Starting /dee2/code/volunteer_pipeline.sh SRR28623281 current disk space = 3050304909312 free memory = 1421473012 SRR28623281 SRAfilesize 5d6af3b88b663ab04c4de4574a5bbaa9 SRR28623281.sra SRR28623281.sra file validated SRR28623281 is paired end SRR28623281 is conventional basespace SRR28623281 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623281_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4765 37.0 37.0 37.0 37.0 37.0 2 36.441 37.0 37.0 37.0 37.0 37.0 3 36.556 37.0 37.0 37.0 37.0 37.0 4 36.667 37.0 37.0 37.0 37.0 37.0 5 36.6765 37.0 37.0 37.0 37.0 37.0 6 36.664 37.0 37.0 37.0 37.0 37.0 7 36.636 37.0 37.0 37.0 37.0 37.0 8 36.463 37.0 37.0 37.0 37.0 37.0 9 36.6705 37.0 37.0 37.0 37.0 37.0 10-14 36.5733 37.0 37.0 37.0 37.0 37.0 15-19 36.574200000000005 37.0 37.0 37.0 37.0 37.0 20-24 36.528600000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.5004 37.0 37.0 37.0 37.0 37.0 30-34 36.511100000000006 37.0 37.0 37.0 37.0 37.0 35-39 36.444900000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.4136 37.0 37.0 37.0 37.0 37.0 45-49 36.3798 37.0 37.0 37.0 37.0 37.0 50-54 36.3155 37.0 37.0 37.0 37.0 37.0 55-59 36.3095 37.0 37.0 37.0 37.0 37.0 60-64 36.3251 37.0 37.0 37.0 37.0 37.0 65-69 36.2732 37.0 37.0 37.0 37.0 37.0 70-74 36.18390000000001 37.0 37.0 37.0 37.0 37.0 75-79 36.1894 37.0 37.0 37.0 37.0 37.0 80-84 36.08480000000001 37.0 37.0 37.0 37.0 37.0 85-89 36.095600000000005 37.0 37.0 37.0 37.0 37.0 90-94 36.0034 37.0 37.0 37.0 37.0 37.0 95-99 35.9462 37.0 37.0 37.0 37.0 37.0 100-104 36.0029 37.0 37.0 37.0 37.0 37.0 105-109 35.973200000000006 37.0 37.0 37.0 37.0 37.0 110-114 35.920300000000005 37.0 37.0 37.0 37.0 37.0 115-119 35.872 37.0 37.0 37.0 37.0 37.0 120-124 35.728300000000004 37.0 37.0 37.0 37.0 37.0 125-129 35.71039999999999 37.0 37.0 37.0 37.0 37.0 130-134 35.8212 37.0 37.0 37.0 37.0 37.0 135-139 35.7053 37.0 37.0 37.0 37.0 37.0 140-144 35.3654 37.0 37.0 37.0 34.6 37.0 145-149 35.4394 37.0 37.0 37.0 37.0 37.0 150-151 35.217 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 0.0 18 1.0 19 0.0 20 0.0 21 0.0 22 1.0 23 3.0 24 2.0 25 4.0 26 7.0 27 9.0 28 11.0 29 19.0 30 31.0 31 37.0 32 69.0 33 87.0 34 139.0 35 355.0 36 2945.0 37 279.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.045112781954884 14.43609022556391 8.471177944862156 39.04761904761905 2 18.4 14.625 38.125 28.849999999999998 3 17.150000000000002 19.35 29.25 34.25 4 23.1 25.650000000000002 24.099999999999998 27.150000000000002 5 23.474999999999998 31.624999999999996 24.85 20.05 6 20.549999999999997 37.325 22.525000000000002 19.6 7 15.425 29.299999999999997 39.375 15.9 8 18.05 28.425 31.775 21.75 9 18.3 23.9 33.324999999999996 24.474999999999998 10-14 19.52 31.380000000000003 27.48 21.62 15-19 20.01 28.52 28.04 23.43 20-24 19.725 28.294999999999998 28.565 23.415 25-29 19.985 29.24 27.615000000000002 23.16 30-34 19.695 28.93 28.000000000000004 23.375 35-39 19.384999999999998 28.82 27.72 24.075 40-44 19.564999999999998 29.520000000000003 27.375 23.54 45-49 19.54 29.060000000000002 27.689999999999998 23.71 50-54 19.63 29.494999999999997 27.265 23.61 55-59 19.49 28.825 27.834999999999997 23.849999999999998 60-64 19.08 28.78 27.905 24.235 65-69 19.715 29.59 27.705000000000002 22.99 70-74 19.900000000000002 29.42 27.115000000000002 23.565 75-79 19.905 28.825 27.395000000000003 23.875 80-84 20.064999999999998 28.694999999999997 27.01 24.23 85-89 20.18 28.225 27.66 23.935000000000002 90-94 20.035 29.025000000000002 27.3 23.64 95-99 19.98 28.425 27.705000000000002 23.89 100-104 20.1 28.735 27.615000000000002 23.549999999999997 105-109 20.625 28.384999999999998 27.54 23.45 110-114 20.005 28.754999999999995 27.58 23.66 115-119 20.34 28.535 26.915 24.21 120-124 20.31 28.655 27.02 24.015 125-129 20.72 28.625 26.58 24.075 130-134 20.255000000000003 28.865000000000002 26.845000000000002 24.035 135-139 21.240000000000002 27.76 26.25 24.75 140-144 20.445 28.205000000000002 26.700000000000003 24.65 145-149 21.02 27.855 26.55 24.575 150-151 20.45 27.762500000000003 26.787499999999998 25.0 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 1.0 19 1.0 20 1.0 21 1.5 22 1.5 23 1.0 24 3.0 25 4.5 26 5.0 27 9.5 28 9.5 29 14.5 30 24.0 31 32.5 32 43.5 33 52.0 34 64.0 35 84.5 36 101.5 37 127.0 38 141.0 39 168.5 40 213.0 41 225.5 42 252.0 43 244.5 44 235.5 45 273.0 46 268.5 47 243.0 48 224.5 49 181.0 50 144.0 51 127.5 52 100.0 53 85.0 54 71.5 55 50.5 56 38.5 57 26.0 58 18.0 59 17.5 60 15.5 61 13.5 62 10.5 63 4.5 64 2.5 65 3.0 66 4.0 67 2.0 68 3.0 69 2.5 70 0.5 71 1.5 72 1.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.25 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.775 #Duplication Level Percentage of deduplicated Percentage of total 1 85.549985255087 72.52499999999999 2 11.530521969920377 19.55 3 2.3296962547920965 5.925 4 0.5897965202005309 2.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.1875 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.2875 0.0 0.0 0.0 0.0 82-83 0.32499999999999996 0.0 0.0 0.0 0.0 84-85 0.4 0.0 0.0 0.0 0.0 86-87 0.4625 0.0 0.0 0.0 0.0 88-89 0.7 0.0 0.0 0.0 0.0 90-91 0.8 0.0 0.0 0.0 0.0 92-93 0.9125 0.0 0.0 0.0 0.0 94-95 1.1375000000000002 0.0 0.0 0.0 0.0 96-97 1.3624999999999998 0.0 0.0 0.0 0.0 98-99 1.6625 0.0 0.0 0.0 0.0 100-101 2.025 0.0 0.0 0.0 0.0 102-103 2.5250000000000004 0.0 0.0 0.0 0.0 104-105 3.025 0.0 0.0 0.0 0.0 106-107 3.4875 0.0 0.0 0.0 0.0 108-109 3.825 0.0 0.0 0.0 0.0 110-111 4.2375 0.0 0.0 0.0 0.0 112-113 4.65 0.0 0.0 0.0 0.0 114-115 5.2875 0.0 0.0 0.0 0.0 116-117 5.675000000000001 0.0 0.0 0.0 0.0 118-119 6.1375 0.0 0.0 0.0 0.0 120-121 6.9375 0.0 0.0 0.0 0.0 122-123 7.35 0.0 0.0 0.0 0.0 124-125 7.85 0.0 0.0 0.0 0.0 126-127 8.3125 0.0 0.0 0.0 0.0 128-129 8.9375 0.0 0.0 0.0 0.0 130-131 9.7625 0.0 0.0 0.0 0.0 132-133 10.55 0.0 0.0 0.0 0.0 134-135 11.25 0.0 0.0 0.0 0.0 136-137 12.05 0.0 0.0 0.0 0.0 138-139 12.5875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGGTTTT 10 0.006830828 145.0 2 ATCCAAC 10 0.006830828 145.0 145 ACATGCG 10 0.006830828 145.0 4 TGCGAGT 10 0.006830828 145.0 7 ATGCGAG 10 0.006830828 145.0 6 CGAACAA 10 0.006830828 145.0 5 CGAGTTT 10 0.006830828 145.0 9 GAACAAT 10 0.006830828 145.0 6 GCACATG 10 0.006830828 145.0 2 GCGAGTT 10 0.006830828 145.0 8 CATGCGA 10 0.006830828 145.0 5 CCGAAAT 10 0.006830828 145.0 2 >>END_MODULE SRR28623281 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623281_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.824 37.0 37.0 37.0 37.0 37.0 2 36.2085 37.0 37.0 37.0 37.0 37.0 3 36.2875 37.0 37.0 37.0 37.0 37.0 4 36.1885 37.0 37.0 37.0 37.0 37.0 5 36.2525 37.0 37.0 37.0 37.0 37.0 6 36.087 37.0 37.0 37.0 37.0 37.0 7 36.3035 37.0 37.0 37.0 37.0 37.0 8 36.115 37.0 37.0 37.0 37.0 37.0 9 36.1815 37.0 37.0 37.0 37.0 37.0 10-14 36.153499999999994 37.0 37.0 37.0 37.0 37.0 15-19 36.1369 37.0 37.0 37.0 37.0 37.0 20-24 36.201499999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.1271 37.0 37.0 37.0 37.0 37.0 30-34 35.9797 37.0 37.0 37.0 37.0 37.0 35-39 36.063599999999994 37.0 37.0 37.0 37.0 37.0 40-44 36.0255 37.0 37.0 37.0 37.0 37.0 45-49 35.991 37.0 37.0 37.0 37.0 37.0 50-54 35.957 37.0 37.0 37.0 37.0 37.0 55-59 35.833999999999996 37.0 37.0 37.0 37.0 37.0 60-64 35.7727 37.0 37.0 37.0 37.0 37.0 65-69 35.824200000000005 37.0 37.0 37.0 37.0 37.0 70-74 35.76199999999999 37.0 37.0 37.0 37.0 37.0 75-79 35.8388 37.0 37.0 37.0 37.0 37.0 80-84 35.669599999999996 37.0 37.0 37.0 37.0 37.0 85-89 35.667199999999994 37.0 37.0 37.0 37.0 37.0 90-94 35.6205 37.0 37.0 37.0 37.0 37.0 95-99 35.6391 37.0 37.0 37.0 37.0 37.0 100-104 35.5419 37.0 37.0 37.0 37.0 37.0 105-109 35.426899999999996 37.0 37.0 37.0 37.0 37.0 110-114 35.541 37.0 37.0 37.0 37.0 37.0 115-119 35.4303 37.0 37.0 37.0 37.0 37.0 120-124 35.5389 37.0 37.0 37.0 37.0 37.0 125-129 35.0386 37.0 37.0 37.0 29.8 37.0 130-134 35.341499999999996 37.0 37.0 37.0 34.6 37.0 135-139 35.0737 37.0 37.0 37.0 25.0 37.0 140-144 34.9991 37.0 37.0 37.0 25.0 37.0 145-149 35.0259 37.0 37.0 37.0 27.4 37.0 150-151 34.66675 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 2.0 14 5.0 15 4.0 16 4.0 17 2.0 18 1.0 19 0.0 20 4.0 21 3.0 22 5.0 23 8.0 24 10.0 25 8.0 26 16.0 27 10.0 28 14.0 29 14.0 30 31.0 31 47.0 32 73.0 33 111.0 34 235.0 35 654.0 36 2509.0 37 229.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.550000000000004 23.1 11.125 25.224999999999998 2 27.375 26.450000000000003 29.849999999999998 16.325 3 23.275000000000002 28.1 30.375000000000004 18.25 4 24.675 34.625 21.65 19.05 5 26.375 35.575 23.1 14.95 6 21.375 38.925 21.425 18.275 7 22.15 21.9 38.2 17.75 8 22.25 25.1 29.075 23.575 9 22.375 23.474999999999998 30.2 23.95 10-14 23.27 29.4 26.939999999999998 20.39 15-19 23.925 27.705000000000002 28.294999999999998 20.075000000000003 20-24 23.575 28.555000000000003 27.47 20.4 25-29 23.425 28.505000000000003 27.97 20.1 30-34 23.53 28.095 28.26 20.115 35-39 22.675 28.810000000000002 27.46 21.055 40-44 23.145 28.76 27.650000000000002 20.445 45-49 22.93 28.360000000000003 28.21 20.5 50-54 22.81 28.744999999999997 28.165000000000003 20.28 55-59 23.68 28.465 27.900000000000002 19.955000000000002 60-64 23.235 28.46 28.144999999999996 20.16 65-69 23.23 29.220000000000002 27.715 19.835 70-74 23.59 28.675 28.075 19.66 75-79 23.419999999999998 27.985 28.53 20.064999999999998 80-84 23.125 28.325 28.575 19.975 85-89 24.32 28.050000000000004 27.515 20.115 90-94 23.880000000000003 27.805000000000003 28.13 20.185 95-99 23.630000000000003 28.04 28.585 19.744999999999997 100-104 24.45 27.49 28.084999999999997 19.975 105-109 24.745 28.37 27.644999999999996 19.24 110-114 25.025 28.365000000000002 27.275 19.335 115-119 24.515 28.610000000000003 26.865 20.01 120-124 25.055 27.779999999999998 27.43 19.735 125-129 25.64 28.57 26.495 19.295 130-134 25.255 28.73 26.905 19.11 135-139 25.395 27.825 27.35 19.43 140-144 25.25 28.439999999999998 27.139999999999997 19.17 145-149 25.945 28.205000000000002 26.924999999999997 18.925 150-151 26.474999999999998 27.1625 27.1375 19.225 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 1.0 8 0.5 9 0.0 10 0.5 11 0.5 12 1.0 13 1.5 14 1.0 15 0.5 16 0.5 17 2.0 18 2.0 19 1.5 20 2.0 21 2.0 22 1.5 23 4.0 24 4.5 25 4.5 26 10.5 27 11.5 28 9.0 29 15.5 30 20.0 31 20.5 32 35.0 33 46.5 34 61.0 35 80.0 36 91.0 37 102.5 38 134.0 39 171.5 40 192.5 41 217.5 42 249.0 43 282.5 44 282.5 45 270.0 46 263.0 47 262.0 48 224.5 49 175.0 50 154.5 51 134.0 52 105.0 53 71.5 54 61.5 55 49.5 56 40.5 57 30.5 58 20.0 59 15.5 60 9.0 61 8.0 62 9.0 63 5.5 64 3.0 65 3.5 66 2.5 67 2.0 68 2.5 69 1.0 70 1.0 71 2.5 72 1.5 73 0.0 74 1.0 75 1.0 76 0.0 77 0.0 78 0.5 79 1.0 80 0.5 81 0.0 82 0.5 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.375 #Duplication Level Percentage of deduplicated Percentage of total 1 86.23718887262079 73.625 2 10.95168374816984 18.7 3 2.2840409956076133 5.8500000000000005 4 0.49780380673499264 1.7000000000000002 5 0.029282576866764276 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CGGAGAAACTCGATGACGAAAACAAAGAACATTTTAAGAAAAACATTGAG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.1875 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.2875 0.0 0.0 0.0 0.0 82-83 0.32499999999999996 0.0 0.0 0.0 0.0 84-85 0.4 0.0 0.0 0.0 0.0 86-87 0.4625 0.0 0.0 0.0 0.0 88-89 0.7 0.0 0.0 0.0 0.0 90-91 0.8 0.0 0.0 0.0 0.0 92-93 0.9125 0.0 0.0 0.0 0.0 94-95 1.1375000000000002 0.0 0.0 0.0 0.0 96-97 1.3624999999999998 0.0 0.0 0.0 0.0 98-99 1.6625 0.0 0.0 0.0 0.0 100-101 2.025 0.0 0.0 0.0 0.0 102-103 2.5250000000000004 0.0 0.0 0.0 0.0 104-105 3.025 0.0 0.0 0.0 0.0 106-107 3.4875 0.0 0.0 0.0 0.0 108-109 3.8375000000000004 0.0 0.0 0.0 0.0 110-111 4.2625 0.0 0.0 0.0 0.0 112-113 4.675000000000001 0.0 0.0 0.0 0.0 114-115 5.3125 0.0 0.0 0.0 0.0 116-117 5.699999999999999 0.0 0.0 0.0 0.0 118-119 6.1875 0.0 0.0 0.0 0.0 120-121 6.9875 0.0 0.0 0.0 0.0 122-123 7.4125 0.0 0.0 0.0 0.0 124-125 7.9125 0.0 0.0 0.0 0.0 126-127 8.3625 0.0 0.0 0.0 0.0 128-129 9.0 0.0 0.0 0.0 0.0 130-131 9.825 0.0 0.0 0.0 0.0 132-133 10.625 0.0 0.0 0.0 0.0 134-135 11.2875 0.0 0.0 0.0 0.0 136-137 12.1125 0.0 0.0 0.0 0.0 138-139 12.6875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCCGAT 10 0.006830828 145.0 9 GTGTAAA 10 0.006830828 145.0 145 GATCTTG 10 0.006830828 145.0 6 ATTCCGA 10 0.006830828 145.0 8 AAAAAAA 95 3.29002E-5 13.736842 85-89 >>END_MODULE Read 1445800 spots for SRR28623281.sra Written 1445800 spots for SRR28623281.sra Read 1445800 spots for SRR28623281.sra Written 1445800 spots for SRR28623281.sra Read 1445800 spots for SRR28623281.sra Written 1445800 spots for SRR28623281.sra Read 1445800 spots for SRR28623281.sra Written 1445800 spots for SRR28623281.sra Read 1445800 spots for SRR28623281.sra Written 1445800 spots for SRR28623281.sra Read 1445800 spots for SRR28623281.sra Written 1445800 spots for SRR28623281.sra Read 1445800 spots for SRR28623281.sra Written 1445800 spots for SRR28623281.sra Read 1445800 spots for SRR28623281.sra Written 1445800 spots for SRR28623281.sra Read 1445800 spots for SRR28623281.sra Written 1445800 spots for SRR28623281.sra Read 1445800 spots for SRR28623281.sra Written 1445800 spots for SRR28623281.sra Read 1445800 spots for SRR28623281.sra Written 1445800 spots for SRR28623281.sra Read 1445800 spots for SRR28623281.sra Written 1445800 spots for SRR28623281.sra Read 1445800 spots for SRR28623281.sra Written 1445800 spots for SRR28623281.sra Read 1445800 spots for SRR28623281.sra Written 1445800 spots for SRR28623281.sra Read 1445800 spots for SRR28623281.sra Written 1445800 spots for SRR28623281.sra Read 1445800 spots for SRR28623281.sra Written 1445800 spots for SRR28623281.sra Read 1445814 spots for SRR28623281.sra Written 1445814 spots for SRR28623281.sra Read 1445800 spots for SRR28623281.sra Written 1445800 spots for SRR28623281.sra Read 1445800 spots for SRR28623281.sra Written 1445800 spots for SRR28623281.sra Read 1445800 spots for SRR28623281.sra Written 1445800 spots for SRR28623281.sra SRR ids: ['SRR28623281.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qtmm598y SRR28623281.sra spots: 28916014 blocks: [[1, 1445800], [1445801, 2891600], [2891601, 4337400], [4337401, 5783200], [5783201, 7229000], [7229001, 8674800], [8674801, 10120600], [10120601, 11566400], [11566401, 13012200], [13012201, 14458000], [14458001, 15903800], [15903801, 17349600], [17349601, 18795400], [18795401, 20241200], [20241201, 21687000], [21687001, 23132800], [23132801, 24578600], [24578601, 26024400], [26024401, 27470200], [27470201, 28916014]] SRR28623281 file size 10676380 SRR28623281 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR28623281 SRR28623281_1.fastq SRR28623281_2.fastq Input file: SRR28623281_1.fastq Paired file: SRR28623281_2.fastq trimmed: SRR28623281-trimmed-pair1.fastq, SRR28623281-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 13:57:42 2025 >> started Tue Feb 11 13:58:15 2025 >> done (33.373s) 28916014 read pairs processed; of these: 36 ( 0.00%) short read pairs filtered out after trimming by size control 13101 ( 0.05%) empty read pairs filtered out after trimming by size control 28902877 (99.95%) read pairs available; of these: 5199885 (17.99%) trimmed read pairs available after processing 23702992 (82.01%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 5 0.00% 20 1 0.00% 21 2 0.00% 22 9 0.00% 23 8 0.00% 24 5 0.00% 25 3 0.00% 26 9 0.00% 27 4 0.00% 28 10 0.00% 29 7 0.00% 30 10 0.00% 31 12 0.00% 32 17 0.00% 33 16 0.00% 34 10 0.00% 35 20 0.00% 36 25 0.00% 37 20 0.00% 38 28 0.00% 39 37 0.00% 40 46 0.00% 41 71 0.00% 42 60 0.00% 43 68 0.00% 44 59 0.00% 45 80 0.00% 46 89 0.00% 47 98 0.00% 48 137 0.00% 49 137 0.00% 50 148 0.00% 51 196 0.00% 52 228 0.00% 53 259 0.00% 54 282 0.00% 55 308 0.00% 56 362 0.00% 57 438 0.00% 58 497 0.00% 59 621 0.00% 60 722 0.00% 61 844 0.00% 62 958 0.00% 63 1118 0.00% 64 1247 0.00% 65 1479 0.01% 66 1668 0.01% 67 1780 0.01% 68 2148 0.01% 69 2362 0.01% 70 2752 0.01% 71 3080 0.01% 72 3674 0.01% 73 4313 0.01% 74 4815 0.02% 75 5462 0.02% 76 6082 0.02% 77 6539 0.02% 78 7585 0.03% 79 8360 0.03% 80 9373 0.03% 81 10742 0.04% 82 11871 0.04% 83 13126 0.05% 84 14722 0.05% 85 16570 0.06% 86 17989 0.06% 87 19287 0.07% 88 20914 0.07% 89 22521 0.08% 90 24075 0.08% 91 26322 0.09% 92 28288 0.10% 93 30854 0.11% 94 33116 0.11% 95 35864 0.12% 96 38125 0.13% 97 40312 0.14% 98 41619 0.14% 99 43793 0.15% 100 45792 0.16% 101 47012 0.16% 102 49209 0.17% 103 52306 0.18% 104 54409 0.19% 105 58070 0.20% 106 60270 0.21% 107 61805 0.21% 108 64302 0.22% 109 66664 0.23% 110 66577 0.23% 111 69115 0.24% 112 70527 0.24% 113 72046 0.25% 114 74806 0.26% 115 78145 0.27% 116 80079 0.28% 117 82252 0.28% 118 84303 0.29% 119 85251 0.29% 120 87215 0.30% 121 87738 0.30% 122 88564 0.31% 123 90781 0.31% 124 92212 0.32% 125 93657 0.32% 126 96732 0.33% 127 98952 0.34% 128 100280 0.35% 129 101796 0.35% 130 103323 0.36% 131 103483 0.36% 132 103950 0.36% 133 105165 0.36% 134 105923 0.37% 135 107835 0.37% 136 109334 0.38% 137 110248 0.38% 138 112608 0.39% 139 114514 0.40% 140 113989 0.39% 141 115293 0.40% 142 115504 0.40% 143 114993 0.40% 144 116817 0.40% 145 117232 0.41% 146 116720 0.40% 147 117803 0.41% 148 120445 0.42% 149 121048 0.42% 150 121875 0.42% 151 23702992 82.01% 28902877 reads passed initial QC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=2.81 fanout-score-rank=35 prefix-density=0.14 prefix-fanout=2.7 sequence=GTGGACTCCTTCTGGAT criterion=fanout-score sequence-density=0.06 sequence-density-rank=22 fanout-score=345.87 fanout-score-rank=1 prefix-density=0.95 prefix-fanout=21.0 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=12.28 fanout-score-rank=21 prefix-density=0.20 prefix-fanout=7.3 sequence=GAAGGCAATGAGA criterion=fanout-score sequence-density=0.07 sequence-density-rank=9 fanout-score=344.06 fanout-score-rank=1 prefix-density=0.93 prefix-fanout=26.8 sequence=AAGAAGAAGAAA SRR28623281 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 13:58:57 Started mapping on | Feb 11 13:58:58 Finished on | Feb 11 14:01:38 Mapping speed, Million of reads per hour | 650.31 Number of input reads | 28902877 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 27225732 Uniquely mapped reads % | 94.20% Average mapped length | 290.74 Number of splices: Total | 23865501 Number of splices: Annotated (sjdb) | 23288805 Number of splices: GT/AG | 23446496 Number of splices: GC/AG | 323522 Number of splices: AT/AC | 24669 Number of splices: Non-canonical | 70814 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.04% Deletion average length | 2.97 Insertion rate per base | 0.03% Insertion average length | 2.39 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 666945 % of reads mapped to multiple loci | 2.31% Number of reads mapped to too many loci | 169562 % of reads mapped to too many loci | 0.59% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.69% % of reads unmapped: other | 0.22% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1010200 1010200 1010200 N_multimapping 666945 666945 666945 N_noFeature 1221222 26849580 1403160 N_ambiguous 351081 2327 155271 UnstrandedReadsAssigned:25653429 PositiveStrandReadsAssigned:373825 NegativeStrandReadsAssigned:25667301 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR28623281 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR28623281-trimmed-pair1.fastq SRR28623281-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 28,902,877 reads, 25,987,018 reads pseudoaligned [quant] estimated average fragment length: 221.616 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,090 rounds 52401 SRR28623281.ke.tsv 34699 SRR28623281.se.tsv 87100 total ==> SRR28623281.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1797.38 1101 24.0486 Potri.005G024800.1.v4.1 1035 814.384 644 31.0456 Potri.004G059700.1.v4.1 961 740.405 102 5.40847 Potri.007G009000.2.v4.1 1416 1195.38 0 0 Potri.003G141000.2.v4.1 2943 2722.38 976.704 14.085 Potri.016G087400.1.v4.1 270 95.9726 1892.07 773.986 Potri.015G069301.1.v4.1 564 348.006 0 0 Potri.010G195200.1.v4.1 1773 1552.38 115 2.90832 Potri.012G127500.1.v4.1 977 756.389 5382 279.346 ==> SRR28623281.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1044 Potri.001G233950.v4.1 3 Potri.001G122700.v4.1 539 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 29 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 7 SRR28623281 completed mapping pipeline successfully