Starting /dee2/code/volunteer_pipeline.sh SRR28623283 current disk space = 3050100355072 free memory = 1146576260 SRR28623283 SRAfilesize 24b4ffb1911d064ade71d949b3937fec SRR28623283.sra SRR28623283.sra file validated SRR28623283 is paired end SRR28623283 is conventional basespace SRR28623283 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623283_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.02675 37.0 37.0 37.0 37.0 37.0 2 36.3815 37.0 37.0 37.0 37.0 37.0 3 36.3795 37.0 37.0 37.0 37.0 37.0 4 36.5035 37.0 37.0 37.0 37.0 37.0 5 36.6255 37.0 37.0 37.0 37.0 37.0 6 36.628 37.0 37.0 37.0 37.0 37.0 7 36.6025 37.0 37.0 37.0 37.0 37.0 8 36.5595 37.0 37.0 37.0 37.0 37.0 9 36.573 37.0 37.0 37.0 37.0 37.0 10-14 36.6502 37.0 37.0 37.0 37.0 37.0 15-19 36.5807 37.0 37.0 37.0 37.0 37.0 20-24 36.5799 37.0 37.0 37.0 37.0 37.0 25-29 36.49849999999999 37.0 37.0 37.0 37.0 37.0 30-34 36.421299999999995 37.0 37.0 37.0 37.0 37.0 35-39 36.382099999999994 37.0 37.0 37.0 37.0 37.0 40-44 36.3754 37.0 37.0 37.0 37.0 37.0 45-49 36.341300000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.295 37.0 37.0 37.0 37.0 37.0 55-59 36.2634 37.0 37.0 37.0 37.0 37.0 60-64 36.2441 37.0 37.0 37.0 37.0 37.0 65-69 36.1282 37.0 37.0 37.0 37.0 37.0 70-74 36.131299999999996 37.0 37.0 37.0 37.0 37.0 75-79 36.073699999999995 37.0 37.0 37.0 37.0 37.0 80-84 36.0861 37.0 37.0 37.0 37.0 37.0 85-89 35.97429999999999 37.0 37.0 37.0 37.0 37.0 90-94 36.0173 37.0 37.0 37.0 37.0 37.0 95-99 35.80839999999999 37.0 37.0 37.0 37.0 37.0 100-104 35.8909 37.0 37.0 37.0 37.0 37.0 105-109 35.7986 37.0 37.0 37.0 37.0 37.0 110-114 35.6897 37.0 37.0 37.0 37.0 37.0 115-119 35.728300000000004 37.0 37.0 37.0 37.0 37.0 120-124 35.6442 37.0 37.0 37.0 37.0 37.0 125-129 35.5106 37.0 37.0 37.0 37.0 37.0 130-134 35.2526 37.0 37.0 37.0 29.8 37.0 135-139 35.099399999999996 37.0 37.0 37.0 29.8 37.0 140-144 34.860299999999995 37.0 37.0 37.0 25.0 37.0 145-149 34.6076 37.0 37.0 37.0 25.0 37.0 150-151 33.759249999999994 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 2.0 23 1.0 24 4.0 25 9.0 26 10.0 27 14.0 28 18.0 29 21.0 30 39.0 31 59.0 32 67.0 33 116.0 34 165.0 35 411.0 36 2903.0 37 160.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.21026282853567 14.493116395494368 9.16145181476846 48.1351689612015 2 17.4 14.95 41.475 26.174999999999997 3 18.05 18.075 26.8 37.075 4 21.875 25.85 24.025 28.249999999999996 5 23.974999999999998 31.574999999999996 25.0 19.45 6 20.150000000000002 35.025 24.175 20.65 7 16.1 28.15 39.425 16.325 8 17.95 27.400000000000002 32.175 22.475 9 17.375 22.375 36.55 23.7 10-14 19.555 30.154999999999998 27.52 22.770000000000003 15-19 19.82 28.854999999999997 27.465 23.86 20-24 20.080000000000002 28.439999999999998 27.925 23.555 25-29 19.814999999999998 29.735 27.555000000000003 22.895 30-34 20.13 28.625 27.639999999999997 23.605 35-39 19.695 28.415000000000003 27.485 24.404999999999998 40-44 19.415 29.630000000000003 27.224999999999998 23.73 45-49 19.855 29.085 27.3 23.76 50-54 20.565 28.884999999999998 27.224999999999998 23.325000000000003 55-59 19.8 29.23 27.525 23.445 60-64 19.765 29.154999999999998 27.22 23.86 65-69 20.599999999999998 28.549999999999997 27.43 23.419999999999998 70-74 20.685000000000002 28.12 27.134999999999998 24.060000000000002 75-79 20.47 28.235 28.144999999999996 23.150000000000002 80-84 20.79 28.749999999999996 27.295 23.165 85-89 20.474999999999998 28.71 27.195000000000004 23.62 90-94 20.01 28.395 27.779999999999998 23.815 95-99 21.355 28.64 26.950000000000003 23.055 100-104 20.94 28.555000000000003 27.500000000000004 23.005 105-109 20.560000000000002 29.085 26.6 23.755000000000003 110-114 21.085 28.970000000000002 26.545 23.400000000000002 115-119 20.549999999999997 28.815 26.615 24.02 120-124 21.255 29.115000000000002 25.595000000000002 24.035 125-129 21.38 29.125 25.580000000000002 23.915 130-134 21.560000000000002 28.939999999999998 25.165 24.335 135-139 22.015 27.694999999999997 26.35 23.94 140-144 21.78 28.455000000000002 25.71 24.055 145-149 21.884999999999998 27.310000000000002 26.584999999999997 24.22 150-151 20.974999999999998 28.375 26.525 24.125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 1.0 2 1.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.5 17 1.0 18 1.0 19 1.5 20 1.5 21 1.0 22 2.5 23 3.5 24 3.0 25 6.0 26 7.0 27 8.5 28 14.5 29 18.0 30 24.5 31 33.5 32 37.0 33 48.0 34 72.0 35 88.5 36 98.5 37 121.0 38 141.0 39 159.0 40 176.5 41 191.0 42 208.5 43 215.0 44 247.0 45 264.5 46 244.0 47 234.5 48 235.5 49 210.5 50 168.5 51 148.5 52 116.0 53 90.5 54 84.0 55 61.0 56 42.5 57 39.0 58 33.0 59 29.0 60 26.5 61 16.5 62 9.0 63 7.0 64 3.5 65 1.0 66 0.0 67 0.0 68 0.0 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 97.05730511099638 94.0 2 2.684563758389262 5.2 3 0.20650490449148168 0.6 4 0.05162622612287042 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.1375 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.2 0.0 0.0 0.0 0.0 74-75 0.25 0.0 0.0 0.0 0.0 76-77 0.375 0.0 0.0 0.0 0.0 78-79 0.44999999999999996 0.0 0.0 0.0 0.0 80-81 0.55 0.0 0.0 0.0 0.0 82-83 0.75 0.0 0.0 0.0 0.0 84-85 0.8875 0.0 0.0 0.0 0.0 86-87 1.1875 0.0 0.0 0.0 0.0 88-89 1.4625 0.0 0.0 0.0 0.0 90-91 1.6625 0.0 0.0 0.0 0.0 92-93 2.0875000000000004 0.0 0.0 0.0 0.0 94-95 2.5625 0.0 0.0 0.0 0.0 96-97 2.9749999999999996 0.0 0.0 0.0 0.0 98-99 3.3499999999999996 0.0 0.0 0.0 0.0 100-101 3.9124999999999996 0.0 0.0 0.0 0.0 102-103 4.5 0.0 0.0 0.0 0.0 104-105 5.2875 0.0 0.0 0.0 0.0 106-107 5.824999999999999 0.0 0.0 0.0 0.0 108-109 6.5125 0.0 0.0 0.0 0.0 110-111 7.3375 0.0 0.0 0.0 0.0 112-113 8.1875 0.0 0.0 0.0 0.0 114-115 9.05 0.0 0.0 0.0 0.0 116-117 9.925 0.0 0.0 0.0 0.0 118-119 10.9 0.0 0.0 0.0 0.0 120-121 12.1375 0.0 0.0 0.0 0.0 122-123 12.9375 0.0 0.0 0.0 0.0 124-125 13.662500000000001 0.0 0.0 0.0 0.0 126-127 14.45 0.0 0.0 0.0 0.0 128-129 15.45 0.0 0.0 0.0 0.0 130-131 16.450000000000003 0.0 0.0 0.0 0.0 132-133 17.3875 0.0 0.0 0.0 0.0 134-135 18.3 0.0 0.0 0.0 0.0 136-137 19.2 0.0 0.0 0.0 0.0 138-139 20.0125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTTTT 55 0.0025160722 15.818182 35-39 >>END_MODULE SRR28623283 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623283_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.079 37.0 37.0 37.0 37.0 37.0 2 36.466 37.0 37.0 37.0 37.0 37.0 3 36.5405 37.0 37.0 37.0 37.0 37.0 4 36.4635 37.0 37.0 37.0 37.0 37.0 5 36.4055 37.0 37.0 37.0 37.0 37.0 6 36.423 37.0 37.0 37.0 37.0 37.0 7 36.412 37.0 37.0 37.0 37.0 37.0 8 36.4665 37.0 37.0 37.0 37.0 37.0 9 36.5155 37.0 37.0 37.0 37.0 37.0 10-14 36.432199999999995 37.0 37.0 37.0 37.0 37.0 15-19 36.3892 37.0 37.0 37.0 37.0 37.0 20-24 36.376799999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.3544 37.0 37.0 37.0 37.0 37.0 30-34 36.29789999999999 37.0 37.0 37.0 37.0 37.0 35-39 36.2189 37.0 37.0 37.0 37.0 37.0 40-44 36.2442 37.0 37.0 37.0 37.0 37.0 45-49 36.211400000000005 37.0 37.0 37.0 37.0 37.0 50-54 36.1558 37.0 37.0 37.0 37.0 37.0 55-59 36.0943 37.0 37.0 37.0 37.0 37.0 60-64 36.08560000000001 37.0 37.0 37.0 37.0 37.0 65-69 35.9654 37.0 37.0 37.0 37.0 37.0 70-74 35.928 37.0 37.0 37.0 37.0 37.0 75-79 35.97939999999999 37.0 37.0 37.0 37.0 37.0 80-84 35.9739 37.0 37.0 37.0 37.0 37.0 85-89 35.8247 37.0 37.0 37.0 37.0 37.0 90-94 35.7493 37.0 37.0 37.0 37.0 37.0 95-99 35.743700000000004 37.0 37.0 37.0 37.0 37.0 100-104 35.5938 37.0 37.0 37.0 37.0 37.0 105-109 35.5663 37.0 37.0 37.0 37.0 37.0 110-114 35.50580000000001 37.0 37.0 37.0 37.0 37.0 115-119 35.375 37.0 37.0 37.0 34.6 37.0 120-124 35.2816 37.0 37.0 37.0 27.4 37.0 125-129 35.2256 37.0 37.0 37.0 25.0 37.0 130-134 35.1362 37.0 37.0 37.0 25.0 37.0 135-139 34.936600000000006 37.0 37.0 37.0 25.0 37.0 140-144 35.0826 37.0 37.0 37.0 25.0 37.0 145-149 34.6563 37.0 37.0 37.0 25.0 37.0 150-151 34.24325 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 1.0 14 0.0 15 0.0 16 1.0 17 0.0 18 5.0 19 0.0 20 0.0 21 2.0 22 4.0 23 2.0 24 8.0 25 9.0 26 11.0 27 14.0 28 25.0 29 17.0 30 28.0 31 49.0 32 56.0 33 111.0 34 232.0 35 626.0 36 2607.0 37 191.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 31.45 22.325 12.5 33.725 2 25.874999999999996 26.05 31.75 16.325 3 20.0 28.449999999999996 31.674999999999997 19.875 4 21.95 33.75 24.5 19.8 5 26.0 35.099999999999994 22.025 16.875 6 19.425 40.0 21.9 18.675 7 20.674999999999997 20.9 38.574999999999996 19.85 8 20.349999999999998 26.650000000000002 27.950000000000003 25.05 9 21.85 24.875 29.925 23.35 10-14 23.625 29.225 26.345000000000002 20.805 15-19 22.79 28.365000000000002 27.735 21.11 20-24 23.05 28.525 27.265 21.16 25-29 22.715 27.815 28.02 21.45 30-34 23.294999999999998 28.235 27.694999999999997 20.775 35-39 23.26 28.095 27.560000000000002 21.085 40-44 23.395 27.950000000000003 27.91 20.745 45-49 23.11 27.794999999999998 28.139999999999997 20.955 50-54 23.5 27.325 28.144999999999996 21.029999999999998 55-59 23.135 27.655 28.59 20.62 60-64 23.29 26.855 28.615000000000002 21.240000000000002 65-69 23.695 27.689999999999998 27.97 20.645 70-74 23.22 27.365000000000002 28.67 20.745 75-79 22.759999999999998 28.215 28.105000000000004 20.919999999999998 80-84 23.73 27.71 27.505000000000003 21.055 85-89 23.625 27.97 27.889999999999997 20.515 90-94 23.445 27.76 27.98 20.815 95-99 23.549999999999997 28.055000000000003 27.85 20.544999999999998 100-104 23.915 28.15 27.49 20.445 105-109 24.425 27.994999999999997 27.450000000000003 20.13 110-114 25.130000000000003 28.345 26.735 19.79 115-119 24.98 27.97 27.015 20.035 120-124 25.655 28.345 26.955000000000002 19.045 125-129 27.025 28.1 26.174999999999997 18.7 130-134 27.205000000000002 28.21 26.105 18.48 135-139 27.41 27.800000000000004 26.369999999999997 18.42 140-144 27.66 27.97 26.22 18.15 145-149 28.465 27.060000000000002 26.55 17.925 150-151 28.375 27.375 26.4125 17.837500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.5 7 0.5 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.5 20 1.0 21 1.0 22 1.5 23 3.0 24 3.5 25 5.0 26 4.5 27 5.5 28 10.5 29 8.5 30 11.0 31 22.0 32 31.0 33 43.5 34 51.5 35 58.0 36 78.0 37 113.0 38 143.5 39 161.0 40 191.5 41 241.5 42 252.5 43 242.0 44 251.5 45 263.0 46 263.5 47 248.5 48 237.0 49 207.5 50 176.5 51 143.0 52 106.5 53 89.0 54 79.5 55 64.0 56 37.0 57 27.0 58 30.0 59 26.5 60 20.0 61 13.5 62 10.0 63 5.0 64 1.5 65 2.0 66 0.5 67 1.0 68 2.5 69 2.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.875 #Duplication Level Percentage of deduplicated Percentage of total 1 97.03225806451613 94.0 2 2.761290322580645 5.35 3 0.15483870967741936 0.44999999999999996 4 0.05161290322580645 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.0875 0.0 0.0 0.0 0.0 68-69 0.16249999999999998 0.0 0.0 0.0 0.0 70-71 0.175 0.0 0.0 0.0 0.0 72-73 0.225 0.0 0.0 0.0 0.0 74-75 0.275 0.0 0.0 0.0 0.0 76-77 0.4 0.0 0.0 0.0 0.0 78-79 0.475 0.0 0.0 0.0 0.0 80-81 0.575 0.0 0.0 0.0 0.0 82-83 0.75 0.0 0.0 0.0 0.0 84-85 0.8875 0.0 0.0 0.0 0.0 86-87 1.1875 0.0 0.0 0.0 0.0 88-89 1.475 0.0 0.0 0.0 0.0 90-91 1.6625 0.0 0.0 0.0 0.0 92-93 2.0875000000000004 0.0 0.0 0.0 0.0 94-95 2.5374999999999996 0.0 0.0 0.0 0.0 96-97 2.9749999999999996 0.0 0.0 0.0 0.0 98-99 3.3625 0.0 0.0 0.0 0.0 100-101 3.925 0.0 0.0 0.0 0.0 102-103 4.5375 0.0 0.0 0.0 0.0 104-105 5.324999999999999 0.0 0.0 0.0 0.0 106-107 5.85 0.0 0.0 0.0 0.0 108-109 6.5625 0.0 0.0 0.0 0.0 110-111 7.3875 0.0 0.0 0.0 0.0 112-113 8.2375 0.0 0.0 0.0 0.0 114-115 9.1 0.0 0.0 0.0 0.0 116-117 10.05 0.0 0.0 0.0 0.0 118-119 11.0625 0.0 0.0 0.0 0.0 120-121 12.3625 0.0 0.0 0.0 0.0 122-123 13.1875 0.0 0.0 0.0 0.0 124-125 13.95 0.0 0.0 0.0 0.0 126-127 14.75 0.0 0.0 0.0 0.0 128-129 15.712499999999999 0.0 0.0 0.0 0.0 130-131 16.7125 0.0 0.0 0.0 0.0 132-133 17.625 0.0 0.0 0.0 0.0 134-135 18.512500000000003 0.0 0.0 0.0 0.0 136-137 19.4375 0.0 0.0 0.0 0.0 138-139 20.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 592513 spots for SRR28623283.sra Written 592513 spots for SRR28623283.sra Read 592513 spots for SRR28623283.sra Written 592513 spots for SRR28623283.sra Read 592513 spots for SRR28623283.sra Written 592513 spots for SRR28623283.sra Read 592513 spots for SRR28623283.sra Written 592513 spots for SRR28623283.sra Read 592513 spots for SRR28623283.sra Written 592513 spots for SRR28623283.sra Read 592513 spots for SRR28623283.sra Written 592513 spots for SRR28623283.sra Read 592513 spots for SRR28623283.sra Written 592513 spots for SRR28623283.sra Read 592513 spots for SRR28623283.sra Written 592513 spots for SRR28623283.sra Read 592513 spots for SRR28623283.sra Written 592513 spots for SRR28623283.sra Read 592513 spots for SRR28623283.sra Written 592513 spots for SRR28623283.sra Read 592513 spots for SRR28623283.sra Written 592513 spots for SRR28623283.sra Read 592513 spots for SRR28623283.sra Written 592513 spots for SRR28623283.sra Read 592513 spots for SRR28623283.sra Written 592513 spots for SRR28623283.sra Read 592513 spots for SRR28623283.sra Written 592513 spots for SRR28623283.sra Read 592521 spots for SRR28623283.sra Written 592521 spots for SRR28623283.sra Read 592513 spots for SRR28623283.sra Written 592513 spots for SRR28623283.sra Read 592513 spots for SRR28623283.sra Written 592513 spots for SRR28623283.sra Read 592513 spots for SRR28623283.sra Written 592513 spots for SRR28623283.sra Read 592513 spots for SRR28623283.sra Written 592513 spots for SRR28623283.sra Read 592513 spots for SRR28623283.sra Written 592513 spots for SRR28623283.sra SRR ids: ['SRR28623283.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_oyfsv_29 SRR28623283.sra spots: 11850268 blocks: [[1, 592513], [592514, 1185026], [1185027, 1777539], [1777540, 2370052], [2370053, 2962565], [2962566, 3555078], [3555079, 4147591], [4147592, 4740104], [4740105, 5332617], [5332618, 5925130], [5925131, 6517643], [6517644, 7110156], [7110157, 7702669], [7702670, 8295182], [8295183, 8887695], [8887696, 9480208], [9480209, 10072721], [10072722, 10665234], [10665235, 11257747], [11257748, 11850268]] SRR28623283 file size 4368838 SRR28623283 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR28623283 SRR28623283_1.fastq SRR28623283_2.fastq Input file: SRR28623283_1.fastq Paired file: SRR28623283_2.fastq trimmed: SRR28623283-trimmed-pair1.fastq, SRR28623283-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 14:09:30 2025 >> started Tue Feb 11 14:09:43 2025 >> done (13.001s) 11850268 read pairs processed; of these: 20 ( 0.00%) short read pairs filtered out after trimming by size control 199 ( 0.00%) empty read pairs filtered out after trimming by size control 11850049 (100.00%) read pairs available; of these: 3218201 (27.16%) trimmed read pairs available after processing 8631848 (72.84%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 20 1 0.00% 21 1 0.00% 22 1 0.00% 23 3 0.00% 24 1 0.00% 25 3 0.00% 26 2 0.00% 27 3 0.00% 28 1 0.00% 29 2 0.00% 30 5 0.00% 31 8 0.00% 32 8 0.00% 33 7 0.00% 34 12 0.00% 35 9 0.00% 36 4 0.00% 37 7 0.00% 38 13 0.00% 39 12 0.00% 40 12 0.00% 41 23 0.00% 42 27 0.00% 43 24 0.00% 44 36 0.00% 45 25 0.00% 46 35 0.00% 47 44 0.00% 48 62 0.00% 49 103 0.00% 50 129 0.00% 51 126 0.00% 52 140 0.00% 53 169 0.00% 54 165 0.00% 55 186 0.00% 56 201 0.00% 57 292 0.00% 58 327 0.00% 59 368 0.00% 60 466 0.00% 61 573 0.00% 62 689 0.01% 63 831 0.01% 64 928 0.01% 65 1109 0.01% 66 1193 0.01% 67 1339 0.01% 68 1518 0.01% 69 1794 0.02% 70 2085 0.02% 71 2488 0.02% 72 2928 0.02% 73 3315 0.03% 74 3817 0.03% 75 4390 0.04% 76 4927 0.04% 77 5505 0.05% 78 5911 0.05% 79 6774 0.06% 80 7405 0.06% 81 8522 0.07% 82 9741 0.08% 83 10862 0.09% 84 12125 0.10% 85 13285 0.11% 86 14557 0.12% 87 15680 0.13% 88 16597 0.14% 89 18193 0.15% 90 19032 0.16% 91 20717 0.17% 92 21825 0.18% 93 23988 0.20% 94 26141 0.22% 95 28184 0.24% 96 29274 0.25% 97 30610 0.26% 98 31229 0.26% 99 32488 0.27% 100 33546 0.28% 101 34745 0.29% 102 36456 0.31% 103 37913 0.32% 104 39355 0.33% 105 41247 0.35% 106 43280 0.37% 107 44762 0.38% 108 45009 0.38% 109 45931 0.39% 110 45351 0.38% 111 46587 0.39% 112 47574 0.40% 113 48628 0.41% 114 50119 0.42% 115 52309 0.44% 116 53231 0.45% 117 54609 0.46% 118 54948 0.46% 119 54848 0.46% 120 54905 0.46% 121 54763 0.46% 122 55259 0.47% 123 54799 0.46% 124 56684 0.48% 125 57481 0.49% 126 59108 0.50% 127 60330 0.51% 128 60071 0.51% 129 60567 0.51% 130 60567 0.51% 131 59856 0.51% 132 59506 0.50% 133 60059 0.51% 134 59686 0.50% 135 59944 0.51% 136 61346 0.52% 137 61693 0.52% 138 62941 0.53% 139 63197 0.53% 140 62823 0.53% 141 61687 0.52% 142 60792 0.51% 143 61252 0.52% 144 61059 0.52% 145 60441 0.51% 146 61257 0.52% 147 61308 0.52% 148 62901 0.53% 149 63057 0.53% 150 62782 0.53% 151 8631848 72.84% 11850049 reads passed initial QC criterion=sequence-density sequence-density=0.86 sequence-density-rank=1 fanout-score=2.09 fanout-score-rank=14 prefix-density=0.89 prefix-fanout=2.0 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.03 sequence-density-rank=23 fanout-score=49.39 fanout-score-rank=1 prefix-density=0.73 prefix-fanout=2.1 sequence=TGAATGGTGCACATTACGGGTCCATGGCACAAAATCAGAGGATAACAATATCCATTCAAGACTATGCAACAATATAATTTGATTATCCTTAGAAAGTGCTTCTCCTTACACACCCACAAGCCTAGAAAAGGAATTAGAATTTGTAAGTGCAGCTTCCATCATCACTCCTTGCAGTTGGATCAAAGTTTGCTGCATTTGGATCAGTACAGCCTTCAGCGACAGGCACCTTTACTTGCTGTGCCGCTTGGCC criterion=sequence-density sequence-density=0.85 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=17 prefix-density=0.84 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.29 sequence-density-rank=19 fanout-score=9.21 fanout-score-rank=1 prefix-density=0.46 prefix-fanout=5.8 sequence=AACAACAACGCCTGGGCATATGCCACAAACTTCGTTCCCGGAAAGTG SRR28623283 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 14:10:24 Started mapping on | Feb 11 14:10:25 Finished on | Feb 11 14:11:48 Mapping speed, Million of reads per hour | 513.98 Number of input reads | 11850049 Average input read length | 286 UNIQUE READS: Uniquely mapped reads number | 11110425 Uniquely mapped reads % | 93.76% Average mapped length | 284.90 Number of splices: Total | 9305635 Number of splices: Annotated (sjdb) | 9101212 Number of splices: GT/AG | 9108763 Number of splices: GC/AG | 157548 Number of splices: AT/AC | 7475 Number of splices: Non-canonical | 31849 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.67 Insertion rate per base | 0.03% Insertion average length | 2.29 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 294066 % of reads mapped to multiple loci | 2.48% Number of reads mapped to too many loci | 76984 % of reads mapped to too many loci | 0.65% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.97% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 445558 445558 445558 N_multimapping 294066 294066 294066 N_noFeature 414951 10960130 476834 N_ambiguous 155790 567 67045 UnstrandedReadsAssigned:10539684 PositiveStrandReadsAssigned:149728 NegativeStrandReadsAssigned:10566546 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=136 echo kmer=131 SRR28623283 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR28623283-trimmed-pair1.fastq SRR28623283-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,850,049 reads, 10,712,210 reads pseudoaligned [quant] estimated average fragment length: 196.534 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,006 rounds 52401 SRR28623283.ke.tsv 34699 SRR28623283.se.tsv 87100 total ==> SRR28623283.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1822.47 255 13.5507 Potri.005G024800.1.v4.1 1035 839.466 63 7.26803 Potri.004G059700.1.v4.1 961 765.466 45 5.69333 Potri.007G009000.2.v4.1 1416 1220.47 1 0.0793513 Potri.003G141000.2.v4.1 2943 2747.47 226 7.96628 Potri.016G087400.1.v4.1 270 106.213 569.335 519.125 Potri.015G069301.1.v4.1 564 370.383 0 0 Potri.010G195200.1.v4.1 1773 1577.47 0 0 Potri.012G127500.1.v4.1 977 781.466 375 46.473 ==> SRR28623283.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 26 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 142 Potri.001G212900.v4.1 34 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR28623283 completed mapping pipeline successfully