Starting /dee2/code/volunteer_pipeline.sh SRR28623275 current disk space = 3050248036352 free memory = 1578160224 SRR28623275 SRAfilesize 0763189c2ec68f3137ab15a703a79ab7 SRR28623275.sra SRR28623275.sra file validated SRR28623275 is paired end SRR28623275 is conventional basespace SRR28623275 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623275_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.50925 37.0 37.0 37.0 37.0 37.0 2 36.4895 37.0 37.0 37.0 37.0 37.0 3 36.683 37.0 37.0 37.0 37.0 37.0 4 36.704 37.0 37.0 37.0 37.0 37.0 5 36.623 37.0 37.0 37.0 37.0 37.0 6 36.664 37.0 37.0 37.0 37.0 37.0 7 36.6125 37.0 37.0 37.0 37.0 37.0 8 36.4665 37.0 37.0 37.0 37.0 37.0 9 36.6415 37.0 37.0 37.0 37.0 37.0 10-14 36.6416 37.0 37.0 37.0 37.0 37.0 15-19 36.6228 37.0 37.0 37.0 37.0 37.0 20-24 36.5663 37.0 37.0 37.0 37.0 37.0 25-29 36.556599999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.5111 37.0 37.0 37.0 37.0 37.0 35-39 36.495 37.0 37.0 37.0 37.0 37.0 40-44 36.455 37.0 37.0 37.0 37.0 37.0 45-49 36.4168 37.0 37.0 37.0 37.0 37.0 50-54 36.3427 37.0 37.0 37.0 37.0 37.0 55-59 36.3144 37.0 37.0 37.0 37.0 37.0 60-64 36.3506 37.0 37.0 37.0 37.0 37.0 65-69 36.317499999999995 37.0 37.0 37.0 37.0 37.0 70-74 36.2625 37.0 37.0 37.0 37.0 37.0 75-79 36.16799999999999 37.0 37.0 37.0 37.0 37.0 80-84 36.137299999999996 37.0 37.0 37.0 37.0 37.0 85-89 36.1288 37.0 37.0 37.0 37.0 37.0 90-94 36.1132 37.0 37.0 37.0 37.0 37.0 95-99 35.9457 37.0 37.0 37.0 37.0 37.0 100-104 36.0029 37.0 37.0 37.0 37.0 37.0 105-109 36.058299999999996 37.0 37.0 37.0 37.0 37.0 110-114 35.8962 37.0 37.0 37.0 37.0 37.0 115-119 35.8977 37.0 37.0 37.0 37.0 37.0 120-124 35.7642 37.0 37.0 37.0 37.0 37.0 125-129 35.6481 37.0 37.0 37.0 37.0 37.0 130-134 35.749700000000004 37.0 37.0 37.0 37.0 37.0 135-139 35.6608 37.0 37.0 37.0 37.0 37.0 140-144 35.3774 37.0 37.0 37.0 37.0 37.0 145-149 35.2087 37.0 37.0 37.0 29.8 37.0 150-151 35.05075 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 2.0 22 0.0 23 3.0 24 4.0 25 2.0 26 7.0 27 9.0 28 15.0 29 15.0 30 28.0 31 32.0 32 57.0 33 85.0 34 141.0 35 404.0 36 2948.0 37 248.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 29.18864606882693 14.56920371765888 13.28811856317508 42.95403165033911 2 17.599999999999998 16.975 36.625 28.799999999999997 3 17.7 19.475 27.275 35.55 4 22.15 27.025 22.525000000000002 28.299999999999997 5 23.225 32.800000000000004 23.775 20.200000000000003 6 21.25 36.425000000000004 23.825 18.5 7 15.675 31.35 37.574999999999996 15.4 8 16.45 30.7 31.075000000000003 21.775 9 16.925 27.150000000000002 34.599999999999994 21.325 10-14 18.775 32.074999999999996 27.625 21.525 15-19 18.735 29.865000000000002 28.32 23.080000000000002 20-24 19.005 30.19 27.605 23.200000000000003 25-29 18.83 30.36 27.405 23.405 30-34 18.490000000000002 30.680000000000003 27.560000000000002 23.27 35-39 18.995 30.375000000000004 27.189999999999998 23.44 40-44 19.5 29.99 27.175 23.335 45-49 19.345000000000002 30.385 27.0 23.27 50-54 19.384999999999998 30.37 26.855 23.39 55-59 19.689999999999998 29.45 27.825 23.035 60-64 19.66 29.7 27.04 23.599999999999998 65-69 19.64 30.220000000000002 26.619999999999997 23.52 70-74 19.215 29.575000000000003 26.91 24.3 75-79 19.32 29.805 27.155 23.72 80-84 20.365 29.86 26.765 23.01 85-89 20.485 29.07 26.97 23.474999999999998 90-94 20.205000000000002 29.475 26.834999999999997 23.485 95-99 20.275000000000002 29.494999999999997 27.165 23.064999999999998 100-104 20.34 29.59 26.669999999999998 23.400000000000002 105-109 20.645 29.675 26.3 23.380000000000003 110-114 20.66 29.45 26.235000000000003 23.655 115-119 20.495 28.605000000000004 27.075 23.825 120-124 21.099999999999998 28.999999999999996 25.374999999999996 24.525 125-129 20.485 29.67 25.779999999999998 24.065 130-134 21.09 29.005 25.72 24.185000000000002 135-139 21.175 28.744999999999997 25.645 24.435000000000002 140-144 21.175 27.810000000000002 26.155 24.86 145-149 21.955 27.51 25.685000000000002 24.85 150-151 21.762500000000003 28.9125 25.637500000000003 23.6875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.5 22 2.5 23 2.0 24 3.5 25 6.0 26 10.5 27 15.5 28 17.0 29 28.0 30 39.0 31 44.0 32 67.5 33 86.5 34 112.0 35 127.0 36 133.0 37 135.5 38 143.0 39 178.0 40 189.5 41 196.5 42 214.0 43 217.0 44 216.5 45 237.5 46 229.5 47 207.0 48 192.5 49 161.0 50 145.0 51 128.0 52 108.0 53 87.0 54 71.0 55 61.0 56 42.0 57 29.5 58 29.5 59 26.0 60 15.5 61 11.0 62 6.0 63 3.5 64 4.0 65 3.0 66 3.5 67 4.0 68 3.5 69 2.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.475 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.0 #Duplication Level Percentage of deduplicated Percentage of total 1 85.38235294117648 72.575 2 12.0 20.4 3 2.264705882352941 5.775 4 0.29411764705882354 1.0 5 0.0588235294117647 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGTACAAGGATAATCCATCGCATATAAGACCGGAATCATCAATAATCTAC 5 0.125 No Hit GACATGCAGATTCCAGCAGGCAAGCATGCAAATCCCTGTTGCATTAACTT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.0875 0.0 0.0 0.0 0.0 68-69 0.1125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.1625 0.0 0.0 0.0 0.0 74-75 0.25 0.0 0.0 0.0 0.0 76-77 0.32499999999999996 0.0 0.0 0.0 0.0 78-79 0.4125 0.0 0.0 0.0 0.0 80-81 0.4625 0.0 0.0 0.0 0.0 82-83 0.5875 0.0 0.0 0.0 0.0 84-85 0.8125 0.0 0.0 0.0 0.0 86-87 1.0375 0.0 0.0 0.0 0.0 88-89 1.3375 0.0 0.0 0.0 0.0 90-91 1.6375 0.0 0.0 0.0 0.0 92-93 1.8624999999999998 0.0 0.0 0.0 0.0 94-95 2.275 0.0 0.0 0.0 0.0 96-97 2.6375 0.0 0.0 0.0 0.0 98-99 2.95 0.0 0.0 0.0 0.0 100-101 3.6125 0.0 0.0 0.0 0.0 102-103 4.175000000000001 0.0 0.0 0.0 0.0 104-105 4.6875 0.0 0.0 0.0 0.0 106-107 5.3 0.0 0.0 0.0 0.0 108-109 6.074999999999999 0.0 0.0 0.0 0.0 110-111 6.5375 0.0 0.0 0.0 0.0 112-113 7.125 0.0 0.0 0.0 0.0 114-115 8.0 0.0 0.0 0.0 0.0 116-117 8.912500000000001 0.0 0.0 0.0 0.0 118-119 10.025 0.0 0.0 0.0 0.0 120-121 11.1875 0.0 0.0 0.0 0.0 122-123 12.15 0.0 0.0 0.0 0.0 124-125 12.8625 0.0 0.0 0.0 0.0 126-127 13.587499999999999 0.0 0.0 0.0 0.0 128-129 14.35 0.0 0.0 0.0 0.0 130-131 15.4125 0.0 0.0 0.0 0.0 132-133 16.225 0.0 0.0 0.0 0.0 134-135 16.975 0.0 0.0 0.0 0.0 136-137 17.825000000000003 0.0 0.0 0.0 0.0 138-139 18.7625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTACAA 10 0.006830828 145.0 7 CAAGTAC 10 0.006830828 145.0 4 ATTTACA 10 0.006830828 145.0 6 >>END_MODULE SRR28623275 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623275_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.0345 37.0 37.0 37.0 37.0 37.0 2 36.4705 37.0 37.0 37.0 37.0 37.0 3 36.3245 37.0 37.0 37.0 37.0 37.0 4 36.441 37.0 37.0 37.0 37.0 37.0 5 36.496 37.0 37.0 37.0 37.0 37.0 6 36.4165 37.0 37.0 37.0 37.0 37.0 7 36.4315 37.0 37.0 37.0 37.0 37.0 8 36.401 37.0 37.0 37.0 37.0 37.0 9 36.3885 37.0 37.0 37.0 37.0 37.0 10-14 36.341300000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.3658 37.0 37.0 37.0 37.0 37.0 20-24 36.3114 37.0 37.0 37.0 37.0 37.0 25-29 36.318 37.0 37.0 37.0 37.0 37.0 30-34 36.1913 37.0 37.0 37.0 37.0 37.0 35-39 36.188300000000005 37.0 37.0 37.0 37.0 37.0 40-44 36.1798 37.0 37.0 37.0 37.0 37.0 45-49 36.1983 37.0 37.0 37.0 37.0 37.0 50-54 36.196 37.0 37.0 37.0 37.0 37.0 55-59 36.0024 37.0 37.0 37.0 37.0 37.0 60-64 35.9609 37.0 37.0 37.0 37.0 37.0 65-69 36.11280000000001 37.0 37.0 37.0 37.0 37.0 70-74 36.108000000000004 37.0 37.0 37.0 37.0 37.0 75-79 36.0812 37.0 37.0 37.0 37.0 37.0 80-84 35.9735 37.0 37.0 37.0 37.0 37.0 85-89 35.909400000000005 37.0 37.0 37.0 37.0 37.0 90-94 35.8878 37.0 37.0 37.0 37.0 37.0 95-99 35.8929 37.0 37.0 37.0 37.0 37.0 100-104 35.8041 37.0 37.0 37.0 37.0 37.0 105-109 35.8082 37.0 37.0 37.0 37.0 37.0 110-114 35.7913 37.0 37.0 37.0 37.0 37.0 115-119 35.7179 37.0 37.0 37.0 37.0 37.0 120-124 35.7187 37.0 37.0 37.0 37.0 37.0 125-129 35.2972 37.0 37.0 37.0 32.2 37.0 130-134 35.5603 37.0 37.0 37.0 37.0 37.0 135-139 35.319900000000004 37.0 37.0 37.0 32.2 37.0 140-144 35.4128 37.0 37.0 37.0 37.0 37.0 145-149 35.3738 37.0 37.0 37.0 34.6 37.0 150-151 34.94925 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 1.0 14 5.0 15 2.0 16 4.0 17 2.0 18 5.0 19 2.0 20 3.0 21 3.0 22 6.0 23 6.0 24 4.0 25 4.0 26 7.0 27 7.0 28 9.0 29 16.0 30 21.0 31 28.0 32 41.0 33 93.0 34 159.0 35 555.0 36 2721.0 37 295.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.425000000000004 18.875 16.5 28.199999999999996 2 28.9 25.174999999999997 28.95 16.975 3 20.95 28.325 31.25 19.475 4 24.224999999999998 31.55 24.45 19.775000000000002 5 26.974999999999998 34.125 22.625 16.275000000000002 6 21.05 38.425 23.175 17.349999999999998 7 20.8 21.85 37.974999999999994 19.375 8 23.150000000000002 26.5 28.549999999999997 21.8 9 23.474999999999998 24.15 30.599999999999998 21.775 10-14 24.585 28.665000000000003 26.340000000000003 20.41 15-19 23.79 28.24 27.6 20.369999999999997 20-24 23.805 28.93 27.55 19.715 25-29 24.709999999999997 27.72 27.595 19.975 30-34 23.995 27.495000000000005 28.470000000000002 20.04 35-39 24.275 27.735 27.465 20.525 40-44 24.0 27.685 28.165000000000003 20.150000000000002 45-49 23.765 27.450000000000003 28.225 20.560000000000002 50-54 24.005000000000003 27.075 28.275 20.645 55-59 22.900000000000002 27.07 29.709999999999997 20.32 60-64 24.2 26.66 29.035 20.105 65-69 23.31 27.175 29.24 20.275000000000002 70-74 24.55 27.634999999999998 27.805000000000003 20.01 75-79 23.77 27.125 28.84 20.265 80-84 23.36 27.62 29.315 19.705000000000002 85-89 23.97 28.63 27.889999999999997 19.509999999999998 90-94 23.674999999999997 28.435 28.62 19.27 95-99 24.05 28.015 28.175 19.759999999999998 100-104 24.62 27.965 28.1 19.314999999999998 105-109 24.505 28.189999999999998 28.294999999999998 19.009999999999998 110-114 25.169999999999998 27.794999999999998 27.605 19.43 115-119 25.900000000000002 27.74 27.860000000000003 18.5 120-124 25.740000000000002 27.54 27.54 19.18 125-129 26.015 28.999999999999996 26.47 18.515 130-134 26.900000000000002 28.265 26.96 17.875 135-139 27.215 27.125 27.615000000000002 18.045 140-144 27.43 27.905 27.365000000000002 17.299999999999997 145-149 27.36 28.1 26.76 17.78 150-151 27.6375 27.5625 27.437499999999996 17.3625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 1.0 7 0.5 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.5 16 1.5 17 1.0 18 2.0 19 2.0 20 0.0 21 0.0 22 1.0 23 2.0 24 2.5 25 3.5 26 6.5 27 8.5 28 7.5 29 15.5 30 22.0 31 27.5 32 43.5 33 57.0 34 67.0 35 84.5 36 109.0 37 112.5 38 133.5 39 172.0 40 195.0 41 206.0 42 218.5 43 227.5 44 226.5 45 258.5 46 275.0 47 229.0 48 196.0 49 189.0 50 159.5 51 131.0 52 112.5 53 102.5 54 86.5 55 67.5 56 58.0 57 48.5 58 36.5 59 22.5 60 15.0 61 13.0 62 10.0 63 7.5 64 5.0 65 1.5 66 1.0 67 1.0 68 1.0 69 1.5 70 1.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.5 77 1.0 78 0.5 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.5 95 1.0 96 0.5 97 0.0 98 0.0 99 0.0 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 85.93978368897983 73.5 2 11.57556270096463 19.8 3 2.133878982753581 5.475 4 0.3215434083601286 1.0999999999999999 5 0.029231218941829874 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.0875 0.0 0.0 0.0 0.0 68-69 0.1125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.1625 0.0 0.0 0.0 0.0 74-75 0.25 0.0 0.0 0.0 0.0 76-77 0.35 0.0 0.0 0.0 0.0 78-79 0.4375 0.0 0.0 0.0 0.0 80-81 0.4875 0.0 0.0 0.0 0.0 82-83 0.6125 0.0 0.0 0.0 0.0 84-85 0.8375 0.0 0.0 0.0 0.0 86-87 1.0625 0.0 0.0 0.0 0.0 88-89 1.3625 0.0 0.0 0.0 0.0 90-91 1.6875 0.0 0.0 0.0 0.0 92-93 1.9125 0.0 0.0 0.0 0.0 94-95 2.325 0.0 0.0 0.0 0.0 96-97 2.6875 0.0 0.0 0.0 0.0 98-99 3.0 0.0 0.0 0.0 0.0 100-101 3.6624999999999996 0.0 0.0 0.0 0.0 102-103 4.237500000000001 0.0 0.0 0.0 0.0 104-105 4.762499999999999 0.0 0.0 0.0 0.0 106-107 5.35 0.0 0.0 0.0 0.0 108-109 6.1625 0.0 0.0 0.0 0.0 110-111 6.612500000000001 0.0 0.0 0.0 0.0 112-113 7.2 0.0 0.0 0.0 0.0 114-115 8.1 0.0 0.0 0.0 0.0 116-117 9.075 0.0 0.0 0.0 0.0 118-119 10.25 0.0 0.0 0.0 0.0 120-121 11.4375 0.0 0.0 0.0 0.0 122-123 12.375 0.0 0.0 0.0 0.0 124-125 13.125 0.0 0.0 0.0 0.0 126-127 13.8875 0.0 0.0 0.0 0.0 128-129 14.675 0.0 0.0 0.0 0.0 130-131 15.75 0.0 0.0 0.0 0.0 132-133 16.575 0.0 0.0 0.0 0.0 134-135 17.375 0.0 0.0 0.0 0.0 136-137 18.325000000000003 0.0 0.0 0.0 0.0 138-139 19.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACGAAA 10 0.006830828 145.0 1 ATAAAAG 10 0.006830828 145.0 8 CGAAAAT 10 0.006830828 145.0 3 ACGAAAA 10 0.006830828 145.0 2 AAAAAAA 115 5.2083124E-8 15.130436 95-99 >>END_MODULE Read 1841267 spots for SRR28623275.sra Written 1841267 spots for SRR28623275.sra Read 1841267 spots for SRR28623275.sra Written 1841267 spots for SRR28623275.sra Read 1841267 spots for SRR28623275.sra Written 1841267 spots for SRR28623275.sra Read 1841267 spots for SRR28623275.sra Written 1841267 spots for SRR28623275.sra Read 1841267 spots for SRR28623275.sra Written 1841267 spots for SRR28623275.sra Read 1841267 spots for SRR28623275.sra Written 1841267 spots for SRR28623275.sra Read 1841267 spots for SRR28623275.sra Written 1841267 spots for SRR28623275.sra Read 1841267 spots for SRR28623275.sra Written 1841267 spots for SRR28623275.sra Read 1841267 spots for SRR28623275.sra Written 1841267 spots for SRR28623275.sra Read 1841267 spots for SRR28623275.sra Written 1841267 spots for SRR28623275.sra Read 1841267 spots for SRR28623275.sra Written 1841267 spots for SRR28623275.sra Read 1841267 spots for SRR28623275.sra Written 1841267 spots for SRR28623275.sra Read 1841267 spots for SRR28623275.sra Written 1841267 spots for SRR28623275.sra Read 1841267 spots for SRR28623275.sra Written 1841267 spots for SRR28623275.sra Read 1841267 spots for SRR28623275.sra Written 1841267 spots for SRR28623275.sra Read 1841267 spots for SRR28623275.sra Written 1841267 spots for SRR28623275.sra Read 1841267 spots for SRR28623275.sra Written 1841267 spots for SRR28623275.sra Read 1841267 spots for SRR28623275.sra Written 1841267 spots for SRR28623275.sra Read 1841281 spots for SRR28623275.sra Written 1841281 spots for SRR28623275.sra Read 1841267 spots for SRR28623275.sra Written 1841267 spots for SRR28623275.sra SRR ids: ['SRR28623275.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_thj7dn4y SRR28623275.sra spots: 36825354 blocks: [[1, 1841267], [1841268, 3682534], [3682535, 5523801], [5523802, 7365068], [7365069, 9206335], [9206336, 11047602], [11047603, 12888869], [12888870, 14730136], [14730137, 16571403], [16571404, 18412670], [18412671, 20253937], [20253938, 22095204], [22095205, 23936471], [23936472, 25777738], [25777739, 27619005], [27619006, 29460272], [29460273, 31301539], [31301540, 33142806], [33142807, 34984073], [34984074, 36825354]] SRR28623275 file size 13599611 SRR28623275 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR28623275 SRR28623275_1.fastq SRR28623275_2.fastq Input file: SRR28623275_1.fastq Paired file: SRR28623275_2.fastq trimmed: SRR28623275-trimmed-pair1.fastq, SRR28623275-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 14:05:46 2025 >> started Tue Feb 11 14:06:32 2025 >> done (45.539s) 36825354 read pairs processed; of these: 21 ( 0.00%) short read pairs filtered out after trimming by size control 39504 ( 0.11%) empty read pairs filtered out after trimming by size control 36785829 (99.89%) read pairs available; of these: 9474509 (25.76%) trimmed read pairs available after processing 27311320 (74.24%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 4 0.00% 21 4 0.00% 22 5 0.00% 23 6 0.00% 24 6 0.00% 25 9 0.00% 26 7 0.00% 27 8 0.00% 28 5 0.00% 29 16 0.00% 30 17 0.00% 31 15 0.00% 32 15 0.00% 33 33 0.00% 34 23 0.00% 35 35 0.00% 36 36 0.00% 37 44 0.00% 38 50 0.00% 39 60 0.00% 40 86 0.00% 41 81 0.00% 42 130 0.00% 43 138 0.00% 44 153 0.00% 45 159 0.00% 46 188 0.00% 47 243 0.00% 48 274 0.00% 49 348 0.00% 50 435 0.00% 51 510 0.00% 52 547 0.00% 53 694 0.00% 54 745 0.00% 55 816 0.00% 56 908 0.00% 57 1136 0.00% 58 1332 0.00% 59 1449 0.00% 60 1795 0.00% 61 2057 0.01% 62 2364 0.01% 63 2805 0.01% 64 3174 0.01% 65 3532 0.01% 66 4140 0.01% 67 4661 0.01% 68 5209 0.01% 69 6097 0.02% 70 6885 0.02% 71 7938 0.02% 72 9434 0.03% 73 10747 0.03% 74 12368 0.03% 75 13896 0.04% 76 15258 0.04% 77 17083 0.05% 78 18970 0.05% 79 21303 0.06% 80 23213 0.06% 81 25876 0.07% 82 29034 0.08% 83 32341 0.09% 84 36355 0.10% 85 39729 0.11% 86 42899 0.12% 87 46565 0.13% 88 49499 0.13% 89 52877 0.14% 90 56138 0.15% 91 59794 0.16% 92 63884 0.17% 93 68264 0.19% 94 74675 0.20% 95 78700 0.21% 96 83061 0.23% 97 86578 0.24% 98 90052 0.24% 99 92750 0.25% 100 96590 0.26% 101 99560 0.27% 102 102958 0.28% 103 107630 0.29% 104 111115 0.30% 105 116719 0.32% 106 121016 0.33% 107 125515 0.34% 108 127354 0.35% 109 129757 0.35% 110 131477 0.36% 111 134447 0.37% 112 136305 0.37% 113 138575 0.38% 114 142561 0.39% 115 148142 0.40% 116 152008 0.41% 117 155214 0.42% 118 157008 0.43% 119 159444 0.43% 120 159579 0.43% 121 160259 0.44% 122 161014 0.44% 123 162127 0.44% 124 165753 0.45% 125 166177 0.45% 126 171039 0.46% 127 173553 0.47% 128 175666 0.48% 129 176177 0.48% 130 177445 0.48% 131 176855 0.48% 132 178550 0.49% 133 180467 0.49% 134 180335 0.49% 135 180114 0.49% 136 182302 0.50% 137 184226 0.50% 138 186508 0.51% 139 189693 0.52% 140 188612 0.51% 141 188348 0.51% 142 189031 0.51% 143 187635 0.51% 144 187363 0.51% 145 187744 0.51% 146 188228 0.51% 147 188655 0.51% 148 191264 0.52% 149 192078 0.52% 150 191544 0.52% 151 27311320 74.24% 36785829 reads passed initial QC criterion=sequence-density sequence-density=0.63 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=30 prefix-density=0.62 prefix-fanout=2.0 sequence=GTTAGGGTAAGCTTTCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=152.39 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=10.6 sequence=AAAACAACAACTCAACCCCAAGGGTTTTATTTTTAAGGAATAGCAGCACTCCCTTCACATAGCACAGCACAAACAAGAAATCAAGACACGAACATTCAGTGGTTCAAAACCAGCATTTATTGCACATTACATTACTTTATTCCCATGAAATAGCCCGGCCGAAGTCGTTACTCCTGAGCATTTAGTAGAGAAAGTAGTCTATCACAAGACGCTGTGACAAAGTAGGCAAAAATCCTTCTGCAAATGCAGCAAGAGCAGCAGAATCGAGGTACTCTTGCAAACCTGACTTGCTCTCAAATGTAGATTCAAAGGCATGAGTGTATCCTCGGTTTAGCTCCGCAGACTCCATGCCCAAATCCGTGCCCCAATTGAAACTCTTCATGGTTGGAATGAGATCGAGCAGATTGGTATAGTCATTAATGTAGTTGTCGATTTGTTCTCGTGTGATCTCATCCTTGAACCGAGTCAACAATGTGTGCTTCACAAGCTTTGGAGTTCTGGTTGCCATGTC criterion=sequence-density sequence-density=0.57 sequence-density-rank=1 fanout-score=5.12 fanout-score-rank=4 prefix-density=0.82 prefix-fanout=3.6 sequence=AAGAAAGCTTACCCTAAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=20.65 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=3.7 sequence=CTGGACATTAATTAGGGCTGAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTTCCTCCTATGGTTTTCAAAACAATCACCATCATGCTATTAATGATATTAAAATCCCAACTATACCAAAGAATATCCCAATTATCCATAAAACTGTAACTAAGTGAGGCTCTCTCATTGGTTTATACTTCAATATAAGCCTTGGTAGGGATAGATAGCCACCTATATAGTATAGCTTCCCATCTTCTTTGAGAGTTGTTGGTTTATGCTCATCCCTACTCATAACCCCAGCACTTAGATATTTTAAAGAGGCATCTATCACATAAGGCATCATTATAACTAAAAATGGGATATATTCCTTATAAACTACTGCTAAGACAGCTAAGAAAGCTCCAATTGGTAGAGTTCCAACATCTCCTGGAAAAACCTTTGCTGGATATTTGTTAAATATCAATAGCCCTAAATAGGATGCAGAGAATATCAAAGCGGA SRR28623275 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 14:07:16 Started mapping on | Feb 11 14:07:16 Finished on | Feb 11 14:12:26 Mapping speed, Million of reads per hour | 427.19 Number of input reads | 36785829 Average input read length | 287 UNIQUE READS: Uniquely mapped reads number | 33424158 Uniquely mapped reads % | 90.86% Average mapped length | 285.60 Number of splices: Total | 24549059 Number of splices: Annotated (sjdb) | 23920942 Number of splices: GT/AG | 23953014 Number of splices: GC/AG | 470405 Number of splices: AT/AC | 30263 Number of splices: Non-canonical | 95377 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.04% Deletion average length | 2.88 Insertion rate per base | 0.03% Insertion average length | 2.26 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1021725 % of reads mapped to multiple loci | 2.78% Number of reads mapped to too many loci | 453002 % of reads mapped to too many loci | 1.23% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.87% % of reads unmapped: other | 0.26% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2339946 2339946 2339946 N_multimapping 1021725 1021725 1021725 N_noFeature 1338409 32853047 1509912 N_ambiguous 625483 3115 224000 UnstrandedReadsAssigned:31460266 PositiveStrandReadsAssigned:567996 NegativeStrandReadsAssigned:31690246 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=138 echo kmer=133 SRR28623275 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR28623275-trimmed-pair1.fastq SRR28623275-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 36,785,829 reads, 32,527,575 reads pseudoaligned [quant] estimated average fragment length: 198.422 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,251 rounds 52401 SRR28623275.ke.tsv 34699 SRR28623275.se.tsv 87100 total ==> SRR28623275.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1820.58 584 8.83218 Potri.005G024800.1.v4.1 1035 837.578 383 12.5904 Potri.004G059700.1.v4.1 961 763.587 219 7.89678 Potri.007G009000.2.v4.1 1416 1218.58 0 0 Potri.003G141000.2.v4.1 2943 2745.58 562 5.63595 Potri.016G087400.1.v4.1 270 104.652 1955.19 514.407 Potri.015G069301.1.v4.1 564 368.947 0 0 Potri.010G195200.1.v4.1 1773 1575.58 0 0 Potri.012G127500.1.v4.1 977 779.578 4336 153.142 ==> SRR28623275.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 50 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 536 Potri.001G212900.v4.1 686 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR28623275 completed mapping pipeline successfully