Starting /dee2/code/volunteer_pipeline.sh SRR28623282 current disk space = 3050068357120 free memory = 1467469184 SRR28623282 SRAfilesize 0002820693bdc64e27ccf0ae48a9f2f7 SRR28623282.sra SRR28623282.sra file validated SRR28623282 is paired end SRR28623282 is conventional basespace SRR28623282 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623282_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.81475 37.0 37.0 37.0 37.0 37.0 2 36.396 37.0 37.0 37.0 37.0 37.0 3 36.448 37.0 37.0 37.0 37.0 37.0 4 36.5515 37.0 37.0 37.0 37.0 37.0 5 36.643 37.0 37.0 37.0 37.0 37.0 6 36.5855 37.0 37.0 37.0 37.0 37.0 7 36.57575 37.0 37.0 37.0 37.0 37.0 8 36.547 37.0 37.0 37.0 37.0 37.0 9 36.568 37.0 37.0 37.0 37.0 37.0 10-14 36.5923 37.0 37.0 37.0 37.0 37.0 15-19 36.576 37.0 37.0 37.0 37.0 37.0 20-24 36.528800000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.4519 37.0 37.0 37.0 37.0 37.0 30-34 36.4149 37.0 37.0 37.0 37.0 37.0 35-39 36.3688 37.0 37.0 37.0 37.0 37.0 40-44 36.36120000000001 37.0 37.0 37.0 37.0 37.0 45-49 36.295 37.0 37.0 37.0 37.0 37.0 50-54 36.2758 37.0 37.0 37.0 37.0 37.0 55-59 36.2355 37.0 37.0 37.0 37.0 37.0 60-64 36.2091 37.0 37.0 37.0 37.0 37.0 65-69 36.1132 37.0 37.0 37.0 37.0 37.0 70-74 36.0889 37.0 37.0 37.0 37.0 37.0 75-79 36.03959999999999 37.0 37.0 37.0 37.0 37.0 80-84 35.957499999999996 37.0 37.0 37.0 37.0 37.0 85-89 35.9197 37.0 37.0 37.0 37.0 37.0 90-94 35.954600000000006 37.0 37.0 37.0 37.0 37.0 95-99 35.8287 37.0 37.0 37.0 37.0 37.0 100-104 35.7873 37.0 37.0 37.0 37.0 37.0 105-109 35.783 37.0 37.0 37.0 37.0 37.0 110-114 35.611900000000006 37.0 37.0 37.0 37.0 37.0 115-119 35.6032 37.0 37.0 37.0 37.0 37.0 120-124 35.4793 37.0 37.0 37.0 37.0 37.0 125-129 35.2891 37.0 37.0 37.0 29.8 37.0 130-134 34.9049 37.0 37.0 37.0 25.0 37.0 135-139 34.7773 37.0 37.0 37.0 25.0 37.0 140-144 34.491400000000006 37.0 37.0 37.0 25.0 37.0 145-149 34.197500000000005 37.0 37.0 37.0 25.0 37.0 150-151 33.39425 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 1.0 22 0.0 23 0.0 24 4.0 25 7.0 26 8.0 27 18.0 28 18.0 29 22.0 30 43.0 31 49.0 32 110.0 33 152.0 34 190.0 35 471.0 36 2767.0 37 139.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.35001250938204 13.385038779084313 9.006755066299725 44.25819364523392 2 17.525 15.25 38.05 29.175 3 16.45 17.325 27.975 38.25 4 21.349999999999998 26.200000000000003 24.25 28.199999999999996 5 23.525 31.775 23.875 20.825 6 20.5 37.375 22.5 19.625 7 15.628907226806701 27.33183295823956 39.709927481870466 17.329332333083272 8 16.975 27.125 32.275 23.625 9 16.975 24.425 36.075 22.525000000000002 10-14 19.605 30.15 27.765 22.48 15-19 19.265 28.21 28.07 24.455 20-24 19.314999999999998 29.205 27.935 23.544999999999998 25-29 19.73 29.099999999999998 27.615000000000002 23.555 30-34 19.665 29.04 27.860000000000003 23.435 35-39 19.52 28.73 28.470000000000002 23.28 40-44 19.73 28.92 28.215 23.135 45-49 19.85 29.005 27.395000000000003 23.75 50-54 20.015 28.655 27.815 23.515 55-59 19.61 28.625 28.365000000000002 23.400000000000002 60-64 19.55 28.27 28.23 23.95 65-69 19.220000000000002 29.445 28.050000000000004 23.285 70-74 20.41 28.749999999999996 27.79 23.05 75-79 19.86 28.76 27.925 23.455000000000002 80-84 20.1 29.04 27.365000000000002 23.494999999999997 85-89 20.335 28.615000000000002 27.755000000000003 23.294999999999998 90-94 20.515 28.910000000000004 27.43 23.145 95-99 20.635 28.79 27.165 23.41 100-104 20.73 28.84 26.695 23.735 105-109 20.115 29.49 27.04 23.355 110-114 21.105 28.854999999999997 26.529999999999998 23.51 115-119 20.755000000000003 29.09 26.605 23.549999999999997 120-124 20.87 28.610000000000003 26.83 23.69 125-129 20.505000000000003 29.220000000000002 26.369999999999997 23.905 130-134 21.495 28.18 25.96 24.365000000000002 135-139 20.555 29.104999999999997 26.365 23.974999999999998 140-144 20.97 28.07 26.590000000000003 24.37 145-149 21.67 27.855 26.185000000000002 24.29 150-151 21.6125 28.025 26.787499999999998 23.575 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.5 17 1.0 18 0.0 19 0.5 20 0.5 21 0.5 22 0.5 23 1.5 24 2.5 25 5.0 26 4.5 27 9.5 28 13.0 29 15.0 30 22.5 31 32.0 32 47.5 33 53.5 34 62.5 35 80.0 36 100.5 37 133.0 38 156.5 39 166.5 40 186.0 41 214.5 42 233.0 43 251.5 44 275.0 45 283.5 46 261.0 47 230.0 48 205.5 49 188.5 50 166.0 51 130.0 52 111.0 53 91.5 54 61.5 55 45.0 56 36.5 57 27.5 58 21.5 59 19.5 60 16.0 61 8.5 62 6.5 63 5.5 64 4.0 65 2.0 66 1.5 67 1.0 68 0.5 69 1.5 70 1.5 71 1.0 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.025 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.0 #Duplication Level Percentage of deduplicated Percentage of total 1 98.01020408163265 96.05 2 1.9387755102040816 3.8 3 0.05102040816326531 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.037500000000000006 0.0 0.0 0.0 0.0 60-61 0.1125 0.0 0.0 0.0 0.0 62-63 0.125 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.15 0.0 0.0 0.0 0.0 68-69 0.225 0.0 0.0 0.0 0.0 70-71 0.25 0.0 0.0 0.0 0.0 72-73 0.32499999999999996 0.0 0.0 0.0 0.0 74-75 0.55 0.0 0.0 0.0 0.0 76-77 0.75 0.0 0.0 0.0 0.0 78-79 0.9125 0.0 0.0 0.0 0.0 80-81 1.0625 0.0 0.0 0.0 0.0 82-83 1.2125 0.0 0.0 0.0 0.0 84-85 1.4625 0.0 0.0 0.0 0.0 86-87 1.9125 0.0 0.0 0.0 0.0 88-89 2.1125 0.0 0.0 0.0 0.0 90-91 2.4875 0.0 0.0 0.0 0.0 92-93 2.9125 0.0 0.0 0.0 0.0 94-95 3.6 0.0 0.0 0.0 0.0 96-97 3.9375 0.0 0.0 0.0 0.0 98-99 4.3 0.0 0.0 0.0 0.0 100-101 4.762499999999999 0.0 0.0 0.0 0.0 102-103 5.325 0.0 0.0 0.0 0.0 104-105 6.0375 0.0 0.0 0.0 0.0 106-107 6.75 0.0 0.0 0.0 0.0 108-109 7.5375 0.0 0.0 0.0 0.0 110-111 8.2625 0.0 0.0 0.0 0.0 112-113 8.837499999999999 0.0 0.0 0.0 0.0 114-115 9.575 0.0 0.0 0.0 0.0 116-117 10.5 0.0 0.0 0.0 0.0 118-119 11.5 0.0 0.0 0.0 0.0 120-121 12.5 0.0 0.0 0.0 0.0 122-123 13.5875 0.0 0.0 0.0 0.0 124-125 14.6125 0.0 0.0 0.0 0.0 126-127 15.4 0.0 0.0 0.0 0.0 128-129 16.424999999999997 0.0 0.0 0.0 0.0 130-131 17.7 0.0 0.0 0.0 0.0 132-133 18.5375 0.0 0.0 0.0 0.0 134-135 19.5125 0.0 0.0 0.0 0.0 136-137 20.2 0.0 0.0 0.0 0.0 138-139 20.775 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCCTCAA 10 0.006830828 145.0 1 GCTTTCT 10 0.006830828 145.0 1 >>END_MODULE SRR28623282 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623282_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.32425 37.0 37.0 37.0 37.0 37.0 2 36.535 37.0 37.0 37.0 37.0 37.0 3 36.5545 37.0 37.0 37.0 37.0 37.0 4 36.4945 37.0 37.0 37.0 37.0 37.0 5 36.4565 37.0 37.0 37.0 37.0 37.0 6 36.4495 37.0 37.0 37.0 37.0 37.0 7 36.5645 37.0 37.0 37.0 37.0 37.0 8 36.493 37.0 37.0 37.0 37.0 37.0 9 36.526 37.0 37.0 37.0 37.0 37.0 10-14 36.458099999999995 37.0 37.0 37.0 37.0 37.0 15-19 36.4481 37.0 37.0 37.0 37.0 37.0 20-24 36.451800000000006 37.0 37.0 37.0 37.0 37.0 25-29 36.3902 37.0 37.0 37.0 37.0 37.0 30-34 36.3507 37.0 37.0 37.0 37.0 37.0 35-39 36.2937 37.0 37.0 37.0 37.0 37.0 40-44 36.3084 37.0 37.0 37.0 37.0 37.0 45-49 36.3132 37.0 37.0 37.0 37.0 37.0 50-54 36.2548 37.0 37.0 37.0 37.0 37.0 55-59 36.2445 37.0 37.0 37.0 37.0 37.0 60-64 36.223800000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.1639 37.0 37.0 37.0 37.0 37.0 70-74 36.1147 37.0 37.0 37.0 37.0 37.0 75-79 36.1301 37.0 37.0 37.0 37.0 37.0 80-84 36.0696 37.0 37.0 37.0 37.0 37.0 85-89 35.989999999999995 37.0 37.0 37.0 37.0 37.0 90-94 35.9658 37.0 37.0 37.0 37.0 37.0 95-99 35.911199999999994 37.0 37.0 37.0 37.0 37.0 100-104 35.7915 37.0 37.0 37.0 37.0 37.0 105-109 35.7829 37.0 37.0 37.0 37.0 37.0 110-114 35.68580000000001 37.0 37.0 37.0 37.0 37.0 115-119 35.583600000000004 37.0 37.0 37.0 37.0 37.0 120-124 35.4948 37.0 37.0 37.0 37.0 37.0 125-129 35.4572 37.0 37.0 37.0 37.0 37.0 130-134 35.3997 37.0 37.0 37.0 34.6 37.0 135-139 35.230399999999996 37.0 37.0 37.0 29.8 37.0 140-144 35.1926 37.0 37.0 37.0 29.8 37.0 145-149 34.8865 37.0 37.0 37.0 25.0 37.0 150-151 34.597750000000005 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 5.0 15 0.0 16 1.0 17 1.0 18 1.0 19 0.0 20 1.0 21 1.0 22 5.0 23 3.0 24 8.0 25 6.0 26 9.0 27 6.0 28 10.0 29 19.0 30 23.0 31 32.0 32 50.0 33 104.0 34 178.0 35 551.0 36 2726.0 37 259.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.82912184138104 19.389542156617463 12.83462596947711 28.946710032524393 2 24.975 27.450000000000003 32.425 15.15 3 20.45 28.7 30.8 20.05 4 23.875 33.725 23.875 18.525 5 25.85 35.525 23.9 14.725 6 20.575 38.95 23.575 16.900000000000002 7 20.849999999999998 23.125 37.8 18.224999999999998 8 21.5 26.450000000000003 28.725 23.325000000000003 9 21.175 25.025 31.8 22.0 10-14 23.585 29.49 26.424999999999997 20.5 15-19 23.04 28.76 28.21 19.99 20-24 22.975 28.605000000000004 27.150000000000002 21.27 25-29 22.900000000000002 28.560000000000002 27.925 20.615 30-34 23.625 28.63 27.63 20.115 35-39 23.235 29.080000000000002 27.105 20.580000000000002 40-44 22.67 28.325 28.83 20.175 45-49 23.625 28.58 27.525 20.27 50-54 23.244999999999997 28.815 28.155 19.785 55-59 23.785 27.589999999999996 28.74 19.885 60-64 22.5 28.939999999999998 28.310000000000002 20.25 65-69 23.365 28.384999999999998 28.04 20.21 70-74 23.69 28.365000000000002 27.985 19.96 75-79 23.665 28.54 27.785 20.01 80-84 23.549999999999997 28.82 27.700000000000003 19.93 85-89 24.015 28.535 27.73 19.72 90-94 23.919999999999998 28.62 27.91 19.55 95-99 24.55 28.144999999999996 27.42 19.885 100-104 24.55 28.754999999999995 27.515 19.18 105-109 25.145 28.084999999999997 27.544999999999998 19.225 110-114 25.21 28.744999999999997 27.150000000000002 18.895 115-119 25.155 29.470000000000002 26.46 18.915000000000003 120-124 26.045 28.615000000000002 26.465 18.875 125-129 26.72 28.455000000000002 26.32 18.505 130-134 26.765 28.38 26.195 18.66 135-139 27.400000000000002 28.205000000000002 26.540000000000003 17.854999999999997 140-144 27.1 28.48 26.334999999999997 18.085 145-149 27.505000000000003 28.275 26.31 17.91 150-151 28.249999999999996 28.3625 26.687499999999996 16.7 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 1.0 6 1.0 7 0.0 8 0.0 9 1.0 10 1.0 11 0.5 12 1.0 13 1.5 14 1.5 15 0.5 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 1.0 23 2.5 24 2.5 25 3.0 26 5.0 27 5.0 28 12.0 29 16.5 30 16.5 31 24.5 32 32.0 33 39.0 34 53.0 35 72.5 36 95.0 37 121.5 38 158.0 39 198.0 40 220.5 41 230.5 42 242.5 43 253.0 44 275.5 45 284.0 46 267.5 47 248.5 48 212.5 49 184.0 50 158.0 51 123.5 52 104.5 53 78.0 54 58.0 55 49.5 56 39.0 57 28.0 58 12.5 59 12.0 60 15.0 61 12.0 62 6.5 63 3.0 64 2.0 65 1.0 66 1.0 67 2.0 68 2.0 69 1.0 70 1.0 71 1.0 72 0.5 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.5 95 0.5 96 0.0 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.7 #Duplication Level Percentage of deduplicated Percentage of total 1 97.85056294779939 95.6 2 1.9959058341862845 3.9 3 0.1023541453428864 0.3 4 0.0511770726714432 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.037500000000000006 0.0 0.0 0.0 0.0 60-61 0.1125 0.0 0.0 0.0 0.0 62-63 0.125 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.15 0.0 0.0 0.0 0.0 68-69 0.225 0.0 0.0 0.0 0.0 70-71 0.25 0.0 0.0 0.0 0.0 72-73 0.32499999999999996 0.0 0.0 0.0 0.0 74-75 0.5625 0.0 0.0 0.0 0.0 76-77 0.7749999999999999 0.0 0.0 0.0 0.0 78-79 0.9375 0.0 0.0 0.0 0.0 80-81 1.0875 0.0 0.0 0.0 0.0 82-83 1.25 0.0 0.0 0.0 0.0 84-85 1.5125000000000002 0.0 0.0 0.0 0.0 86-87 1.9749999999999999 0.0 0.0 0.0 0.0 88-89 2.2 0.0 0.0 0.0 0.0 90-91 2.6125 0.0 0.0 0.0 0.0 92-93 3.0625 0.0 0.0 0.0 0.0 94-95 3.75 0.0 0.0 0.0 0.0 96-97 4.1 0.0 0.0 0.0 0.0 98-99 4.5 0.0 0.0 0.0 0.0 100-101 4.9625 0.0 0.0 0.0 0.0 102-103 5.5875 0.0 0.0 0.0 0.0 104-105 6.324999999999999 0.0 0.0 0.0 0.0 106-107 7.05 0.0 0.0 0.0 0.0 108-109 7.8875 0.0 0.0 0.0 0.0 110-111 8.65 0.0 0.0 0.0 0.0 112-113 9.25 0.0 0.0 0.0 0.0 114-115 9.95 0.0 0.0 0.0 0.0 116-117 10.899999999999999 0.0 0.0 0.0 0.0 118-119 11.912500000000001 0.0 0.0 0.0 0.0 120-121 12.9 0.0 0.0 0.0 0.0 122-123 14.025 0.0 0.0 0.0 0.0 124-125 15.0875 0.0 0.0 0.0 0.0 126-127 15.925 0.0 0.0 0.0 0.0 128-129 17.0625 0.0 0.0 0.0 0.0 130-131 18.425 0.0 0.0 0.0 0.0 132-133 19.275 0.0 0.0 0.0 0.0 134-135 20.299999999999997 0.0 0.0 0.0 0.0 136-137 21.05 0.0 0.0 0.0 0.0 138-139 21.6875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1087132 spots for SRR28623282.sra Written 1087132 spots for SRR28623282.sra Read 1087132 spots for SRR28623282.sra Written 1087132 spots for SRR28623282.sra Read 1087132 spots for SRR28623282.sra Written 1087132 spots for SRR28623282.sra Read 1087132 spots for SRR28623282.sra Written 1087132 spots for SRR28623282.sra Read 1087132 spots for SRR28623282.sra Written 1087132 spots for SRR28623282.sra Read 1087132 spots for SRR28623282.sra Written 1087132 spots for SRR28623282.sra Read 1087132 spots for SRR28623282.sra Written 1087132 spots for SRR28623282.sra Read 1087132 spots for SRR28623282.sra Written 1087132 spots for SRR28623282.sra Read 1087132 spots for SRR28623282.sra Written 1087132 spots for SRR28623282.sra Read 1087132 spots for SRR28623282.sra Written 1087132 spots for SRR28623282.sra Read 1087132 spots for SRR28623282.sra Written 1087132 spots for SRR28623282.sra Read 1087151 spots for SRR28623282.sra Written 1087151 spots for SRR28623282.sra Read 1087132 spots for SRR28623282.sra Written 1087132 spots for SRR28623282.sra Read 1087132 spots for SRR28623282.sra Written 1087132 spots for SRR28623282.sra Read 1087132 spots for SRR28623282.sra Written 1087132 spots for SRR28623282.sra Read 1087132 spots for SRR28623282.sra Written 1087132 spots for SRR28623282.sra Read 1087132 spots for SRR28623282.sra Written 1087132 spots for SRR28623282.sra Read 1087132 spots for SRR28623282.sra Written 1087132 spots for SRR28623282.sra Read 1087132 spots for SRR28623282.sra Written 1087132 spots for SRR28623282.sra Read 1087132 spots for SRR28623282.sra Written 1087132 spots for SRR28623282.sra SRR ids: ['SRR28623282.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_55iccpw4 SRR28623282.sra spots: 21742659 blocks: [[1, 1087132], [1087133, 2174264], [2174265, 3261396], [3261397, 4348528], [4348529, 5435660], [5435661, 6522792], [6522793, 7609924], [7609925, 8697056], [8697057, 9784188], [9784189, 10871320], [10871321, 11958452], [11958453, 13045584], [13045585, 14132716], [14132717, 15219848], [15219849, 16306980], [16306981, 17394112], [17394113, 18481244], [18481245, 19568376], [19568377, 20655508], [20655509, 21742659]] SRR28623282 file size 8025005 SRR28623282 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR28623282 SRR28623282_1.fastq SRR28623282_2.fastq Input file: SRR28623282_1.fastq Paired file: SRR28623282_2.fastq trimmed: SRR28623282-trimmed-pair1.fastq, SRR28623282-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 14:14:12 2025 >> started Tue Feb 11 14:14:41 2025 >> done (29.151s) 21742659 read pairs processed; of these: 46 ( 0.00%) short read pairs filtered out after trimming by size control 12133 ( 0.06%) empty read pairs filtered out after trimming by size control 21730480 (99.94%) read pairs available; of these: 6186849 (28.47%) trimmed read pairs available after processing 15543631 (71.53%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 2 0.00% 20 6 0.00% 21 3 0.00% 22 2 0.00% 23 2 0.00% 24 7 0.00% 25 11 0.00% 26 2 0.00% 27 6 0.00% 28 7 0.00% 29 13 0.00% 30 10 0.00% 31 12 0.00% 32 7 0.00% 33 16 0.00% 34 22 0.00% 35 36 0.00% 36 33 0.00% 37 51 0.00% 38 46 0.00% 39 79 0.00% 40 98 0.00% 41 105 0.00% 42 151 0.00% 43 148 0.00% 44 196 0.00% 45 230 0.00% 46 273 0.00% 47 311 0.00% 48 346 0.00% 49 442 0.00% 50 525 0.00% 51 626 0.00% 52 757 0.00% 53 809 0.00% 54 927 0.00% 55 1113 0.01% 56 1284 0.01% 57 1513 0.01% 58 1764 0.01% 59 2098 0.01% 60 2449 0.01% 61 2883 0.01% 62 3300 0.02% 63 3851 0.02% 64 4458 0.02% 65 5045 0.02% 66 5715 0.03% 67 6453 0.03% 68 7174 0.03% 69 8358 0.04% 70 9534 0.04% 71 10803 0.05% 72 12145 0.06% 73 13738 0.06% 74 15293 0.07% 75 17070 0.08% 76 19103 0.09% 77 20589 0.09% 78 22429 0.10% 79 24437 0.11% 80 26311 0.12% 81 28683 0.13% 82 31162 0.14% 83 33503 0.15% 84 35806 0.16% 85 38788 0.18% 86 40678 0.19% 87 42480 0.20% 88 45159 0.21% 89 47136 0.22% 90 49139 0.23% 91 51243 0.24% 92 52744 0.24% 93 55486 0.26% 94 58377 0.27% 95 61235 0.28% 96 63126 0.29% 97 65554 0.30% 98 66404 0.31% 99 68753 0.32% 100 70365 0.32% 101 71432 0.33% 102 73571 0.34% 103 75947 0.35% 104 76521 0.35% 105 78781 0.36% 106 81358 0.37% 107 83003 0.38% 108 84181 0.39% 109 84863 0.39% 110 86143 0.40% 111 87071 0.40% 112 88528 0.41% 113 89747 0.41% 114 91378 0.42% 115 92841 0.43% 116 93584 0.43% 117 95270 0.44% 118 97278 0.45% 119 97648 0.45% 120 98287 0.45% 121 100046 0.46% 122 99288 0.46% 123 100345 0.46% 124 102066 0.47% 125 101762 0.47% 126 103585 0.48% 127 104554 0.48% 128 104803 0.48% 129 105580 0.49% 130 106488 0.49% 131 106472 0.49% 132 107020 0.49% 133 107256 0.49% 134 107252 0.49% 135 108043 0.50% 136 107343 0.49% 137 107262 0.49% 138 108453 0.50% 139 108842 0.50% 140 108773 0.50% 141 109596 0.50% 142 109855 0.51% 143 109117 0.50% 144 109642 0.50% 145 109305 0.50% 146 108936 0.50% 147 108707 0.50% 148 110095 0.51% 149 108573 0.50% 150 109310 0.50% 151 15543631 71.53% 21730480 reads passed initial QC criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=42 prefix-density=0.10 prefix-fanout=2.0 sequence=TGCGACATGGTTGGCAAGAATCCTTCTGCGAATTTAGCAACAACCGAAGAATCAAGATACTCCTGCAAGCCCTCCAGATCATCAAAGGTAGTTTCAAAAGCATGAGTATATCCGAAATTGAGGTCGTGAATACCCAGATTAGTGCCCCAGTGTAAGCTCTTCAAGGGTTCAACTTGATTGACCAGATGAGTGAAGTCGTTTATGATTTTCTCAATTT criterion=fanout-score sequence-density=0.06 sequence-density-rank=21 fanout-score=456.24 fanout-score-rank=1 prefix-density=0.89 prefix-fanout=33.3 sequence=TTCTTCTTCTTT criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=14.59 fanout-score-rank=21 prefix-density=0.14 prefix-fanout=14.6 sequence=GAGAGAGAGAGTTAAGACAATGGCCTCGAAGAAATCTGCAATCGTATTACCTGGTTCAAAGGTGTTGAAGCACATAGTTTTTGTACGGTTTAATGATGGGATCACTGATGAACAAATTGAGAA criterion=fanout-score sequence-density=0.08 sequence-density-rank=6 fanout-score=358.44 fanout-score-rank=1 prefix-density=1.00 prefix-fanout=30.3 sequence=AAGAAGAAGAAA SRR28623282 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 14:15:30 Started mapping on | Feb 11 14:15:31 Finished on | Feb 11 14:18:08 Mapping speed, Million of reads per hour | 498.28 Number of input reads | 21730480 Average input read length | 283 UNIQUE READS: Uniquely mapped reads number | 20553359 Uniquely mapped reads % | 94.58% Average mapped length | 282.46 Number of splices: Total | 17958951 Number of splices: Annotated (sjdb) | 17523744 Number of splices: GT/AG | 17638472 Number of splices: GC/AG | 247229 Number of splices: AT/AC | 18161 Number of splices: Non-canonical | 55089 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.97 Insertion rate per base | 0.03% Insertion average length | 2.34 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 556022 % of reads mapped to multiple loci | 2.56% Number of reads mapped to too many loci | 177255 % of reads mapped to too many loci | 0.82% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.84% % of reads unmapped: other | 0.20% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 621099 621099 621099 N_multimapping 556022 556022 556022 N_noFeature 906104 20281236 1055529 N_ambiguous 227762 1609 104065 UnstrandedReadsAssigned:19419493 PositiveStrandReadsAssigned:270514 NegativeStrandReadsAssigned:19393765 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=133 echo kmer=129 SRR28623282 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR28623282-trimmed-pair1.fastq SRR28623282-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,730,480 reads, 19,615,350 reads pseudoaligned [quant] estimated average fragment length: 197.096 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,094 rounds 52401 SRR28623282.ke.tsv 34699 SRR28623282.se.tsv 87100 total ==> SRR28623282.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1821.9 1045 29.3955 Potri.005G024800.1.v4.1 1035 838.904 591 36.1049 Potri.004G059700.1.v4.1 961 764.904 241 16.1473 Potri.007G009000.2.v4.1 1416 1219.9 0 0 Potri.003G141000.2.v4.1 2943 2746.9 599.391 11.183 Potri.016G087400.1.v4.1 270 109.121 1648.53 774.251 Potri.015G069301.1.v4.1 564 371.013 0 0 Potri.010G195200.1.v4.1 1773 1576.9 23 0.747504 Potri.012G127500.1.v4.1 977 780.904 10404 682.8 ==> SRR28623282.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2302 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 450 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 15 Potri.001G452600.v4.1 5 SRR28623282 completed mapping pipeline successfully