658393 N_noFeature 1226432 27907050 1447211 N_ambiguous 371870 4617 119765 UnstrandedReadsAssigned:26777947 PositiveStrandReadsAssigned:464582 NegativeStrandReadsAssigned:26809273 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=137 echo kmer=133 SRR28623274 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR28623274-trimmed-pair1.fastq SRR28623274-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 31,893,669 reads, 28,608,651 reads pseudoaligned [quant] estimated average fragment length: 200.567 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,262 rounds 52401 SRR28623274.ke.tsv 34699 SRR28623274.se.tsv 87100 total ==> SRR28623274.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1818.43 821 18.0198 Potri.005G024800.1.v4.1 1035 835.433 155 7.40499 Potri.004G059700.1.v4.1 961 761.439 23 1.20558 Potri.007G009000.2.v4.1 1416 1216.43 0 0 Potri.003G141000.2.v4.1 2943 2743.43 307.243 4.46984 Potri.016G087400.1.v4.1 270 106.922 1759.77 656.891 Potri.015G069301.1.v4.1 564 367.992 0 0 Potri.010G195200.1.v4.1 1773 1573.43 99 2.51126 Potri.012G127500.1.v4.1 977 777.433 6773 347.714 ==> SRR28623274.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2855 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 544 Potri.001G212900.v4.1 7 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR28623274 completed mapping pipeline successfully