Starting /dee2/code/volunteer_pipeline.sh SRR28623277 current disk space = 3050343010304 free memory = 1155834116 SRR28623277 SRAfilesize 6ba1464990e6512008c75b8db5773e07 SRR28623277.sra SRR28623277.sra file validated SRR28623277 is paired end SRR28623277 is conventional basespace SRR28623277 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623277_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.38625 37.0 37.0 37.0 37.0 37.0 2 36.529 37.0 37.0 37.0 37.0 37.0 3 36.636 37.0 37.0 37.0 37.0 37.0 4 36.6385 37.0 37.0 37.0 37.0 37.0 5 36.6425 37.0 37.0 37.0 37.0 37.0 6 36.6255 37.0 37.0 37.0 37.0 37.0 7 36.5865 37.0 37.0 37.0 37.0 37.0 8 36.5845 37.0 37.0 37.0 37.0 37.0 9 36.6045 37.0 37.0 37.0 37.0 37.0 10-14 36.6115 37.0 37.0 37.0 37.0 37.0 15-19 36.523900000000005 37.0 37.0 37.0 37.0 37.0 20-24 36.469 37.0 37.0 37.0 37.0 37.0 25-29 36.478300000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.43470000000001 37.0 37.0 37.0 37.0 37.0 35-39 36.37910000000001 37.0 37.0 37.0 37.0 37.0 40-44 36.3591 37.0 37.0 37.0 37.0 37.0 45-49 36.291000000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.2 37.0 37.0 37.0 37.0 37.0 55-59 36.123799999999996 37.0 37.0 37.0 37.0 37.0 60-64 36.24640000000001 37.0 37.0 37.0 37.0 37.0 65-69 36.1824 37.0 37.0 37.0 37.0 37.0 70-74 36.07940000000001 37.0 37.0 37.0 37.0 37.0 75-79 36.165000000000006 37.0 37.0 37.0 37.0 37.0 80-84 36.063700000000004 37.0 37.0 37.0 37.0 37.0 85-89 36.095 37.0 37.0 37.0 37.0 37.0 90-94 36.08390000000001 37.0 37.0 37.0 37.0 37.0 95-99 35.9069 37.0 37.0 37.0 37.0 37.0 100-104 35.9659 37.0 37.0 37.0 37.0 37.0 105-109 35.9692 37.0 37.0 37.0 37.0 37.0 110-114 35.839800000000004 37.0 37.0 37.0 37.0 37.0 115-119 35.883799999999994 37.0 37.0 37.0 37.0 37.0 120-124 35.707899999999995 37.0 37.0 37.0 37.0 37.0 125-129 35.5948 37.0 37.0 37.0 37.0 37.0 130-134 35.692099999999996 37.0 37.0 37.0 37.0 37.0 135-139 35.420899999999996 37.0 37.0 37.0 37.0 37.0 140-144 35.075 37.0 37.0 37.0 27.4 37.0 145-149 34.8356 37.0 37.0 37.0 27.4 37.0 150-151 34.53875 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 2.0 23 2.0 24 4.0 25 4.0 26 6.0 27 13.0 28 21.0 29 22.0 30 39.0 31 47.0 32 77.0 33 108.0 34 157.0 35 374.0 36 2850.0 37 273.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.21580928481807 13.42534504391468 8.506900878293601 33.851944792973654 2 19.6 15.4 35.075 29.925 3 17.175 20.175 30.425 32.225 4 21.175 26.3 25.374999999999996 27.150000000000002 5 23.425 34.449999999999996 23.5 18.625 6 21.525 35.375 22.85 20.25 7 14.75 29.65 39.35 16.25 8 15.7 29.099999999999998 32.4 22.8 9 17.875 23.75 34.9 23.474999999999998 10-14 19.12 31.995 27.345000000000002 21.54 15-19 19.55 29.415000000000003 27.655 23.380000000000003 20-24 19.52 29.735 27.735 23.01 25-29 19.585 29.42 27.215 23.78 30-34 19.035 29.755 27.800000000000004 23.41 35-39 19.11 29.23 27.650000000000002 24.01 40-44 19.33 29.345 27.779999999999998 23.544999999999998 45-49 20.29 28.95 27.395000000000003 23.365 50-54 19.645000000000003 29.285 27.415 23.655 55-59 20.07 29.849999999999998 26.650000000000002 23.43 60-64 20.005 29.5 27.62 22.875 65-69 20.355 29.01 27.700000000000003 22.935 70-74 19.79 29.43 27.625 23.155 75-79 19.785 29.675 26.555 23.985 80-84 19.875 29.085 27.76 23.28 85-89 20.565 29.04 27.029999999999998 23.365 90-94 20.275000000000002 28.799999999999997 26.97 23.955000000000002 95-99 20.24 28.865000000000002 27.54 23.355 100-104 20.419999999999998 29.95 25.96 23.669999999999998 105-109 20.979999999999997 28.804999999999996 26.27 23.945 110-114 21.065 29.07 26.540000000000003 23.325000000000003 115-119 20.96 29.049999999999997 26.740000000000002 23.25 120-124 21.21 29.134999999999998 26.015 23.64 125-129 21.945 28.735 25.590000000000003 23.73 130-134 21.495 28.305000000000003 26.345000000000002 23.855 135-139 21.575 28.49 25.765 24.169999999999998 140-144 22.95 27.985 25.525 23.54 145-149 22.93 28.29 25.1 23.68 150-151 22.9375 27.800000000000004 24.6875 24.575 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.5 15 0.5 16 1.0 17 1.5 18 1.0 19 0.5 20 2.0 21 2.5 22 0.5 23 2.0 24 5.5 25 5.0 26 3.5 27 9.0 28 13.5 29 15.0 30 23.0 31 41.5 32 56.5 33 69.0 34 81.0 35 93.5 36 118.0 37 142.0 38 150.5 39 166.0 40 192.0 41 215.0 42 241.0 43 245.0 44 235.0 45 234.0 46 238.0 47 220.0 48 194.5 49 182.5 50 160.5 51 132.5 52 105.5 53 86.5 54 74.5 55 56.5 56 41.0 57 39.0 58 29.5 59 17.5 60 15.0 61 10.0 62 4.5 63 3.0 64 2.0 65 2.0 66 3.0 67 1.0 68 0.0 69 1.5 70 2.0 71 0.5 72 1.0 73 2.0 74 1.5 75 1.0 76 1.5 77 2.0 78 1.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.375 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 86.925 #Duplication Level Percentage of deduplicated Percentage of total 1 87.46045441472535 76.02499999999999 2 10.555076215127984 18.35 3 1.610583836640782 4.2 4 0.23008340523439746 0.8 5 0.14380212827149844 0.625 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCAGATTGACAGTGGTTTCTACAGCTTTCATGGCTTCAAATCTTGGCTC 5 0.125 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACGGATACCAATCTCGGTT 5 0.125 TruSeq Adapter, Index 11 (97% over 39bp) GGGAAGGGCCAAAAGGCATAAATATTAGGCATGATTTTGCATTCAGAACA 5 0.125 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACGGATACCAATCTCGGGT 5 0.125 TruSeq Adapter, Index 11 (97% over 39bp) AGGAAGGACACTTGAACCCTTCAGGTGGGGTCTTGCCACAGTCAACAAGG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.25 0.0 0.0 0.0 0.0 76-77 0.3625 0.0 0.0 0.0 0.0 78-79 0.375 0.0 0.0 0.0 0.0 80-81 0.5249999999999999 0.0 0.0 0.0 0.0 82-83 0.7 0.0 0.0 0.0 0.0 84-85 0.9 0.0 0.0 0.0 0.0 86-87 1.1875 0.0 0.0 0.0 0.0 88-89 1.3875 0.0 0.0 0.0 0.0 90-91 1.575 0.0 0.0 0.0 0.0 92-93 1.95 0.0 0.0 0.0 0.0 94-95 2.425 0.0 0.0 0.0 0.0 96-97 2.8625 0.0 0.0 0.0 0.0 98-99 3.2625 0.0 0.0 0.0 0.0 100-101 3.8125 0.0 0.0 0.0 0.0 102-103 4.45 0.0 0.0 0.0 0.0 104-105 4.975 0.0 0.0 0.0 0.0 106-107 5.4125 0.0 0.0 0.0 0.0 108-109 5.8125 0.0 0.0 0.0 0.0 110-111 6.3 0.0 0.0 0.0 0.0 112-113 6.95 0.0 0.0 0.0 0.0 114-115 7.5875 0.0 0.0 0.0 0.0 116-117 8.3625 0.0 0.0 0.0 0.0 118-119 8.8875 0.0 0.0 0.0 0.0 120-121 9.5625 0.0 0.0 0.0 0.0 122-123 10.337499999999999 0.0 0.0 0.0 0.0 124-125 11.05 0.0 0.0 0.0 0.0 126-127 11.65 0.0 0.0 0.0 0.0 128-129 12.3125 0.0 0.0 0.0 0.0 130-131 13.1125 0.0 0.0 0.0 0.0 132-133 14.2 0.0 0.0 0.0 0.0 134-135 15.175 0.0 0.0 0.0 0.0 136-137 16.275 0.0 0.0 0.0 0.0 138-139 17.0875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCCTTTC 10 0.006830828 145.0 5 CTATATC 10 0.006830828 145.0 1 TATATCA 10 0.006830828 145.0 2 TATCATT 10 0.006830828 145.0 4 >>END_MODULE SRR28623277 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623277_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.111 37.0 37.0 37.0 37.0 37.0 2 36.2085 37.0 37.0 37.0 37.0 37.0 3 36.2855 37.0 37.0 37.0 37.0 37.0 4 36.127 37.0 37.0 37.0 37.0 37.0 5 36.2135 37.0 37.0 37.0 37.0 37.0 6 36.1285 37.0 37.0 37.0 37.0 37.0 7 36.187 37.0 37.0 37.0 37.0 37.0 8 36.112 37.0 37.0 37.0 37.0 37.0 9 35.978 37.0 37.0 37.0 37.0 37.0 10-14 35.9631 37.0 37.0 37.0 37.0 37.0 15-19 35.9486 37.0 37.0 37.0 37.0 37.0 20-24 35.8969 37.0 37.0 37.0 37.0 37.0 25-29 35.7808 37.0 37.0 37.0 37.0 37.0 30-34 35.6492 37.0 37.0 37.0 37.0 37.0 35-39 35.6323 37.0 37.0 37.0 37.0 37.0 40-44 35.59259999999999 37.0 37.0 37.0 37.0 37.0 45-49 35.52810000000001 37.0 37.0 37.0 37.0 37.0 50-54 35.4996 37.0 37.0 37.0 37.0 37.0 55-59 35.410000000000004 37.0 37.0 37.0 37.0 37.0 60-64 35.3871 37.0 37.0 37.0 37.0 37.0 65-69 35.3917 37.0 37.0 37.0 37.0 37.0 70-74 35.3728 37.0 37.0 37.0 37.0 37.0 75-79 35.3459 37.0 37.0 37.0 37.0 37.0 80-84 35.250099999999996 37.0 37.0 37.0 37.0 37.0 85-89 35.236000000000004 37.0 37.0 37.0 37.0 37.0 90-94 35.2012 37.0 37.0 37.0 34.6 37.0 95-99 35.258799999999994 37.0 37.0 37.0 37.0 37.0 100-104 35.1017 37.0 37.0 37.0 34.6 37.0 105-109 35.1382 37.0 37.0 37.0 34.6 37.0 110-114 35.1596 37.0 37.0 37.0 32.2 37.0 115-119 35.1048 37.0 37.0 37.0 32.2 37.0 120-124 35.1075 37.0 37.0 37.0 34.6 37.0 125-129 34.7781 37.0 37.0 37.0 25.0 37.0 130-134 34.967499999999994 37.0 37.0 37.0 25.0 37.0 135-139 34.84910000000001 37.0 37.0 37.0 25.0 37.0 140-144 34.8046 37.0 37.0 37.0 25.0 37.0 145-149 34.6874 37.0 37.0 37.0 25.0 37.0 150-151 34.38225 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 14.0 14 16.0 15 13.0 16 8.0 17 15.0 18 7.0 19 12.0 20 10.0 21 14.0 22 16.0 23 14.0 24 15.0 25 7.0 26 22.0 27 11.0 28 12.0 29 14.0 30 26.0 31 33.0 32 65.0 33 94.0 34 160.0 35 514.0 36 2586.0 37 300.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.075 23.125 10.7 20.1 2 29.575000000000003 25.15 28.125 17.150000000000002 3 24.025 27.35 31.0 17.625 4 28.125 31.7 21.5 18.675 5 27.875 34.775 21.349999999999998 16.0 6 24.6 38.925 21.075 15.4 7 23.05 23.525 34.175 19.25 8 23.625 25.525 27.400000000000002 23.45 9 24.224999999999998 25.1 28.025 22.650000000000002 10-14 25.979999999999997 28.71 25.435000000000002 19.875 15-19 24.805 27.63 28.015 19.55 20-24 24.915000000000003 28.49 27.200000000000003 19.395 25-29 25.35 27.98 26.91 19.759999999999998 30-34 24.73 28.665000000000003 27.015 19.59 35-39 24.779999999999998 28.084999999999997 27.62 19.515 40-44 24.5 28.449999999999996 27.395000000000003 19.655 45-49 24.435000000000002 27.79 28.615000000000002 19.16 50-54 24.915000000000003 28.32 27.500000000000004 19.265 55-59 24.605 28.035 27.605 19.755 60-64 23.89 28.494999999999997 27.905 19.71 65-69 24.240000000000002 27.605 28.17 19.985 70-74 23.96 28.175 27.905 19.96 75-79 24.37 28.815 27.21 19.605 80-84 24.125 28.925 27.150000000000002 19.8 85-89 25.009999999999998 28.634999999999998 26.889999999999997 19.465 90-94 24.755 28.634999999999998 26.72 19.89 95-99 24.884999999999998 28.74 26.875 19.5 100-104 24.665 28.444999999999997 27.465 19.425 105-109 25.36 28.26 27.215 19.165 110-114 25.025 28.945 27.450000000000003 18.58 115-119 25.96 27.865000000000002 27.560000000000002 18.615000000000002 120-124 25.505 28.439999999999998 26.919999999999998 19.134999999999998 125-129 26.305 28.060000000000002 26.974999999999998 18.66 130-134 26.615 28.48 26.56 18.345 135-139 26.525 28.439999999999998 26.700000000000003 18.335 140-144 26.845000000000002 28.505000000000003 26.16 18.490000000000002 145-149 26.865 28.395 26.584999999999997 18.154999999999998 150-151 27.787499999999998 28.4375 26.5875 17.1875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 1.0 7 1.5 8 1.0 9 1.0 10 1.0 11 1.5 12 1.5 13 1.0 14 3.0 15 3.5 16 2.5 17 3.5 18 2.5 19 2.0 20 3.0 21 3.0 22 4.0 23 3.0 24 2.5 25 3.0 26 6.0 27 13.0 28 12.0 29 10.5 30 18.0 31 24.5 32 24.5 33 32.5 34 59.5 35 85.5 36 92.5 37 99.5 38 134.5 39 164.0 40 201.0 41 237.0 42 239.5 43 239.5 44 236.5 45 234.0 46 257.5 47 268.5 48 233.5 49 192.0 50 159.5 51 126.5 52 94.5 53 78.0 54 71.5 55 64.0 56 43.5 57 32.5 58 32.0 59 21.5 60 12.0 61 5.5 62 5.5 63 5.5 64 2.0 65 1.0 66 4.0 67 3.5 68 1.5 69 3.0 70 1.5 71 1.5 72 2.5 73 1.5 74 1.5 75 2.0 76 2.5 77 2.0 78 0.5 79 0.0 80 0.0 81 2.0 82 2.5 83 1.5 84 2.0 85 2.5 86 2.0 87 0.5 88 1.5 89 2.5 90 2.0 91 2.5 92 2.5 93 2.0 94 1.0 95 1.0 96 2.0 97 1.0 98 2.0 99 5.0 100 10.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 86.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 88.05411629245826 76.47500000000001 2 10.16119746689695 17.65 3 1.468048359240069 3.8249999999999997 4 0.20149683362118592 0.7000000000000001 5 0.08635578583765112 0.375 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02878526194588371 0.975 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 39 0.975 No Hit GAATGTTGCTGTTGAGTAATAAACCTTTTGAACTATAGAAATGGTTGAAG 5 0.125 No Hit CAAGAGACTTGCCCCATTGACACTCTCAAGTTAGGCGCATGTGTGGATGT 5 0.125 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.25 0.0 0.0 0.0 0.0 76-77 0.3625 0.0 0.0 0.0 0.0 78-79 0.375 0.0 0.0 0.0 0.0 80-81 0.5249999999999999 0.0 0.0 0.0 0.0 82-83 0.7 0.0 0.0 0.0 0.0 84-85 0.9 0.0 0.0 0.0 0.0 86-87 1.1875 0.0 0.0 0.0 0.0 88-89 1.3625 0.0 0.0 0.0 0.0 90-91 1.5375 0.0 0.0 0.0 0.0 92-93 1.9249999999999998 0.0 0.0 0.0 0.0 94-95 2.375 0.0 0.0 0.0 0.0 96-97 2.8125 0.0 0.0 0.0 0.0 98-99 3.2125 0.0 0.0 0.0 0.0 100-101 3.7625 0.0 0.0 0.0 0.0 102-103 4.4 0.0 0.0 0.0 0.0 104-105 4.925000000000001 0.0 0.0 0.0 0.0 106-107 5.4 0.0 0.0 0.0 0.0 108-109 5.825 0.0 0.0 0.0 0.0 110-111 6.325 0.0 0.0 0.0 0.0 112-113 6.9625 0.0 0.0 0.0 0.0 114-115 7.5875 0.0 0.0 0.0 0.0 116-117 8.4125 0.0 0.0 0.0 0.0 118-119 8.962499999999999 0.0 0.0 0.0 0.0 120-121 9.649999999999999 0.0 0.0 0.0 0.0 122-123 10.425 0.0 0.0 0.0 0.0 124-125 11.149999999999999 0.0 0.0 0.0 0.0 126-127 11.8 0.0 0.0 0.0 0.0 128-129 12.462499999999999 0.0 0.0 0.0 0.0 130-131 13.225 0.0 0.0 0.0 0.0 132-133 14.274999999999999 0.0 0.0 0.0 0.0 134-135 15.25 0.0 0.0 0.0 0.0 136-137 16.35 0.0 0.0 0.0 0.0 138-139 17.1875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AATCCAA 10 0.006830828 145.0 5 ATCCAAA 10 0.006830828 145.0 6 GATCGTA 10 0.006830828 145.0 4 TCCAAAG 10 0.006830828 145.0 7 >>END_MODULE Read 1293056 spots for SRR28623277.sra Written 1293056 spots for SRR28623277.sra Read 1293056 spots for SRR28623277.sra Written 1293056 spots for SRR28623277.sra Read 1293056 spots for SRR28623277.sra Written 1293056 spots for SRR28623277.sra Read 1293056 spots for SRR28623277.sra Written 1293056 spots for SRR28623277.sra Read 1293056 spots for SRR28623277.sra Written 1293056 spots for SRR28623277.sra Read 1293056 spots for SRR28623277.sra Written 1293056 spots for SRR28623277.sra Read 1293056 spots for SRR28623277.sra Written 1293056 spots for SRR28623277.sra Read 1293056 spots for SRR28623277.sra Written 1293056 spots for SRR28623277.sra Read 1293056 spots for SRR28623277.sra Written 1293056 spots for SRR28623277.sra Read 1293056 spots for SRR28623277.sra Written 1293056 spots for SRR28623277.sra Read 1293056 spots for SRR28623277.sra Written 1293056 spots for SRR28623277.sra Read 1293056 spots for SRR28623277.sra Written 1293056 spots for SRR28623277.sra Read 1293056 spots for SRR28623277.sra Written 1293056 spots for SRR28623277.sra Read 1293056 spots for SRR28623277.sra Written 1293056 spots for SRR28623277.sra Read 1293056 spots for SRR28623277.sra Written 1293056 spots for SRR28623277.sra Read 1293062 spots for SRR28623277.sra Written 1293062 spots for SRR28623277.sra Read 1293056 spots for SRR28623277.sra Written 1293056 spots for SRR28623277.sra Read 1293056 spots for SRR28623277.sra Written 1293056 spots for SRR28623277.sra Read 1293056 spots for SRR28623277.sra Written 1293056 spots for SRR28623277.sra Read 1293056 spots for SRR28623277.sra Written 1293056 spots for SRR28623277.sra SRR ids: ['SRR28623277.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ancv90f8 SRR28623277.sra spots: 25861126 blocks: [[1, 1293056], [1293057, 2586112], [2586113, 3879168], [3879169, 5172224], [5172225, 6465280], [6465281, 7758336], [7758337, 9051392], [9051393, 10344448], [10344449, 11637504], [11637505, 12930560], [12930561, 14223616], [14223617, 15516672], [15516673, 16809728], [16809729, 18102784], [18102785, 19395840], [19395841, 20688896], [20688897, 21981952], [21981953, 23275008], [23275009, 24568064], [24568065, 25861126]] SRR28623277 file size 9547297 SRR28623277 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR28623277 SRR28623277_1.fastq SRR28623277_2.fastq Input file: SRR28623277_1.fastq Paired file: SRR28623277_2.fastq trimmed: SRR28623277-trimmed-pair1.fastq, SRR28623277-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 13:27:01 2025 >> started Tue Feb 11 13:27:32 2025 >> done (30.824s) 25861126 read pairs processed; of these: 21 ( 0.00%) short read pairs filtered out after trimming by size control 95473 ( 0.37%) empty read pairs filtered out after trimming by size control 25765632 (99.63%) read pairs available; of these: 5630827 (21.85%) trimmed read pairs available after processing 20134805 (78.15%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 3 0.00% 20 5 0.00% 21 2 0.00% 22 7 0.00% 23 3 0.00% 24 10 0.00% 25 12 0.00% 26 11 0.00% 27 15 0.00% 28 6 0.00% 29 9 0.00% 30 11 0.00% 31 18 0.00% 32 14 0.00% 33 17 0.00% 34 13 0.00% 35 18 0.00% 36 36 0.00% 37 41 0.00% 38 50 0.00% 39 53 0.00% 40 68 0.00% 41 63 0.00% 42 95 0.00% 43 96 0.00% 44 115 0.00% 45 117 0.00% 46 144 0.00% 47 175 0.00% 48 212 0.00% 49 210 0.00% 50 324 0.00% 51 372 0.00% 52 420 0.00% 53 486 0.00% 54 499 0.00% 55 541 0.00% 56 615 0.00% 57 751 0.00% 58 916 0.00% 59 1118 0.00% 60 1238 0.00% 61 1454 0.01% 62 1744 0.01% 63 2001 0.01% 64 2281 0.01% 65 2447 0.01% 66 2667 0.01% 67 3038 0.01% 68 3468 0.01% 69 3917 0.02% 70 4789 0.02% 71 5457 0.02% 72 6086 0.02% 73 7275 0.03% 74 8025 0.03% 75 8730 0.03% 76 9796 0.04% 77 10871 0.04% 78 11941 0.05% 79 13221 0.05% 80 14354 0.06% 81 16664 0.06% 82 18551 0.07% 83 20453 0.08% 84 22608 0.09% 85 24739 0.10% 86 26553 0.10% 87 28372 0.11% 88 29875 0.12% 89 31803 0.12% 90 34241 0.13% 91 36628 0.14% 92 39264 0.15% 93 42792 0.17% 94 45602 0.18% 95 48518 0.19% 96 50204 0.19% 97 51669 0.20% 98 53694 0.21% 99 55747 0.22% 100 57605 0.22% 101 59062 0.23% 102 62038 0.24% 103 64267 0.25% 104 67152 0.26% 105 69639 0.27% 106 72157 0.28% 107 73293 0.28% 108 74142 0.29% 109 75649 0.29% 110 76260 0.30% 111 79509 0.31% 112 81477 0.32% 113 82203 0.32% 114 84580 0.33% 115 87950 0.34% 116 89753 0.35% 117 90873 0.35% 118 91758 0.36% 119 92551 0.36% 120 92959 0.36% 121 93506 0.36% 122 94928 0.37% 123 96140 0.37% 124 99000 0.38% 125 99111 0.38% 126 101366 0.39% 127 101600 0.39% 128 102560 0.40% 129 104021 0.40% 130 104752 0.41% 131 103264 0.40% 132 104337 0.40% 133 105411 0.41% 134 106010 0.41% 135 107534 0.42% 136 108411 0.42% 137 108561 0.42% 138 109988 0.43% 139 111006 0.43% 140 110548 0.43% 141 111044 0.43% 142 110331 0.43% 143 110797 0.43% 144 112175 0.44% 145 112000 0.43% 146 112511 0.44% 147 113159 0.44% 148 113349 0.44% 149 113627 0.44% 150 114434 0.44% 151 20134805 78.15% 25765632 reads passed initial QC criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=27.41 fanout-score-rank=3 prefix-density=0.46 prefix-fanout=27.4 sequence=GGATCGGAAGAGCACACGTCTGAACTCCAGTCACGGATACCAATCTCGGTTGGCGG criterion=fanout-score sequence-density=0.02 sequence-density-rank=33 fanout-score=55.39 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=10.1 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGCCAGGTTCTCCAGTGGTCCCTTTCCGGTCACAATGGCCTGGACAAAGAATCCGAACATTGAGAACATAGCCAA criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=3.04 fanout-score-rank=18 prefix-density=0.32 prefix-fanout=2.8 sequence=TGCAAGTGCGGCAGCGGCTGTGGAGGATGCAAGATGTACCCTGACATGAGCTCCTCAGAGACGATCACCAACGAAACTCTGGTTCTTGGTGTGGCACCAGAGAAGGGTCACTTTGCGGGAGCTGCTGAGACGGTCGTGGGAGCCGAGAATGGCTGCAAGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=22.32 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=4.1 sequence=AAACAAGAGAGGTGGAGATATAGGAGAGCATAACCATGTTAGTCCCATATATTTCCAAGATGAAGGCCTTTCTTATCGCATGCATTCTCTTAGCTACCATCGTCTTCTCTCCCCT SRR28623277 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 13:28:21 Started mapping on | Feb 11 13:28:21 Finished on | Feb 11 13:31:31 Mapping speed, Million of reads per hour | 488.19 Number of input reads | 25765632 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 23429652 Uniquely mapped reads % | 90.93% Average mapped length | 287.10 Number of splices: Total | 19362425 Number of splices: Annotated (sjdb) | 18842179 Number of splices: GT/AG | 18969365 Number of splices: GC/AG | 302722 Number of splices: AT/AC | 15434 Number of splices: Non-canonical | 74904 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.04% Deletion average length | 2.70 Insertion rate per base | 0.03% Insertion average length | 2.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 648066 % of reads mapped to multiple loci | 2.52% Number of reads mapped to too many loci | 185961 % of reads mapped to too many loci | 0.72% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.28% % of reads unmapped: other | 0.55% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1687914 1687914 1687914 N_multimapping 648066 648066 648066 N_noFeature 995003 23013576 1148082 N_ambiguous 419234 2205 155063 UnstrandedReadsAssigned:22015415 PositiveStrandReadsAssigned:413871 NegativeStrandReadsAssigned:22126507 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=145 echo kmer=141 SRR28623277 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR28623277-trimmed-pair1.fastq SRR28623277-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,765,632 reads, 22,703,927 reads pseudoaligned [quant] estimated average fragment length: 209.298 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,039 rounds 52401 SRR28623277.ke.tsv 34699 SRR28623277.se.tsv 87100 total ==> SRR28623277.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1809.7 1510 33.1246 Potri.005G024800.1.v4.1 1035 826.702 821 39.4253 Potri.004G059700.1.v4.1 961 752.702 103 5.43244 Potri.007G009000.2.v4.1 1416 1207.7 0 0 Potri.003G141000.2.v4.1 2943 2734.7 1411.13 20.4851 Potri.016G087400.1.v4.1 270 101.725 1495.02 583.443 Potri.015G069301.1.v4.1 564 359.27 0 0 Potri.010G195200.1.v4.1 1773 1564.7 108 2.74014 Potri.012G127500.1.v4.1 977 768.702 237 12.2397 ==> SRR28623277.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 166 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 399 Potri.001G212900.v4.1 147 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 80 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 34 SRR28623277 completed mapping pipeline successfully