Starting /dee2/code/volunteer_pipeline.sh SRR28623279 current disk space = 3050334908416 free memory = 1468347732 SRR28623279 SRAfilesize 5c23731434077c5aa747d330af9f0b97 SRR28623279.sra SRR28623279.sra file validated SRR28623279 is paired end SRR28623279 is conventional basespace SRR28623279 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623279_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.50225 37.0 37.0 37.0 37.0 37.0 2 36.545 37.0 37.0 37.0 37.0 37.0 3 36.712 37.0 37.0 37.0 37.0 37.0 4 36.5985 37.0 37.0 37.0 37.0 37.0 5 36.6495 37.0 37.0 37.0 37.0 37.0 6 36.6435 37.0 37.0 37.0 37.0 37.0 7 36.5655 37.0 37.0 37.0 37.0 37.0 8 36.3475 37.0 37.0 37.0 37.0 37.0 9 36.5645 37.0 37.0 37.0 37.0 37.0 10-14 36.602999999999994 37.0 37.0 37.0 37.0 37.0 15-19 36.5287 37.0 37.0 37.0 37.0 37.0 20-24 36.5198 37.0 37.0 37.0 37.0 37.0 25-29 36.490300000000005 37.0 37.0 37.0 37.0 37.0 30-34 36.4614 37.0 37.0 37.0 37.0 37.0 35-39 36.4433 37.0 37.0 37.0 37.0 37.0 40-44 36.384699999999995 37.0 37.0 37.0 37.0 37.0 45-49 36.3381 37.0 37.0 37.0 37.0 37.0 50-54 36.3347 37.0 37.0 37.0 37.0 37.0 55-59 36.287099999999995 37.0 37.0 37.0 37.0 37.0 60-64 36.2908 37.0 37.0 37.0 37.0 37.0 65-69 36.290099999999995 37.0 37.0 37.0 37.0 37.0 70-74 36.2119 37.0 37.0 37.0 37.0 37.0 75-79 36.1403 37.0 37.0 37.0 37.0 37.0 80-84 36.0473 37.0 37.0 37.0 37.0 37.0 85-89 36.0955 37.0 37.0 37.0 37.0 37.0 90-94 36.0454 37.0 37.0 37.0 37.0 37.0 95-99 35.9173 37.0 37.0 37.0 37.0 37.0 100-104 35.950599999999994 37.0 37.0 37.0 37.0 37.0 105-109 35.969899999999996 37.0 37.0 37.0 37.0 37.0 110-114 35.781499999999994 37.0 37.0 37.0 37.0 37.0 115-119 35.855199999999996 37.0 37.0 37.0 37.0 37.0 120-124 35.7101 37.0 37.0 37.0 37.0 37.0 125-129 35.6069 37.0 37.0 37.0 37.0 37.0 130-134 35.708200000000005 37.0 37.0 37.0 37.0 37.0 135-139 35.524899999999995 37.0 37.0 37.0 34.6 37.0 140-144 35.2654 37.0 37.0 37.0 29.8 37.0 145-149 35.1708 37.0 37.0 37.0 32.2 37.0 150-151 35.01925 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 0.0 21 1.0 22 3.0 23 1.0 24 3.0 25 3.0 26 13.0 27 12.0 28 16.0 29 29.0 30 30.0 31 26.0 32 58.0 33 93.0 34 153.0 35 395.0 36 2875.0 37 288.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.189365437672436 13.794833207925757 9.932279909706546 41.08352144469526 2 18.45 14.6 37.0 29.95 3 18.0 18.6 28.499999999999996 34.9 4 24.025 25.575 24.65 25.75 5 24.4 31.0 23.925 20.674999999999997 6 20.05 35.975 23.425 20.549999999999997 7 15.4 27.525 40.825 16.25 8 16.525000000000002 28.125 32.574999999999996 22.775000000000002 9 18.0 25.05 35.35 21.6 10-14 19.18 30.885 27.29 22.645 15-19 19.7 28.705000000000002 27.889999999999997 23.705000000000002 20-24 19.555 29.409999999999997 28.155 22.88 25-29 19.555 29.005 27.58 23.86 30-34 19.115 30.025000000000002 27.045 23.815 35-39 19.56 29.065 27.805000000000003 23.57 40-44 19.67 29.28 27.715 23.335 45-49 19.935 29.049999999999997 27.805000000000003 23.21 50-54 19.865 29.349999999999998 27.47 23.315 55-59 19.945 29.125 26.935 23.995 60-64 19.75 28.535 28.235 23.48 65-69 20.1 29.01 27.675 23.215 70-74 20.015 28.87 27.634999999999998 23.48 75-79 19.85 29.580000000000002 27.465 23.105 80-84 20.125 29.659999999999997 27.35 22.865 85-89 20.41 29.38 27.215 22.994999999999997 90-94 20.145 29.325000000000003 26.655 23.875 95-99 20.02 29.665000000000003 26.97 23.345 100-104 20.78 29.395 26.52 23.305 105-109 20.495 29.609999999999996 26.590000000000003 23.305 110-114 20.59 28.87 26.11 24.43 115-119 21.05 29.134999999999998 26.584999999999997 23.23 120-124 20.880000000000003 28.915000000000003 26.095000000000002 24.11 125-129 20.915 28.565 25.785000000000004 24.735 130-134 21.044999999999998 28.285 26.615 24.055 135-139 21.025 27.85 26.555 24.57 140-144 20.979999999999997 28.060000000000002 26.529999999999998 24.43 145-149 20.919999999999998 28.015 25.775 25.290000000000003 150-151 21.0 28.1625 26.125 24.712500000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 3.5 22 3.5 23 2.0 24 3.0 25 3.5 26 8.5 27 13.5 28 10.5 29 13.5 30 27.0 31 41.0 32 46.0 33 50.0 34 62.0 35 80.5 36 108.0 37 142.0 38 169.5 39 178.0 40 176.5 41 214.0 42 259.0 43 255.5 44 247.5 45 227.5 46 221.0 47 230.0 48 220.5 49 203.0 50 168.0 51 142.0 52 122.5 53 84.0 54 56.5 55 45.5 56 38.5 57 32.5 58 21.0 59 15.5 60 11.5 61 8.5 62 9.0 63 5.0 64 0.5 65 1.5 66 2.5 67 3.0 68 3.0 69 2.5 70 2.0 71 0.5 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.5 97 0.5 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.325 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.22500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 83.74887353559627 69.69999999999999 2 13.187143286272155 21.95 3 2.4031240612796636 6.0 4 0.48062481225593273 1.6 5 0.18023430459597475 0.75 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCAGAACAGCAACAGCTCTGCTCAAACCATATATGTTCTTCATCGTCCT 5 0.125 No Hit CTCTCAGGTTTGGCAGCATTTGTGATGTCTTCAGCTAGGCTTGTCTGTGA 5 0.125 No Hit GTAACAAGGAAGTATGGATTAGCACCAGCTCCAGCCATGTCCAAATCCAT 5 0.125 No Hit CTCTCTTTCTCTTTTCTTCTTGTTGATGTTAATTTCTTGCTACTAATTAT 5 0.125 No Hit GGCCTGGATCTGAAGAGTATTTGATGGATGAAAGCCACGTGAAAAATCTG 5 0.125 No Hit CCTTGAACAACCCACTTTCCTTCAGCTTCCCACAGTATCCCATTCTCAAT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.037500000000000006 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.0875 0.0 0.0 0.0 0.0 68-69 0.1375 0.0 0.0 0.0 0.0 70-71 0.225 0.0 0.0 0.0 0.0 72-73 0.3125 0.0 0.0 0.0 0.0 74-75 0.3625 0.0 0.0 0.0 0.0 76-77 0.4625 0.0 0.0 0.0 0.0 78-79 0.625 0.0 0.0 0.0 0.0 80-81 0.7375 0.0 0.0 0.0 0.0 82-83 0.8875 0.0 0.0 0.0 0.0 84-85 1.0375 0.0 0.0 0.0 0.0 86-87 1.4 0.0 0.0 0.0 0.0 88-89 1.7125 0.0 0.0 0.0 0.0 90-91 2.05 0.0 0.0 0.0 0.0 92-93 2.2625 0.0 0.0 0.0 0.0 94-95 2.55 0.0 0.0 0.0 0.0 96-97 3.075 0.0 0.0 0.0 0.0 98-99 3.5250000000000004 0.0 0.0 0.0 0.0 100-101 3.9749999999999996 0.0 0.0 0.0 0.0 102-103 4.449999999999999 0.0 0.0 0.0 0.0 104-105 4.8 0.0 0.0 0.0 0.0 106-107 5.3375 0.0 0.0 0.0 0.0 108-109 5.7375 0.0 0.0 0.0 0.0 110-111 6.325 0.0 0.0 0.0 0.0 112-113 6.95 0.0 0.0 0.0 0.0 114-115 7.7125 0.0 0.0 0.0 0.0 116-117 8.524999999999999 0.0 0.0 0.0 0.0 118-119 9.225000000000001 0.0 0.0 0.0 0.0 120-121 10.075 0.0 0.0 0.0 0.0 122-123 11.0375 0.0 0.0 0.0 0.0 124-125 11.7375 0.0 0.0 0.0 0.0 126-127 12.4875 0.0 0.0 0.0 0.0 128-129 13.399999999999999 0.0 0.0 0.0 0.0 130-131 14.15 0.0 0.0 0.0 0.0 132-133 15.2375 0.0 0.0 0.0 0.0 134-135 16.1125 0.0 0.0 0.0 0.0 136-137 16.825 0.0 0.0 0.0 0.0 138-139 17.8875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR28623279 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623279_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.589 37.0 37.0 37.0 37.0 37.0 2 36.2105 37.0 37.0 37.0 37.0 37.0 3 36.2355 37.0 37.0 37.0 37.0 37.0 4 36.17 37.0 37.0 37.0 37.0 37.0 5 36.273 37.0 37.0 37.0 37.0 37.0 6 36.219 37.0 37.0 37.0 37.0 37.0 7 36.194 37.0 37.0 37.0 37.0 37.0 8 36.113 37.0 37.0 37.0 37.0 37.0 9 36.0405 37.0 37.0 37.0 37.0 37.0 10-14 35.9951 37.0 37.0 37.0 37.0 37.0 15-19 35.945899999999995 37.0 37.0 37.0 37.0 37.0 20-24 35.9122 37.0 37.0 37.0 37.0 37.0 25-29 35.8072 37.0 37.0 37.0 37.0 37.0 30-34 35.754599999999996 37.0 37.0 37.0 37.0 37.0 35-39 35.781000000000006 37.0 37.0 37.0 37.0 37.0 40-44 35.701100000000004 37.0 37.0 37.0 37.0 37.0 45-49 35.6845 37.0 37.0 37.0 37.0 37.0 50-54 35.66440000000001 37.0 37.0 37.0 37.0 37.0 55-59 35.5538 37.0 37.0 37.0 37.0 37.0 60-64 35.5477 37.0 37.0 37.0 37.0 37.0 65-69 35.5946 37.0 37.0 37.0 37.0 37.0 70-74 35.6128 37.0 37.0 37.0 37.0 37.0 75-79 35.5954 37.0 37.0 37.0 37.0 37.0 80-84 35.4971 37.0 37.0 37.0 37.0 37.0 85-89 35.4504 37.0 37.0 37.0 37.0 37.0 90-94 35.3306 37.0 37.0 37.0 34.6 37.0 95-99 35.3737 37.0 37.0 37.0 34.6 37.0 100-104 35.2593 37.0 37.0 37.0 37.0 37.0 105-109 35.2252 37.0 37.0 37.0 32.2 37.0 110-114 35.2678 37.0 37.0 37.0 34.6 37.0 115-119 35.193200000000004 37.0 37.0 37.0 32.2 37.0 120-124 35.2487 37.0 37.0 37.0 34.6 37.0 125-129 34.7658 37.0 37.0 37.0 25.0 37.0 130-134 34.984500000000004 37.0 37.0 37.0 25.0 37.0 135-139 34.8704 37.0 37.0 37.0 25.0 37.0 140-144 34.86809999999999 37.0 37.0 37.0 25.0 37.0 145-149 34.801300000000005 37.0 37.0 37.0 25.0 37.0 150-151 34.37425 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 8.0 14 8.0 15 18.0 16 11.0 17 5.0 18 7.0 19 10.0 20 6.0 21 5.0 22 10.0 23 8.0 24 15.0 25 11.0 26 11.0 27 15.0 28 13.0 29 17.0 30 29.0 31 33.0 32 51.0 33 107.0 34 216.0 35 646.0 36 2491.0 37 247.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.0 16.3 12.25 26.450000000000003 2 28.175 25.974999999999998 29.299999999999997 16.55 3 23.925 26.825 30.599999999999998 18.65 4 25.525 32.300000000000004 23.375 18.8 5 26.1 36.449999999999996 21.625 15.825 6 22.1 38.175 21.625 18.099999999999998 7 22.2 22.775000000000002 36.375 18.65 8 22.725 25.525 27.35 24.4 9 22.3 25.674999999999997 29.225 22.8 10-14 25.05 28.625 26.229999999999997 20.095 15-19 24.27 28.105000000000004 27.560000000000002 20.064999999999998 20-24 24.39 28.515 26.86 20.235 25-29 23.799999999999997 28.175 27.575 20.45 30-34 23.494999999999997 27.939999999999998 28.12 20.445 35-39 23.365 28.015 27.73 20.89 40-44 23.57 28.29 28.055000000000003 20.085 45-49 23.46 28.73 27.425 20.385 50-54 23.82 28.04 28.485 19.655 55-59 23.035 27.96 28.23 20.775 60-64 23.455000000000002 28.355000000000004 28.225 19.965 65-69 23.29 28.955 27.975 19.78 70-74 23.1 29.38 27.705000000000002 19.814999999999998 75-79 22.97 29.365000000000002 27.61 20.055 80-84 23.455000000000002 28.335 28.244999999999997 19.965 85-89 23.405 29.085 27.305 20.205000000000002 90-94 23.715 28.82 27.544999999999998 19.919999999999998 95-99 23.665 29.595 27.425 19.314999999999998 100-104 24.404999999999998 30.014999999999997 26.43 19.15 105-109 23.445 29.225 27.495000000000005 19.835 110-114 24.485 29.415000000000003 26.58 19.52 115-119 24.759999999999998 29.220000000000002 27.250000000000004 18.77 120-124 24.66 29.73 27.195000000000004 18.415 125-129 25.14 28.475 27.505000000000003 18.88 130-134 25.915 28.785 26.584999999999997 18.715 135-139 25.77 28.249999999999996 26.645000000000003 19.335 140-144 26.179999999999996 28.43 27.025 18.365000000000002 145-149 26.240000000000002 28.83 26.150000000000002 18.78 150-151 25.724999999999998 28.7375 26.125 19.412499999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 1.5 6 1.0 7 0.0 8 2.5 9 4.0 10 3.0 11 3.5 12 3.0 13 3.0 14 2.0 15 0.5 16 1.5 17 1.5 18 2.0 19 2.5 20 1.5 21 4.0 22 4.0 23 2.5 24 3.0 25 2.5 26 4.5 27 9.5 28 12.0 29 12.0 30 17.5 31 24.0 32 36.0 33 44.5 34 53.0 35 71.0 36 96.0 37 120.0 38 139.5 39 162.0 40 189.0 41 206.0 42 219.5 43 259.0 44 284.5 45 267.5 46 258.5 47 247.0 48 207.5 49 180.5 50 170.0 51 138.5 52 106.0 53 96.0 54 70.5 55 43.0 56 35.5 57 33.0 58 30.0 59 25.0 60 16.5 61 7.0 62 4.0 63 5.0 64 5.0 65 4.5 66 3.0 67 2.5 68 3.0 69 3.5 70 1.5 71 1.5 72 2.0 73 1.5 74 1.0 75 0.0 76 1.0 77 1.5 78 0.5 79 1.0 80 1.0 81 0.0 82 0.5 83 1.5 84 1.0 85 1.0 86 1.0 87 0.5 88 1.0 89 1.0 90 1.0 91 1.0 92 1.0 93 0.5 94 0.0 95 0.0 96 0.5 97 0.5 98 0.0 99 0.0 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.175 #Duplication Level Percentage of deduplicated Percentage of total 1 84.73418473418474 71.325 2 12.71161271161271 21.4 3 1.9008019008019006 4.8 4 0.5346005346005346 1.7999999999999998 5 0.0891000891000891 0.375 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.029700029700029697 0.3 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 12 0.3 No Hit GTATCACACAGCTACAGGCAGAGGAATCTTCTCCGATCCTGCTTACTCGT 5 0.125 No Hit CTTCATTTTACATTCTCTTACTTTCCAAAGATACAATACAAGCCTCAGCA 5 0.125 No Hit GAAAAGTCCACAGGTTCCACTAAAGATGACCTTAAACTCCTTGAAGCTAT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.037500000000000006 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.0875 0.0 0.0 0.0 0.0 68-69 0.1375 0.0 0.0 0.0 0.0 70-71 0.225 0.0 0.0 0.0 0.0 72-73 0.3125 0.0 0.0 0.0 0.0 74-75 0.3625 0.0 0.0 0.0 0.0 76-77 0.4625 0.0 0.0 0.0 0.0 78-79 0.625 0.0 0.0 0.0 0.0 80-81 0.7375 0.0 0.0 0.0 0.0 82-83 0.8875 0.0 0.0 0.0 0.0 84-85 1.0375 0.0 0.0 0.0 0.0 86-87 1.4 0.0 0.0 0.0 0.0 88-89 1.7125 0.0 0.0 0.0 0.0 90-91 2.05 0.0 0.0 0.0 0.0 92-93 2.2249999999999996 0.0 0.0 0.0 0.0 94-95 2.5 0.0 0.0 0.0 0.0 96-97 3.0375 0.0 0.0 0.0 0.0 98-99 3.4875 0.0 0.0 0.0 0.0 100-101 3.9125 0.0 0.0 0.0 0.0 102-103 4.375 0.0 0.0 0.0 0.0 104-105 4.75 0.0 0.0 0.0 0.0 106-107 5.2875 0.0 0.0 0.0 0.0 108-109 5.6875 0.0 0.0 0.0 0.0 110-111 6.225 0.0 0.0 0.0 0.0 112-113 6.8 0.0 0.0 0.0 0.0 114-115 7.574999999999999 0.0 0.0 0.0 0.0 116-117 8.399999999999999 0.0 0.0 0.0 0.0 118-119 9.075 0.0 0.0 0.0 0.0 120-121 9.9 0.0 0.0 0.0 0.0 122-123 10.8625 0.0 0.0 0.0 0.0 124-125 11.575 0.0 0.0 0.0 0.0 126-127 12.3625 0.0 0.0 0.0 0.0 128-129 13.3125 0.0 0.0 0.0 0.0 130-131 14.025 0.0 0.0 0.0 0.0 132-133 15.1125 0.0 0.0 0.0 0.0 134-135 16.0125 0.0 0.0 0.0 0.0 136-137 16.7625 0.0 0.0 0.0 0.0 138-139 17.8375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1579670 spots for SRR28623279.sra Written 1579670 spots for SRR28623279.sra Read 1579670 spots for SRR28623279.sra Written 1579670 spots for SRR28623279.sra Read 1579670 spots for SRR28623279.sra Written 1579670 spots for SRR28623279.sra Read 1579670 spots for SRR28623279.sra Written 1579670 spots for SRR28623279.sra Read 1579670 spots for SRR28623279.sra Written 1579670 spots for SRR28623279.sra Read 1579670 spots for SRR28623279.sra Written 1579670 spots for SRR28623279.sra Read 1579670 spots for SRR28623279.sra Written 1579670 spots for SRR28623279.sra Read 1579670 spots for SRR28623279.sra Written 1579670 spots for SRR28623279.sra Read 1579670 spots for SRR28623279.sra Written 1579670 spots for SRR28623279.sra Read 1579670 spots for SRR28623279.sra Written 1579670 spots for SRR28623279.sra Read 1579670 spots for SRR28623279.sra Written 1579670 spots for SRR28623279.sra Read 1579670 spots for SRR28623279.sra Written 1579670 spots for SRR28623279.sra Read 1579670 spots for SRR28623279.sra Written 1579670 spots for SRR28623279.sra Read 1579670 spots for SRR28623279.sra Written 1579670 spots for SRR28623279.sra Read 1579670 spots for SRR28623279.sra Written 1579670 spots for SRR28623279.sra Read 1579676 spots for SRR28623279.sra Written 1579676 spots for SRR28623279.sra Read 1579670 spots for SRR28623279.sra Written 1579670 spots for SRR28623279.sra Read 1579670 spots for SRR28623279.sra Written 1579670 spots for SRR28623279.sra Read 1579670 spots for SRR28623279.sra Written 1579670 spots for SRR28623279.sra Read 1579670 spots for SRR28623279.sra Written 1579670 spots for SRR28623279.sra SRR ids: ['SRR28623279.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7rm7zmaj SRR28623279.sra spots: 31593406 blocks: [[1, 1579670], [1579671, 3159340], [3159341, 4739010], [4739011, 6318680], [6318681, 7898350], [7898351, 9478020], [9478021, 11057690], [11057691, 12637360], [12637361, 14217030], [14217031, 15796700], [15796701, 17376370], [17376371, 18956040], [18956041, 20535710], [20535711, 22115380], [22115381, 23695050], [23695051, 25274720], [25274721, 26854390], [26854391, 28434060], [28434061, 30013730], [30013731, 31593406]] SRR28623279 file size 11665919 SRR28623279 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR28623279 SRR28623279_1.fastq SRR28623279_2.fastq Input file: SRR28623279_1.fastq Paired file: SRR28623279_2.fastq trimmed: SRR28623279-trimmed-pair1.fastq, SRR28623279-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 13:26:07 2025 >> started Tue Feb 11 13:26:46 2025 >> done (38.946s) 31593406 read pairs processed; of these: 32 ( 0.00%) short read pairs filtered out after trimming by size control 21254 ( 0.07%) empty read pairs filtered out after trimming by size control 31572120 (99.93%) read pairs available; of these: 7068961 (22.39%) trimmed read pairs available after processing 24503159 (77.61%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 1 0.00% 20 3 0.00% 21 2 0.00% 22 9 0.00% 23 8 0.00% 24 7 0.00% 25 12 0.00% 26 13 0.00% 27 10 0.00% 28 14 0.00% 29 19 0.00% 30 20 0.00% 31 18 0.00% 32 21 0.00% 33 38 0.00% 34 37 0.00% 35 33 0.00% 36 49 0.00% 37 50 0.00% 38 88 0.00% 39 88 0.00% 40 97 0.00% 41 145 0.00% 42 114 0.00% 43 151 0.00% 44 158 0.00% 45 226 0.00% 46 226 0.00% 47 243 0.00% 48 284 0.00% 49 378 0.00% 50 436 0.00% 51 541 0.00% 52 624 0.00% 53 710 0.00% 54 701 0.00% 55 891 0.00% 56 996 0.00% 57 1128 0.00% 58 1353 0.00% 59 1723 0.01% 60 1935 0.01% 61 2156 0.01% 62 2490 0.01% 63 2980 0.01% 64 3517 0.01% 65 4031 0.01% 66 4597 0.01% 67 5124 0.02% 68 5879 0.02% 69 6783 0.02% 70 7401 0.02% 71 8717 0.03% 72 9938 0.03% 73 11068 0.04% 74 12622 0.04% 75 14113 0.04% 76 15591 0.05% 77 17221 0.05% 78 18641 0.06% 79 20724 0.07% 80 22611 0.07% 81 24729 0.08% 82 27592 0.09% 83 29707 0.09% 84 32519 0.10% 85 34782 0.11% 86 36540 0.12% 87 39839 0.13% 88 41297 0.13% 89 44268 0.14% 90 46361 0.15% 91 49545 0.16% 92 51321 0.16% 93 54472 0.17% 94 57130 0.18% 95 60058 0.19% 96 62966 0.20% 97 65495 0.21% 98 68213 0.22% 99 69660 0.22% 100 71941 0.23% 101 74621 0.24% 102 76297 0.24% 103 79491 0.25% 104 81197 0.26% 105 84067 0.27% 106 87580 0.28% 107 89453 0.28% 108 91734 0.29% 109 93974 0.30% 110 94530 0.30% 111 96447 0.31% 112 98859 0.31% 113 100430 0.32% 114 102386 0.32% 115 105738 0.33% 116 106798 0.34% 117 109411 0.35% 118 111744 0.35% 119 112953 0.36% 120 114761 0.36% 121 116355 0.37% 122 117359 0.37% 123 118205 0.37% 124 120223 0.38% 125 121042 0.38% 126 123524 0.39% 127 125502 0.40% 128 127349 0.40% 129 127671 0.40% 130 130341 0.41% 131 129294 0.41% 132 131463 0.42% 133 132198 0.42% 134 132735 0.42% 135 132526 0.42% 136 133886 0.42% 137 134191 0.43% 138 137175 0.43% 139 139030 0.44% 140 138195 0.44% 141 139272 0.44% 142 139730 0.44% 143 139427 0.44% 144 141142 0.45% 145 141222 0.45% 146 139257 0.44% 147 141594 0.45% 148 142641 0.45% 149 142173 0.45% 150 143525 0.45% 151 24503159 77.61% 31572120 reads passed initial QC criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=21.07 fanout-score-rank=10 prefix-density=0.28 prefix-fanout=21.1 sequence=GGATCGGAAGAGCACACGTCTGAACTCCAGTCACACCTCTGTATCTCGTATGCCGTCTTCTGCTTGAAA criterion=fanout-score sequence-density=0.07 sequence-density-rank=13 fanout-score=290.26 fanout-score-rank=1 prefix-density=0.98 prefix-fanout=21.3 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=12.54 fanout-score-rank=13 prefix-density=0.15 prefix-fanout=12.4 sequence=GAGAGAGAGAGTTAAGACAATGGCCTCGAAGAAATCTGCAATCGTATTACCTGGTTCAAAGGTGTTGAAGCACATAGTTTTTGTACGGTTTAATGATGGGATCACTGATGAACAAATTGAGAA criterion=fanout-score sequence-density=0.07 sequence-density-rank=23 fanout-score=367.42 fanout-score-rank=1 prefix-density=0.82 prefix-fanout=30.7 sequence=GAAGAAGAAGAAA SRR28623279 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 13:27:55 Started mapping on | Feb 11 13:27:55 Finished on | Feb 11 13:31:56 Mapping speed, Million of reads per hour | 471.62 Number of input reads | 31572120 Average input read length | 288 UNIQUE READS: Uniquely mapped reads number | 28931749 Uniquely mapped reads % | 91.64% Average mapped length | 287.02 Number of splices: Total | 25186052 Number of splices: Annotated (sjdb) | 24630803 Number of splices: GT/AG | 24756024 Number of splices: GC/AG | 327905 Number of splices: AT/AC | 23948 Number of splices: Non-canonical | 78175 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 2.93 Insertion rate per base | 0.03% Insertion average length | 2.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 915464 % of reads mapped to multiple loci | 2.90% Number of reads mapped to too many loci | 192589 % of reads mapped to too many loci | 0.61% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.60% % of reads unmapped: other | 0.25% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1724907 1724907 1724907 N_multimapping 915464 915464 915464 N_noFeature 1090345 28549042 1284864 N_ambiguous 351393 2509 161479 UnstrandedReadsAssigned:27490011 PositiveStrandReadsAssigned:380198 NegativeStrandReadsAssigned:27485406 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=144 echo kmer=139 SRR28623279 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR28623279-trimmed-pair1.fastq SRR28623279-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 31,572,120 reads, 28,209,905 reads pseudoaligned [quant] estimated average fragment length: 206.816 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,191 rounds 52401 SRR28623279.ke.tsv 34699 SRR28623279.se.tsv 87100 total ==> SRR28623279.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1812.18 871 16.4405 Potri.005G024800.1.v4.1 1035 829.184 364 15.0158 Potri.004G059700.1.v4.1 961 755.193 97 4.39352 Potri.007G009000.2.v4.1 1416 1210.18 0 0 Potri.003G141000.2.v4.1 2943 2737.18 840.819 10.5074 Potri.016G087400.1.v4.1 270 101.968 2246.71 753.669 Potri.015G069301.1.v4.1 564 360.825 0 0 Potri.010G195200.1.v4.1 1773 1567.18 31 0.676613 Potri.012G127500.1.v4.1 977 771.193 10626 471.308 ==> SRR28623279.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 962 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 576 Potri.001G212900.v4.1 10 Potri.001G182400.v4.1 5 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 3 SRR28623279 completed mapping pipeline successfully