Starting /dee2/code/volunteer_pipeline.sh SRR28623280 current disk space = 3050110226432 free memory = 1580150484 SRR28623280 SRAfilesize f261b27bbb6ddc8e8850952fc69e9b24 SRR28623280.sra SRR28623280.sra file validated SRR28623280 is paired end SRR28623280 is conventional basespace SRR28623280 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623280_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4375 37.0 37.0 37.0 37.0 37.0 2 36.466 37.0 37.0 37.0 37.0 37.0 3 36.578 37.0 37.0 37.0 37.0 37.0 4 36.676 37.0 37.0 37.0 37.0 37.0 5 36.7155 37.0 37.0 37.0 37.0 37.0 6 36.6775 37.0 37.0 37.0 37.0 37.0 7 36.614 37.0 37.0 37.0 37.0 37.0 8 36.5565 37.0 37.0 37.0 37.0 37.0 9 36.575 37.0 37.0 37.0 37.0 37.0 10-14 36.6028 37.0 37.0 37.0 37.0 37.0 15-19 36.5736 37.0 37.0 37.0 37.0 37.0 20-24 36.54899999999999 37.0 37.0 37.0 37.0 37.0 25-29 36.499900000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.464800000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.4174 37.0 37.0 37.0 37.0 37.0 40-44 36.33059999999999 37.0 37.0 37.0 37.0 37.0 45-49 36.3 37.0 37.0 37.0 37.0 37.0 50-54 36.2188 37.0 37.0 37.0 37.0 37.0 55-59 36.1871 37.0 37.0 37.0 37.0 37.0 60-64 36.140100000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.141200000000005 37.0 37.0 37.0 37.0 37.0 70-74 36.088499999999996 37.0 37.0 37.0 37.0 37.0 75-79 36.073699999999995 37.0 37.0 37.0 37.0 37.0 80-84 35.987199999999994 37.0 37.0 37.0 37.0 37.0 85-89 35.9662 37.0 37.0 37.0 37.0 37.0 90-94 35.9011 37.0 37.0 37.0 37.0 37.0 95-99 35.7807 37.0 37.0 37.0 37.0 37.0 100-104 35.8941 37.0 37.0 37.0 37.0 37.0 105-109 35.8055 37.0 37.0 37.0 37.0 37.0 110-114 35.7649 37.0 37.0 37.0 37.0 37.0 115-119 35.7816 37.0 37.0 37.0 37.0 37.0 120-124 35.653800000000004 37.0 37.0 37.0 37.0 37.0 125-129 35.524800000000006 37.0 37.0 37.0 37.0 37.0 130-134 35.6423 37.0 37.0 37.0 37.0 37.0 135-139 35.4283 37.0 37.0 37.0 34.6 37.0 140-144 35.1754 37.0 37.0 37.0 27.4 37.0 145-149 35.1531 37.0 37.0 37.0 29.8 37.0 150-151 35.00975 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 0.0 21 2.0 22 4.0 23 3.0 24 9.0 25 8.0 26 8.0 27 15.0 28 23.0 29 18.0 30 29.0 31 43.0 32 63.0 33 101.0 34 166.0 35 363.0 36 2867.0 37 277.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.5960863020572 14.676367285499248 9.382839939789262 41.344706472654295 2 17.825 16.6 35.6 29.975 3 15.85 17.4 28.725 38.025 4 21.475 24.95 24.6 28.975 5 23.0 32.35 23.799999999999997 20.849999999999998 6 20.525 37.625 21.275 20.575 7 15.9 28.65 38.675 16.775000000000002 8 16.35 29.025000000000002 31.5 23.125 9 17.0 25.775 34.35 22.875 10-14 18.695 31.155 27.915 22.235 15-19 18.9 29.654999999999998 27.71 23.735 20-24 19.33 29.45 27.375 23.845 25-29 19.515 29.765000000000004 27.67 23.05 30-34 19.470000000000002 29.985 27.13 23.415 35-39 18.67 29.609999999999996 27.794999999999998 23.925 40-44 19.41 29.385 27.889999999999997 23.315 45-49 19.615 28.9 27.6 23.885 50-54 20.175 29.755 26.779999999999998 23.29 55-59 19.29 29.9 26.924999999999997 23.885 60-64 19.095000000000002 30.035 27.16 23.71 65-69 19.575 28.9 27.865000000000002 23.66 70-74 19.61 29.455 26.825 24.11 75-79 19.455 29.715000000000003 26.855 23.974999999999998 80-84 20.225 28.345 27.515 23.915 85-89 20.349999999999998 28.765 26.855 24.03 90-94 20.855 28.804999999999996 26.76 23.580000000000002 95-99 19.99 28.994999999999997 26.695 24.32 100-104 20.445 29.235 26.705000000000002 23.615 105-109 20.605 29.020000000000003 26.27 24.104999999999997 110-114 20.57 28.93 26.369999999999997 24.13 115-119 20.885 28.725 26.22 24.169999999999998 120-124 21.135 28.65 26.16 24.055 125-129 21.62 28.549999999999997 26.265 23.565 130-134 21.19 28.49 26.11 24.21 135-139 21.044999999999998 28.244999999999997 25.765 24.945 140-144 21.425 28.065 26.029999999999998 24.48 145-149 21.375 27.87 25.905 24.85 150-151 21.95 27.525 26.1625 24.3625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 1.0 8 0.5 9 0.0 10 0.0 11 0.0 12 1.5 13 1.5 14 0.5 15 1.0 16 1.0 17 1.0 18 0.5 19 2.0 20 5.5 21 5.5 22 2.5 23 3.0 24 4.0 25 3.5 26 6.0 27 6.0 28 7.5 29 16.0 30 27.0 31 35.0 32 56.0 33 82.0 34 91.5 35 97.5 36 120.0 37 145.5 38 148.5 39 152.5 40 185.5 41 223.0 42 220.5 43 218.5 44 237.0 45 218.5 46 219.5 47 230.0 48 202.0 49 179.0 50 141.0 51 116.0 52 115.5 53 98.0 54 78.0 55 60.0 56 44.5 57 33.5 58 28.0 59 26.5 60 21.0 61 14.5 62 12.0 63 12.0 64 7.5 65 4.5 66 5.5 67 5.0 68 3.0 69 2.5 70 1.5 71 1.5 72 2.5 73 2.5 74 2.0 75 1.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.35000000000000003 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.725 #Duplication Level Percentage of deduplicated Percentage of total 1 85.68899380348185 72.6 2 11.448804957214517 19.400000000000002 3 2.154027736795515 5.475 4 0.5606373561522573 1.9 5 0.14753614635585718 0.625 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCAGAGGAGCCATGAAACGCCACAACACGCGCCAATTAGACCGGCTAGTG 5 0.125 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACCTTGCTGTATCTCGTAT 5 0.125 TruSeq Adapter, Index 12 (97% over 37bp) CTTGAATGAGAAAAAAAAAATAGGGAAGATTGAAAGAACAGAAACACAAA 5 0.125 No Hit ATTCAATCAATACATTCATGTACTTCCATATATATATATATATATATATA 5 0.125 No Hit ACAAGGAGTAGTAGTGTGGATGTTGTTGTTAGACACTTCTTTTTGTCTTT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0125 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.1375 0.0 0.0 0.0 0.0 72-73 0.2125 0.0 0.0 0.0 0.0 74-75 0.30000000000000004 0.0 0.0 0.0 0.0 76-77 0.35 0.0 0.0 0.0 0.0 78-79 0.47500000000000003 0.0 0.0 0.0 0.0 80-81 0.6375 0.0 0.0 0.0 0.0 82-83 0.875 0.0 0.0 0.0 0.0 84-85 1.05 0.0 0.0 0.0 0.0 86-87 1.3624999999999998 0.0 0.0 0.0 0.0 88-89 1.625 0.0 0.0 0.0 0.0 90-91 1.875 0.0 0.0 0.0 0.0 92-93 2.05 0.0 0.0 0.0 0.0 94-95 2.325 0.0 0.0 0.0 0.0 96-97 2.5250000000000004 0.0 0.0 0.0 0.0 98-99 2.775 0.0 0.0 0.0 0.0 100-101 3.1375 0.0 0.0 0.0 0.0 102-103 3.5625 0.0 0.0 0.0 0.0 104-105 3.9625 0.0 0.0 0.0 0.0 106-107 4.6625 0.0 0.0 0.0 0.0 108-109 5.225 0.0 0.0 0.0 0.0 110-111 5.9375 0.0 0.0 0.0 0.0 112-113 6.7375 0.0 0.0 0.0 0.0 114-115 7.550000000000001 0.0 0.0 0.0 0.0 116-117 8.4 0.0 0.0 0.0 0.0 118-119 9.0625 0.0 0.0 0.0 0.0 120-121 9.850000000000001 0.0 0.0 0.0 0.0 122-123 10.625 0.0 0.0 0.0 0.0 124-125 11.7375 0.0 0.0 0.0 0.0 126-127 12.575 0.0 0.0 0.0 0.0 128-129 13.3875 0.0 0.0 0.0 0.0 130-131 14.3625 0.0 0.0 0.0 0.0 132-133 15.4125 0.0 0.0 0.0 0.0 134-135 16.549999999999997 0.0 0.0 0.0 0.0 136-137 17.362499999999997 0.0 0.0 0.0 0.0 138-139 18.4625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CATGATC 10 0.006830828 145.0 2 ACCAGAT 10 0.006830828 145.0 4 >>END_MODULE SRR28623280 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623280_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.6745 37.0 37.0 37.0 37.0 37.0 2 36.255 37.0 37.0 37.0 37.0 37.0 3 36.2675 37.0 37.0 37.0 37.0 37.0 4 36.241 37.0 37.0 37.0 37.0 37.0 5 36.2985 37.0 37.0 37.0 37.0 37.0 6 36.3525 37.0 37.0 37.0 37.0 37.0 7 36.291 37.0 37.0 37.0 37.0 37.0 8 36.2425 37.0 37.0 37.0 37.0 37.0 9 36.2215 37.0 37.0 37.0 37.0 37.0 10-14 36.222300000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.2333 37.0 37.0 37.0 37.0 37.0 20-24 36.2266 37.0 37.0 37.0 37.0 37.0 25-29 36.1237 37.0 37.0 37.0 37.0 37.0 30-34 36.07 37.0 37.0 37.0 37.0 37.0 35-39 36.063199999999995 37.0 37.0 37.0 37.0 37.0 40-44 35.995400000000004 37.0 37.0 37.0 37.0 37.0 45-49 35.9745 37.0 37.0 37.0 37.0 37.0 50-54 35.9464 37.0 37.0 37.0 37.0 37.0 55-59 35.852199999999996 37.0 37.0 37.0 37.0 37.0 60-64 35.8442 37.0 37.0 37.0 37.0 37.0 65-69 35.8486 37.0 37.0 37.0 37.0 37.0 70-74 35.8625 37.0 37.0 37.0 37.0 37.0 75-79 35.8457 37.0 37.0 37.0 37.0 37.0 80-84 35.7629 37.0 37.0 37.0 37.0 37.0 85-89 35.740899999999996 37.0 37.0 37.0 37.0 37.0 90-94 35.694900000000004 37.0 37.0 37.0 37.0 37.0 95-99 35.695499999999996 37.0 37.0 37.0 37.0 37.0 100-104 35.5945 37.0 37.0 37.0 37.0 37.0 105-109 35.5612 37.0 37.0 37.0 37.0 37.0 110-114 35.6409 37.0 37.0 37.0 37.0 37.0 115-119 35.5326 37.0 37.0 37.0 37.0 37.0 120-124 35.6044 37.0 37.0 37.0 37.0 37.0 125-129 34.996599999999994 37.0 37.0 37.0 29.8 37.0 130-134 35.4057 37.0 37.0 37.0 34.6 37.0 135-139 35.13590000000001 37.0 37.0 37.0 29.8 37.0 140-144 35.2031 37.0 37.0 37.0 29.8 37.0 145-149 35.0118 37.0 37.0 37.0 27.4 37.0 150-151 34.7745 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 1.0 14 2.0 15 5.0 16 5.0 17 2.0 18 0.0 19 7.0 20 7.0 21 4.0 22 8.0 23 7.0 24 7.0 25 11.0 26 6.0 27 5.0 28 14.0 29 21.0 30 16.0 31 43.0 32 70.0 33 104.0 34 194.0 35 657.0 36 2532.0 37 270.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.45 17.849999999999998 13.55 29.15 2 27.224999999999998 28.749999999999996 28.199999999999996 15.825 3 23.175 30.575000000000003 28.575 17.675 4 24.875 32.375 24.15 18.6 5 26.8 34.375 21.75 17.075000000000003 6 22.075 38.425 22.45 17.05 7 21.125 21.2 38.775 18.9 8 22.15 25.825 28.549999999999997 23.474999999999998 9 24.525 24.9 29.875 20.7 10-14 24.825 28.215 26.279999999999998 20.68 15-19 23.89 27.79 27.975 20.345 20-24 23.885 28.205000000000002 27.37 20.54 25-29 24.560000000000002 28.065 27.1 20.275000000000002 30-34 23.35 27.655 27.744999999999997 21.25 35-39 24.305 27.905 27.200000000000003 20.59 40-44 23.685000000000002 28.65 27.544999999999998 20.119999999999997 45-49 23.595 28.165000000000003 28.449999999999996 19.79 50-54 23.974999999999998 27.665 27.825 20.535 55-59 24.02 27.33 28.349999999999998 20.3 60-64 23.79 27.765 27.99 20.455000000000002 65-69 23.95 27.529999999999998 28.24 20.28 70-74 23.580000000000002 27.715 28.935 19.77 75-79 24.295 27.235 28.325 20.145 80-84 23.5 28.01 28.560000000000002 19.93 85-89 23.775 27.97 28.199999999999996 20.055 90-94 24.22 27.689999999999998 27.915 20.175 95-99 23.89 27.834999999999997 28.78 19.495 100-104 24.625 28.060000000000002 27.994999999999997 19.32 105-109 24.615000000000002 28.384999999999998 27.655 19.345000000000002 110-114 24.935 28.22 27.815 19.03 115-119 25.564999999999998 27.634999999999998 27.67 19.13 120-124 25.2 27.845 28.044999999999998 18.91 125-129 26.13 27.67 27.125 19.075 130-134 26.55 27.500000000000004 27.639999999999997 18.310000000000002 135-139 27.195000000000004 27.229999999999997 27.425 18.15 140-144 27.62 26.384999999999998 28.17 17.825 145-149 27.41 26.965 27.26 18.365000000000002 150-151 27.025 26.4625 28.249999999999996 18.2625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 1.5 7 1.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.5 13 2.5 14 1.5 15 0.0 16 0.5 17 0.5 18 0.5 19 0.5 20 0.0 21 0.5 22 2.5 23 4.5 24 5.0 25 5.5 26 5.5 27 6.5 28 11.0 29 15.0 30 15.5 31 20.5 32 27.5 33 39.5 34 57.5 35 84.0 36 103.5 37 108.0 38 123.0 39 156.5 40 201.5 41 214.5 42 214.5 43 238.0 44 271.0 45 273.0 46 248.0 47 240.0 48 218.5 49 192.0 50 170.0 51 147.5 52 124.0 53 99.0 54 80.0 55 56.0 56 38.5 57 27.5 58 21.5 59 21.0 60 21.0 61 19.0 62 11.5 63 8.0 64 6.0 65 2.5 66 3.5 67 2.5 68 0.5 69 3.0 70 3.0 71 0.0 72 0.5 73 2.0 74 2.0 75 1.5 76 1.0 77 0.0 78 0.0 79 0.5 80 1.0 81 1.5 82 1.5 83 1.0 84 0.5 85 0.0 86 1.0 87 1.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.5 93 1.5 94 1.0 95 0.0 96 0.0 97 0.0 98 0.5 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.2 #Duplication Level Percentage of deduplicated Percentage of total 1 86.12089201877934 73.375 2 11.238262910798122 19.15 3 1.965962441314554 5.025 4 0.5868544600938966 2.0 5 0.05868544600938967 0.25 6 0.0 0.0 7 0.0 0.0 8 0.029342723004694836 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 8 0.2 No Hit AAACAACAACAATGTTTCGTCTAAGCAATAACTTGGTAGGAATCCTGAAC 5 0.125 No Hit AAAAAGGAAACGGTGAAGACTATAGTGGGTTTGTGAAGAAGCATATCACT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0125 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.1375 0.0 0.0 0.0 0.0 72-73 0.2125 0.0 0.0 0.0 0.0 74-75 0.275 0.0 0.0 0.0 0.0 76-77 0.3 0.0 0.0 0.0 0.0 78-79 0.4375 0.0 0.0 0.0 0.0 80-81 0.625 0.0 0.0 0.0 0.0 82-83 0.875 0.0 0.0 0.0 0.0 84-85 1.05 0.0 0.0 0.0 0.0 86-87 1.3375 0.0 0.0 0.0 0.0 88-89 1.6 0.0 0.0 0.0 0.0 90-91 1.85 0.0 0.0 0.0 0.0 92-93 2.0 0.0 0.0 0.0 0.0 94-95 2.2875 0.0 0.0 0.0 0.0 96-97 2.4875 0.0 0.0 0.0 0.0 98-99 2.7249999999999996 0.0 0.0 0.0 0.0 100-101 3.1125 0.0 0.0 0.0 0.0 102-103 3.525 0.0 0.0 0.0 0.0 104-105 3.9124999999999996 0.0 0.0 0.0 0.0 106-107 4.6375 0.0 0.0 0.0 0.0 108-109 5.199999999999999 0.0 0.0 0.0 0.0 110-111 5.95 0.0 0.0 0.0 0.0 112-113 6.800000000000001 0.0 0.0 0.0 0.0 114-115 7.6 0.0 0.0 0.0 0.0 116-117 8.45 0.0 0.0 0.0 0.0 118-119 9.1125 0.0 0.0 0.0 0.0 120-121 9.95 0.0 0.0 0.0 0.0 122-123 10.787500000000001 0.0 0.0 0.0 0.0 124-125 11.9125 0.0 0.0 0.0 0.0 126-127 12.712499999999999 0.0 0.0 0.0 0.0 128-129 13.5125 0.0 0.0 0.0 0.0 130-131 14.4875 0.0 0.0 0.0 0.0 132-133 15.5125 0.0 0.0 0.0 0.0 134-135 16.675 0.0 0.0 0.0 0.0 136-137 17.5 0.0 0.0 0.0 0.0 138-139 18.625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCTGTTG 20 0.00593511 29.0 35-39 >>END_MODULE Read 1539377 spots for SRR28623280.sra Written 1539377 spots for SRR28623280.sra Read 1539377 spots for SRR28623280.sra Written 1539377 spots for SRR28623280.sra Read 1539377 spots for SRR28623280.sra Written 1539377 spots for SRR28623280.sra Read 1539377 spots for SRR28623280.sra Written 1539377 spots for SRR28623280.sra Read 1539377 spots for SRR28623280.sra Written 1539377 spots for SRR28623280.sra Read 1539377 spots for SRR28623280.sra Written 1539377 spots for SRR28623280.sra Read 1539377 spots for SRR28623280.sra Written 1539377 spots for SRR28623280.sra Read 1539377 spots for SRR28623280.sra Written 1539377 spots for SRR28623280.sra Read 1539377 spots for SRR28623280.sra Written 1539377 spots for SRR28623280.sra Read 1539377 spots for SRR28623280.sra Written 1539377 spots for SRR28623280.sra Read 1539377 spots for SRR28623280.sra Written 1539377 spots for SRR28623280.sra Read 1539377 spots for SRR28623280.sra Written 1539377 spots for SRR28623280.sra Read 1539377 spots for SRR28623280.sra Written 1539377 spots for SRR28623280.sra Read 1539377 spots for SRR28623280.sra Written 1539377 spots for SRR28623280.sra Read 1539377 spots for SRR28623280.sra Written 1539377 spots for SRR28623280.sra Read 1539382 spots for SRR28623280.sra Written 1539382 spots for SRR28623280.sra Read 1539377 spots for SRR28623280.sra Written 1539377 spots for SRR28623280.sra Read 1539377 spots for SRR28623280.sra Written 1539377 spots for SRR28623280.sra Read 1539377 spots for SRR28623280.sra Written 1539377 spots for SRR28623280.sra Read 1539377 spots for SRR28623280.sra Written 1539377 spots for SRR28623280.sra SRR ids: ['SRR28623280.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vft6rvs8 SRR28623280.sra spots: 30787545 blocks: [[1, 1539377], [1539378, 3078754], [3078755, 4618131], [4618132, 6157508], [6157509, 7696885], [7696886, 9236262], [9236263, 10775639], [10775640, 12315016], [12315017, 13854393], [13854394, 15393770], [15393771, 16933147], [16933148, 18472524], [18472525, 20011901], [20011902, 21551278], [21551279, 23090655], [23090656, 24630032], [24630033, 26169409], [26169410, 27708786], [27708787, 29248163], [29248164, 30787545]] SRR28623280 file size 11368088 SRR28623280 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR28623280 SRR28623280_1.fastq SRR28623280_2.fastq Input file: SRR28623280_1.fastq Paired file: SRR28623280_2.fastq trimmed: SRR28623280-trimmed-pair1.fastq, SRR28623280-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 14:34:58 2025 >> started Tue Feb 11 14:35:33 2025 >> done (35.400s) 30787545 read pairs processed; of these: 31 ( 0.00%) short read pairs filtered out after trimming by size control 45453 ( 0.15%) empty read pairs filtered out after trimming by size control 30742061 (99.85%) read pairs available; of these: 7151186 (23.26%) trimmed read pairs available after processing 23590875 (76.74%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 2 0.00% 20 5 0.00% 21 6 0.00% 22 3 0.00% 23 9 0.00% 24 6 0.00% 25 7 0.00% 26 6 0.00% 27 3 0.00% 28 8 0.00% 29 18 0.00% 30 16 0.00% 31 14 0.00% 32 15 0.00% 33 22 0.00% 34 35 0.00% 35 15 0.00% 36 32 0.00% 37 24 0.00% 38 44 0.00% 39 52 0.00% 40 62 0.00% 41 86 0.00% 42 84 0.00% 43 109 0.00% 44 120 0.00% 45 134 0.00% 46 155 0.00% 47 200 0.00% 48 254 0.00% 49 302 0.00% 50 393 0.00% 51 383 0.00% 52 530 0.00% 53 574 0.00% 54 702 0.00% 55 735 0.00% 56 892 0.00% 57 1030 0.00% 58 1258 0.00% 59 1534 0.00% 60 1842 0.01% 61 2075 0.01% 62 2447 0.01% 63 2762 0.01% 64 3258 0.01% 65 3590 0.01% 66 4295 0.01% 67 4850 0.02% 68 5666 0.02% 69 6300 0.02% 70 7201 0.02% 71 8472 0.03% 72 9842 0.03% 73 11163 0.04% 74 12550 0.04% 75 13981 0.05% 76 15696 0.05% 77 17140 0.06% 78 18391 0.06% 79 20920 0.07% 80 22561 0.07% 81 24653 0.08% 82 27213 0.09% 83 29395 0.10% 84 32675 0.11% 85 35495 0.12% 86 37214 0.12% 87 39547 0.13% 88 41350 0.13% 89 43817 0.14% 90 46380 0.15% 91 49110 0.16% 92 51150 0.17% 93 54729 0.18% 94 57080 0.19% 95 60301 0.20% 96 63071 0.21% 97 65768 0.21% 98 68320 0.22% 99 70554 0.23% 100 73160 0.24% 101 74277 0.24% 102 77260 0.25% 103 79250 0.26% 104 82117 0.27% 105 84529 0.27% 106 87224 0.28% 107 89443 0.29% 108 91963 0.30% 109 93540 0.30% 110 95171 0.31% 111 97557 0.32% 112 99932 0.33% 113 100502 0.33% 114 103601 0.34% 115 106480 0.35% 116 107275 0.35% 117 110024 0.36% 118 113288 0.37% 119 113612 0.37% 120 115735 0.38% 121 116966 0.38% 122 119060 0.39% 123 119910 0.39% 124 121758 0.40% 125 122457 0.40% 126 125453 0.41% 127 127224 0.41% 128 128639 0.42% 129 129278 0.42% 130 131236 0.43% 131 131476 0.43% 132 133811 0.44% 133 135470 0.44% 134 134575 0.44% 135 134807 0.44% 136 136445 0.44% 137 137263 0.45% 138 139061 0.45% 139 140867 0.46% 140 139318 0.45% 141 142034 0.46% 142 145176 0.47% 143 144679 0.47% 144 144013 0.47% 145 144921 0.47% 146 143924 0.47% 147 144262 0.47% 148 145970 0.47% 149 145715 0.47% 150 146773 0.48% 151 23590875 76.74% 30742061 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.26 fanout-score-rank=31 prefix-density=0.16 prefix-fanout=2.2 sequence=CTCTAAGAGAGTTGACCACAGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=90.54 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=12.3 sequence=AGAAGAAATCATAGATTGCAACCAATAGATAAGGGTTGATTGTACTCCAACATCTCCTGATCGGTTCACTTGGCACTGGCAAGTTGGGTGCGGAGGAGCTTGGCAGCATCAACCATGTTCTTGAGAGCTGGCTTCACCTCAGAGTACTTGCGAGTTTTGAGTCCACAGTCAGGGTTAACCCACAATATGTTTGTCTCAAGCACTGCAAGCATCTTGTTGATTCTATCAGCAATCTCCTCGGTTGATGGTATTCTGGGAGAGTGGATATCATAGACACCAGGACCAATTCCAGCACCATACTTCACTCCCTCACGGAAGACTGAGAGAAGCTTTTCATCGGAGCGAGAGTTCTCGATGGTGATCACATCAGCATCCATGTCGATGATTGAGTGGATAATGTCATTGAAGTTGGAGTAGCACATGTGAGTGTGGATCTGGGTGGTGTCCTGTACGCCACAATTGGTGATCCTGAAGGAGTGGACTGCCCAATCCAAGTAAAAAGCTTGTTCGG criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=33 prefix-density=0.13 prefix-fanout=2.0 sequence=AATAGGTTCTTGAAGACAGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=44.02 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=5.5 sequence=GGAGATTGTCTCGTACGGTTAAGAGCCTCCGCCCGTCTCTGGGACTATGGACGGGCACGCTCATATCAGGCTATATTTGGTCCGGGTTATTATCGTCGCGGTTACCGTAATACTTCAGATCAGTTAAGTAGGGCCATATGCCTCGGGAATAAGCTGACGGTGACAAGGTTTCCCCCTAATCGAGACGCTGCAATAACACAGGGGCATACAGTAACCAGGCAAGAGTTCAATCGCTTAGTTTCGTGGCGGGATTTGAGGAAAACTGCGACTGTTCTTTAACCAAACATCCGTGCGATTCGTGCCACTCGTAGACGGCATCTCACAGTCACTGAAGGCTATTAAAGAGTTAGCACCCACCATTGGATGAAGCCCAGGATAAGTGACCCCCCCGGACCTTGGAGTTTCATGC SRR28623280 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 14:36:19 Started mapping on | Feb 11 14:36:20 Finished on | Feb 11 14:41:32 Mapping speed, Million of reads per hour | 354.72 Number of input reads | 30742061 Average input read length | 288 UNIQUE READS: Uniquely mapped reads number | 27048007 Uniquely mapped reads % | 87.98% Average mapped length | 286.81 Number of splices: Total | 20333021 Number of splices: Annotated (sjdb) | 19828660 Number of splices: GT/AG | 19967240 Number of splices: GC/AG | 275745 Number of splices: AT/AC | 21567 Number of splices: Non-canonical | 68469 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.04% Deletion average length | 2.98 Insertion rate per base | 0.03% Insertion average length | 2.24 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 627086 % of reads mapped to multiple loci | 2.04% Number of reads mapped to too many loci | 970176 % of reads mapped to too many loci | 3.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.22% % of reads unmapped: other | 0.60% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3066968 3066968 3066968 N_multimapping 627086 627086 627086 N_noFeature 1125980 26654628 1307222 N_ambiguous 337542 3627 122555 UnstrandedReadsAssigned:25584485 PositiveStrandReadsAssigned:389752 NegativeStrandReadsAssigned:25618230 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=143 echo kmer=139 SRR28623280 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR28623280-trimmed-pair1.fastq SRR28623280-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 30,742,061 reads, 26,748,958 reads pseudoaligned [quant] estimated average fragment length: 203.033 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,123 rounds 52401 SRR28623280.ke.tsv 34699 SRR28623280.se.tsv 87100 total ==> SRR28623280.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1815.97 830 18.0588 Potri.005G024800.1.v4.1 1035 832.967 196 9.29708 Potri.004G059700.1.v4.1 961 758.977 53 2.75909 Potri.007G009000.2.v4.1 1416 1213.97 0 0 Potri.003G141000.2.v4.1 2943 2740.97 290.496 4.1875 Potri.016G087400.1.v4.1 270 102.842 2066.32 793.861 Potri.015G069301.1.v4.1 564 364.946 0 0 Potri.010G195200.1.v4.1 1773 1570.97 147 3.69716 Potri.012G127500.1.v4.1 977 774.977 7934 404.503 ==> SRR28623280.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 3639 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 637 Potri.001G212900.v4.1 12 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR28623280 completed mapping pipeline successfully