Starting /dee2/code/volunteer_pipeline.sh SRR28623284 current disk space = 3050322882560 free memory = 1421744264 SRR28623284 SRAfilesize 7a71f1e6c5624d3a9f11e2e29a662286 SRR28623284.sra SRR28623284.sra file validated SRR28623284 is paired end SRR28623284 is conventional basespace SRR28623284 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623284_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.46725 37.0 37.0 37.0 37.0 37.0 2 36.464 37.0 37.0 37.0 37.0 37.0 3 36.576 37.0 37.0 37.0 37.0 37.0 4 36.6035 37.0 37.0 37.0 37.0 37.0 5 36.625 37.0 37.0 37.0 37.0 37.0 6 36.596 37.0 37.0 37.0 37.0 37.0 7 36.555 37.0 37.0 37.0 37.0 37.0 8 36.4945 37.0 37.0 37.0 37.0 37.0 9 36.6145 37.0 37.0 37.0 37.0 37.0 10-14 36.6034 37.0 37.0 37.0 37.0 37.0 15-19 36.57939999999999 37.0 37.0 37.0 37.0 37.0 20-24 36.551500000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.4918 37.0 37.0 37.0 37.0 37.0 30-34 36.4762 37.0 37.0 37.0 37.0 37.0 35-39 36.4394 37.0 37.0 37.0 37.0 37.0 40-44 36.4138 37.0 37.0 37.0 37.0 37.0 45-49 36.2957 37.0 37.0 37.0 37.0 37.0 50-54 36.283699999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.2607 37.0 37.0 37.0 37.0 37.0 60-64 36.2685 37.0 37.0 37.0 37.0 37.0 65-69 36.217 37.0 37.0 37.0 37.0 37.0 70-74 36.1962 37.0 37.0 37.0 37.0 37.0 75-79 36.143899999999995 37.0 37.0 37.0 37.0 37.0 80-84 36.115899999999996 37.0 37.0 37.0 37.0 37.0 85-89 36.120999999999995 37.0 37.0 37.0 37.0 37.0 90-94 36.083600000000004 37.0 37.0 37.0 37.0 37.0 95-99 35.891200000000005 37.0 37.0 37.0 37.0 37.0 100-104 35.985699999999994 37.0 37.0 37.0 37.0 37.0 105-109 35.9448 37.0 37.0 37.0 37.0 37.0 110-114 35.8343 37.0 37.0 37.0 37.0 37.0 115-119 35.8386 37.0 37.0 37.0 37.0 37.0 120-124 35.726600000000005 37.0 37.0 37.0 37.0 37.0 125-129 35.6458 37.0 37.0 37.0 37.0 37.0 130-134 35.7447 37.0 37.0 37.0 37.0 37.0 135-139 35.55219999999999 37.0 37.0 37.0 37.0 37.0 140-144 35.3573 37.0 37.0 37.0 34.6 37.0 145-149 35.273900000000005 37.0 37.0 37.0 34.6 37.0 150-151 35.102000000000004 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 2.0 20 2.0 21 3.0 22 2.0 23 2.0 24 5.0 25 3.0 26 5.0 27 9.0 28 14.0 29 20.0 30 16.0 31 50.0 32 44.0 33 104.0 34 167.0 35 388.0 36 2910.0 37 254.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.110414052697614 13.124215809284816 10.41405269761606 40.35131744040151 2 19.7 15.575 36.325 28.4 3 16.625 19.3 27.925 36.15 4 21.075 26.55 24.775 27.6 5 24.525 33.5 22.900000000000002 19.075 6 20.75 34.575 24.95 19.725 7 14.725 28.1 40.775 16.400000000000002 8 17.525 26.775 32.324999999999996 23.375 9 17.25 23.3 36.199999999999996 23.25 10-14 18.9 30.795 27.224999999999998 23.080000000000002 15-19 18.945 29.01 28.050000000000004 23.995 20-24 19.225 29.115000000000002 28.23 23.43 25-29 19.564999999999998 29.215000000000003 28.025 23.195 30-34 19.485 28.665000000000003 28.189999999999998 23.66 35-39 19.395 29.12 27.72 23.765 40-44 19.41 28.57 28.13 23.89 45-49 19.705000000000002 28.84 28.634999999999998 22.82 50-54 19.7 28.689999999999998 28.38 23.23 55-59 19.185 29.459999999999997 27.63 23.724999999999998 60-64 19.835 29.21 27.595 23.36 65-69 19.46 28.549999999999997 28.455000000000002 23.535 70-74 20.9 29.555 26.950000000000003 22.595000000000002 75-79 19.939999999999998 28.725 27.875 23.46 80-84 19.74 28.515 28.645 23.1 85-89 19.985 29.2 27.589999999999996 23.225 90-94 20.29 28.475 27.700000000000003 23.535 95-99 20.355 28.689999999999998 27.715 23.24 100-104 20.195 28.165000000000003 28.110000000000003 23.53 105-109 20.415 28.035 27.88 23.669999999999998 110-114 20.215 28.544999999999998 27.744999999999997 23.494999999999997 115-119 20.150000000000002 29.604999999999997 26.974999999999998 23.27 120-124 21.43 29.015 26.540000000000003 23.015 125-129 20.895 28.535 26.765 23.805 130-134 20.94 29.125 26.36 23.575 135-139 20.474999999999998 28.660000000000004 26.71 24.154999999999998 140-144 20.23 28.655 26.55 24.565 145-149 20.544999999999998 28.88 26.479999999999997 24.095 150-151 21.0375 28.512500000000003 26.35 24.099999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.5 11 1.0 12 0.5 13 0.5 14 1.0 15 1.0 16 2.0 17 2.0 18 1.0 19 0.5 20 0.0 21 2.5 22 3.5 23 2.0 24 3.5 25 4.5 26 4.0 27 6.0 28 9.5 29 16.0 30 26.0 31 34.5 32 43.5 33 57.5 34 83.0 35 96.5 36 110.0 37 129.0 38 154.0 39 174.5 40 184.0 41 213.0 42 236.5 43 245.0 44 269.0 45 269.0 46 248.0 47 238.5 48 203.0 49 174.0 50 161.5 51 132.5 52 95.0 53 87.5 54 75.0 55 50.5 56 36.0 57 26.0 58 20.5 59 14.5 60 12.5 61 8.0 62 7.0 63 6.5 64 4.5 65 2.5 66 1.0 67 0.5 68 1.0 69 1.5 70 2.0 71 1.0 72 0.5 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.375 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.075 #Duplication Level Percentage of deduplicated Percentage of total 1 84.35920309247695 70.92500000000001 2 12.845673505798395 21.6 3 2.3788284269997026 6.0 4 0.3270889087124591 1.0999999999999999 5 0.08920606601248886 0.375 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGCGACTCGTTGCTTGATGAAGTATGTGATCAAAGGAATCCCAAAGAT 5 0.125 No Hit GAAAATATTTGAGCATAAATAAAACAAGTGCCCAAGCACACAACCATGAC 5 0.125 No Hit CCTGCCTCTACACTTGCTTCAACTAAAGCAGCTTCAAATATCTTGGGATC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.2375 0.0 0.0 0.0 0.0 78-79 0.3 0.0 0.0 0.0 0.0 80-81 0.375 0.0 0.0 0.0 0.0 82-83 0.4625 0.0 0.0 0.0 0.0 84-85 0.55 0.0 0.0 0.0 0.0 86-87 0.6 0.0 0.0 0.0 0.0 88-89 0.7625 0.0 0.0 0.0 0.0 90-91 0.9 0.0 0.0 0.0 0.0 92-93 1.075 0.0 0.0 0.0 0.0 94-95 1.2000000000000002 0.0 0.0 0.0 0.0 96-97 1.3875000000000002 0.0 0.0 0.0 0.0 98-99 1.6125 0.0 0.0 0.0 0.0 100-101 1.925 0.0 0.0 0.0 0.0 102-103 2.2249999999999996 0.0 0.0 0.0 0.0 104-105 2.6125 0.0 0.0 0.0 0.0 106-107 2.8499999999999996 0.0 0.0 0.0 0.0 108-109 3.125 0.0 0.0 0.0 0.0 110-111 3.5374999999999996 0.0 0.0 0.0 0.0 112-113 3.9875000000000003 0.0 0.0 0.0 0.0 114-115 4.425000000000001 0.0 0.0 0.0 0.0 116-117 5.2125 0.0 0.0 0.0 0.0 118-119 5.8375 0.0 0.0 0.0 0.0 120-121 6.525 0.0 0.0 0.0 0.0 122-123 7.0875 0.0 0.0 0.0 0.0 124-125 7.574999999999999 0.0 0.0 0.0 0.0 126-127 8.3125 0.0 0.0 0.0 0.0 128-129 8.825 0.0 0.0 0.0 0.0 130-131 9.462499999999999 0.0 0.0 0.0 0.0 132-133 10.1375 0.0 0.0 0.0 0.0 134-135 10.7625 0.0 0.0 0.0 0.0 136-137 11.325 0.0 0.0 0.0 0.0 138-139 11.8 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCTCAT 10 0.006830828 145.0 4 >>END_MODULE SRR28623284 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623284_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.8475 37.0 37.0 37.0 37.0 37.0 2 36.3535 37.0 37.0 37.0 37.0 37.0 3 36.161 37.0 37.0 37.0 37.0 37.0 4 36.0995 37.0 37.0 37.0 37.0 37.0 5 36.2505 37.0 37.0 37.0 37.0 37.0 6 36.177 37.0 37.0 37.0 37.0 37.0 7 36.1395 37.0 37.0 37.0 37.0 37.0 8 36.219 37.0 37.0 37.0 37.0 37.0 9 36.123 37.0 37.0 37.0 37.0 37.0 10-14 36.083000000000006 37.0 37.0 37.0 37.0 37.0 15-19 36.13590000000001 37.0 37.0 37.0 37.0 37.0 20-24 36.0984 37.0 37.0 37.0 37.0 37.0 25-29 35.99829999999999 37.0 37.0 37.0 37.0 37.0 30-34 35.9909 37.0 37.0 37.0 37.0 37.0 35-39 36.04 37.0 37.0 37.0 37.0 37.0 40-44 35.9054 37.0 37.0 37.0 37.0 37.0 45-49 35.9233 37.0 37.0 37.0 37.0 37.0 50-54 35.9181 37.0 37.0 37.0 37.0 37.0 55-59 35.740899999999996 37.0 37.0 37.0 37.0 37.0 60-64 35.806000000000004 37.0 37.0 37.0 37.0 37.0 65-69 35.748000000000005 37.0 37.0 37.0 37.0 37.0 70-74 35.7438 37.0 37.0 37.0 37.0 37.0 75-79 35.78150000000001 37.0 37.0 37.0 37.0 37.0 80-84 35.6211 37.0 37.0 37.0 37.0 37.0 85-89 35.6409 37.0 37.0 37.0 37.0 37.0 90-94 35.586499999999994 37.0 37.0 37.0 37.0 37.0 95-99 35.5911 37.0 37.0 37.0 37.0 37.0 100-104 35.47539999999999 37.0 37.0 37.0 37.0 37.0 105-109 35.4771 37.0 37.0 37.0 37.0 37.0 110-114 35.519499999999994 37.0 37.0 37.0 37.0 37.0 115-119 35.383799999999994 37.0 37.0 37.0 37.0 37.0 120-124 35.4221 37.0 37.0 37.0 37.0 37.0 125-129 34.9868 37.0 37.0 37.0 27.4 37.0 130-134 35.2579 37.0 37.0 37.0 34.6 37.0 135-139 34.95890000000001 37.0 37.0 37.0 25.0 37.0 140-144 35.0531 37.0 37.0 37.0 25.0 37.0 145-149 35.0275 37.0 37.0 37.0 25.0 37.0 150-151 34.7375 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 6.0 14 9.0 15 3.0 16 1.0 17 0.0 18 3.0 19 1.0 20 4.0 21 8.0 22 4.0 23 11.0 24 5.0 25 8.0 26 7.0 27 18.0 28 15.0 29 14.0 30 26.0 31 41.0 32 69.0 33 130.0 34 230.0 35 737.0 36 2426.0 37 224.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.775 20.674999999999997 15.225 25.324999999999996 2 29.75 25.55 28.1 16.6 3 22.075 27.825 30.4 19.7 4 25.275 33.375 23.549999999999997 17.8 5 26.825 34.699999999999996 22.425 16.05 6 20.75 38.95 23.25 17.05 7 20.3 21.625 38.574999999999996 19.5 8 21.75 26.025 27.775 24.45 9 22.775000000000002 24.099999999999998 29.675 23.45 10-14 23.935000000000002 29.325000000000003 26.115 20.625 15-19 23.255 28.410000000000004 28.645 19.689999999999998 20-24 23.64 28.615000000000002 27.750000000000004 19.994999999999997 25-29 23.435 28.48 28.050000000000004 20.035 30-34 22.994999999999997 28.71 27.955000000000002 20.34 35-39 23.494999999999997 28.78 27.715 20.01 40-44 23.785 29.18 27.36 19.675 45-49 23.565 28.68 28.000000000000004 19.755 50-54 22.99 28.92 27.67 20.419999999999998 55-59 23.875 28.405 28.18 19.54 60-64 22.91 28.549999999999997 28.4 20.14 65-69 23.235 28.645 27.689999999999998 20.43 70-74 23.89 28.98 27.465 19.665 75-79 22.845 28.475 27.994999999999997 20.685000000000002 80-84 23.005 29.099999999999998 27.73 20.165 85-89 23.385 28.24 27.939999999999998 20.435 90-94 23.13 28.395 28.585 19.89 95-99 22.55 29.354999999999997 27.93 20.165 100-104 24.23 28.645 27.785 19.34 105-109 23.945 27.98 28.215 19.86 110-114 24.05 29.354999999999997 26.995 19.6 115-119 24.795 28.405 27.655 19.145 120-124 24.625 28.4 27.765 19.21 125-129 25.385 28.51 27.284999999999997 18.82 130-134 25.014999999999997 29.14 26.334999999999997 19.509999999999998 135-139 25.765 28.660000000000004 26.810000000000002 18.765 140-144 25.41 29.035 27.015 18.54 145-149 25.965 28.175 27.16 18.7 150-151 25.924999999999997 28.812500000000004 26.6125 18.65 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.5 8 2.0 9 1.0 10 0.5 11 0.5 12 1.0 13 0.5 14 0.5 15 1.5 16 1.0 17 2.5 18 2.5 19 1.0 20 3.0 21 2.5 22 2.0 23 2.5 24 2.0 25 6.0 26 6.0 27 4.0 28 9.0 29 14.0 30 18.5 31 21.5 32 27.0 33 47.0 34 66.0 35 72.5 36 97.5 37 126.5 38 141.0 39 186.0 40 221.5 41 230.0 42 252.5 43 268.5 44 273.5 45 281.5 46 260.5 47 234.5 48 213.0 49 175.0 50 151.0 51 126.0 52 101.0 53 78.0 54 61.5 55 49.0 56 38.5 57 31.5 58 20.0 59 10.5 60 7.0 61 7.0 62 5.0 63 6.5 64 6.0 65 2.5 66 1.5 67 1.0 68 0.5 69 0.5 70 1.0 71 1.0 72 1.0 73 0.5 74 0.0 75 0.5 76 0.5 77 1.0 78 1.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.5 87 1.0 88 1.0 89 0.5 90 0.5 91 0.5 92 0.0 93 0.0 94 0.5 95 0.5 96 0.0 97 0.0 98 0.0 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.775 #Duplication Level Percentage of deduplicated Percentage of total 1 85.19610734296667 72.225 2 12.149808316130935 20.599999999999998 3 2.241226776762017 5.7 4 0.32438808611029196 1.0999999999999999 5 0.08846947803007962 0.375 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CAACAATGATTATTTTGAAGAAGTCTATAAGTACTATGCAAATGGCGAAG 5 0.125 No Hit GAAGAGATAACCTCTGCTCCATATTTCATTCGAGCAGTATGCGAAATTGT 5 0.125 No Hit AATAAACAAGCAGAGGAGTGAATGCTGATATCTCTCCTTCGTGCCTACAT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.2375 0.0 0.0 0.0 0.0 78-79 0.3 0.0 0.0 0.0 0.0 80-81 0.3875 0.0 0.0 0.0 0.0 82-83 0.4875 0.0 0.0 0.0 0.0 84-85 0.575 0.0 0.0 0.0 0.0 86-87 0.625 0.0 0.0 0.0 0.0 88-89 0.7875 0.0 0.0 0.0 0.0 90-91 0.925 0.0 0.0 0.0 0.0 92-93 1.075 0.0 0.0 0.0 0.0 94-95 1.2000000000000002 0.0 0.0 0.0 0.0 96-97 1.3875000000000002 0.0 0.0 0.0 0.0 98-99 1.6125 0.0 0.0 0.0 0.0 100-101 1.9 0.0 0.0 0.0 0.0 102-103 2.2 0.0 0.0 0.0 0.0 104-105 2.5875 0.0 0.0 0.0 0.0 106-107 2.825 0.0 0.0 0.0 0.0 108-109 3.1125 0.0 0.0 0.0 0.0 110-111 3.5625 0.0 0.0 0.0 0.0 112-113 3.9875000000000003 0.0 0.0 0.0 0.0 114-115 4.425000000000001 0.0 0.0 0.0 0.0 116-117 5.2125 0.0 0.0 0.0 0.0 118-119 5.85 0.0 0.0 0.0 0.0 120-121 6.6 0.0 0.0 0.0 0.0 122-123 7.1625 0.0 0.0 0.0 0.0 124-125 7.65 0.0 0.0 0.0 0.0 126-127 8.3875 0.0 0.0 0.0 0.0 128-129 8.9 0.0 0.0 0.0 0.0 130-131 9.5875 0.0 0.0 0.0 0.0 132-133 10.274999999999999 0.0 0.0 0.0 0.0 134-135 10.9625 0.0 0.0 0.0 0.0 136-137 11.5 0.0 0.0 0.0 0.0 138-139 12.0125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCTGGA 10 0.006830828 145.0 7 >>END_MODULE Read 1497223 spots for SRR28623284.sra Written 1497223 spots for SRR28623284.sra Read 1497223 spots for SRR28623284.sra Written 1497223 spots for SRR28623284.sra Read 1497223 spots for SRR28623284.sra Written 1497223 spots for SRR28623284.sra Read 1497223 spots for SRR28623284.sra Written 1497223 spots for SRR28623284.sra Read 1497223 spots for SRR28623284.sra Written 1497223 spots for SRR28623284.sra Read 1497223 spots for SRR28623284.sra Written 1497223 spots for SRR28623284.sra Read 1497223 spots for SRR28623284.sra Written 1497223 spots for SRR28623284.sra Read 1497223 spots for SRR28623284.sra Written 1497223 spots for SRR28623284.sra Read 1497223 spots for SRR28623284.sra Written 1497223 spots for SRR28623284.sra Read 1497223 spots for SRR28623284.sra Written 1497223 spots for SRR28623284.sra Read 1497223 spots for SRR28623284.sra Written 1497223 spots for SRR28623284.sra Read 1497223 spots for SRR28623284.sra Written 1497223 spots for SRR28623284.sra Read 1497223 spots for SRR28623284.sra Written 1497223 spots for SRR28623284.sra Read 1497223 spots for SRR28623284.sra Written 1497223 spots for SRR28623284.sra Read 1497223 spots for SRR28623284.sra Written 1497223 spots for SRR28623284.sra Read 1497223 spots for SRR28623284.sra Written 1497223 spots for SRR28623284.sra Read 1497223 spots for SRR28623284.sra Written 1497223 spots for SRR28623284.sra Read 1497241 spots for SRR28623284.sra Written 1497241 spots for SRR28623284.sra Read 1497223 spots for SRR28623284.sra Written 1497223 spots for SRR28623284.sra Read 1497223 spots for SRR28623284.sra Written 1497223 spots for SRR28623284.sra SRR ids: ['SRR28623284.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_80dt6cor SRR28623284.sra spots: 29944478 blocks: [[1, 1497223], [1497224, 2994446], [2994447, 4491669], [4491670, 5988892], [5988893, 7486115], [7486116, 8983338], [8983339, 10480561], [10480562, 11977784], [11977785, 13475007], [13475008, 14972230], [14972231, 16469453], [16469454, 17966676], [17966677, 19463899], [19463900, 20961122], [20961123, 22458345], [22458346, 23955568], [23955569, 25452791], [25452792, 26950014], [26950015, 28447237], [28447238, 29944478]] SRR28623284 file size 11056485 SRR28623284 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR28623284 SRR28623284_1.fastq SRR28623284_2.fastq Input file: SRR28623284_1.fastq Paired file: SRR28623284_2.fastq trimmed: SRR28623284-trimmed-pair1.fastq, SRR28623284-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 13:59:31 2025 >> started Tue Feb 11 14:00:08 2025 >> done (36.882s) 29944478 read pairs processed; of these: 23 ( 0.00%) short read pairs filtered out after trimming by size control 17230 ( 0.06%) empty read pairs filtered out after trimming by size control 29927225 (99.94%) read pairs available; of these: 4918049 (16.43%) trimmed read pairs available after processing 25009176 (83.57%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 4 0.00% 20 2 0.00% 21 4 0.00% 22 6 0.00% 23 5 0.00% 24 3 0.00% 25 4 0.00% 26 8 0.00% 27 11 0.00% 28 9 0.00% 29 10 0.00% 30 13 0.00% 31 15 0.00% 32 10 0.00% 33 22 0.00% 34 19 0.00% 35 20 0.00% 36 28 0.00% 37 27 0.00% 38 31 0.00% 39 40 0.00% 40 46 0.00% 41 55 0.00% 42 64 0.00% 43 83 0.00% 44 77 0.00% 45 89 0.00% 46 105 0.00% 47 97 0.00% 48 140 0.00% 49 134 0.00% 50 187 0.00% 51 212 0.00% 52 233 0.00% 53 250 0.00% 54 315 0.00% 55 317 0.00% 56 339 0.00% 57 418 0.00% 58 482 0.00% 59 563 0.00% 60 610 0.00% 61 757 0.00% 62 878 0.00% 63 1045 0.00% 64 1153 0.00% 65 1293 0.00% 66 1456 0.00% 67 1652 0.01% 68 1853 0.01% 69 2224 0.01% 70 2559 0.01% 71 2865 0.01% 72 3383 0.01% 73 3933 0.01% 74 4241 0.01% 75 4843 0.02% 76 5411 0.02% 77 5961 0.02% 78 6670 0.02% 79 7445 0.02% 80 8450 0.03% 81 9600 0.03% 82 10616 0.04% 83 11878 0.04% 84 13488 0.05% 85 14895 0.05% 86 15844 0.05% 87 17261 0.06% 88 18582 0.06% 89 20373 0.07% 90 21674 0.07% 91 23930 0.08% 92 25502 0.09% 93 27842 0.09% 94 30165 0.10% 95 31992 0.11% 96 34212 0.11% 97 36056 0.12% 98 36980 0.12% 99 39417 0.13% 100 41776 0.14% 101 43113 0.14% 102 45812 0.15% 103 48003 0.16% 104 50144 0.17% 105 53386 0.18% 106 55677 0.19% 107 56697 0.19% 108 58650 0.20% 109 60579 0.20% 110 61562 0.21% 111 63315 0.21% 112 66403 0.22% 113 67980 0.23% 114 70338 0.24% 115 73002 0.24% 116 74498 0.25% 117 76975 0.26% 118 78721 0.26% 119 79264 0.26% 120 80220 0.27% 121 82904 0.28% 122 84138 0.28% 123 85939 0.29% 124 88246 0.29% 125 89690 0.30% 126 91870 0.31% 127 94131 0.31% 128 94317 0.32% 129 95831 0.32% 130 98010 0.33% 131 98241 0.33% 132 99259 0.33% 133 101732 0.34% 134 102836 0.34% 135 103580 0.35% 136 104733 0.35% 137 107042 0.36% 138 107558 0.36% 139 109597 0.37% 140 109453 0.37% 141 110680 0.37% 142 111893 0.37% 143 112631 0.38% 144 114366 0.38% 145 115467 0.39% 146 115109 0.38% 147 116394 0.39% 148 117605 0.39% 149 116904 0.39% 150 118290 0.40% 151 25009176 83.57% 29927225 reads passed initial QC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=40 prefix-density=0.12 prefix-fanout=2.0 sequence=TGCGACATGGTTGGCAAGAATCCTTCTGCGAATTTAGCAACAACCGAAGAATCAAGATACTCCTGCAAGCCCTCCAGATCATCAAAGGTAGTTTCAAAAGCATGAGTATATCCGAAATTGAGGTCGTGAATACCCAGATTAGTGCCCCAGTGTAAGCTCTTCAAGGGTTCAACTTGATTGACCAGATGAGTGAAGTCGTTTATGATTTTCTCAATTT criterion=fanout-score sequence-density=0.07 sequence-density-rank=19 fanout-score=402.77 fanout-score-rank=1 prefix-density=0.93 prefix-fanout=28.3 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=12.60 fanout-score-rank=22 prefix-density=0.13 prefix-fanout=12.6 sequence=GAGAGAGAGAGTTAAGACAATGGCCTCGAAGAAATCTGCAATCGTATTACCTGGTTCAAAGGTGTTGAAGCACATAGTTTTTGTACGGTTTAATGATGGGATCACTGATGAACAAATTGAGAA criterion=fanout-score sequence-density=0.08 sequence-density-rank=11 fanout-score=382.49 fanout-score-rank=1 prefix-density=0.94 prefix-fanout=31.2 sequence=AAGAAGAAGAAA SRR28623284 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 14:00:50 Started mapping on | Feb 11 14:00:50 Finished on | Feb 11 14:04:09 Mapping speed, Million of reads per hour | 541.40 Number of input reads | 29927225 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 27895767 Uniquely mapped reads % | 93.21% Average mapped length | 291.76 Number of splices: Total | 24497151 Number of splices: Annotated (sjdb) | 23853670 Number of splices: GT/AG | 24049382 Number of splices: GC/AG | 343517 Number of splices: AT/AC | 25033 Number of splices: Non-canonical | 79219 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.04% Deletion average length | 2.95 Insertion rate per base | 0.03% Insertion average length | 2.36 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 728394 % of reads mapped to multiple loci | 2.43% Number of reads mapped to too many loci | 198460 % of reads mapped to too many loci | 0.66% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.46% % of reads unmapped: other | 0.23% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1303064 1303064 1303064 N_multimapping 728394 728394 728394 N_noFeature 1390812 27538576 1575431 N_ambiguous 337610 2759 163081 UnstrandedReadsAssigned:26167345 PositiveStrandReadsAssigned:354432 NegativeStrandReadsAssigned:26157255 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR28623284 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR28623284-trimmed-pair1.fastq SRR28623284-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 29,927,225 reads, 26,488,987 reads pseudoaligned [quant] estimated average fragment length: 227.085 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,063 rounds 52401 SRR28623284.ke.tsv 34699 SRR28623284.se.tsv 87100 total ==> SRR28623284.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1791.91 2043 41.0487 Potri.005G024800.1.v4.1 1035 808.915 1986 88.3945 Potri.004G059700.1.v4.1 961 734.92 480 23.5153 Potri.007G009000.2.v4.1 1416 1189.91 0 0 Potri.003G141000.2.v4.1 2943 2716.91 903.836 11.9774 Potri.016G087400.1.v4.1 270 93.8637 2030.27 778.763 Potri.015G069301.1.v4.1 564 342.955 0 0 Potri.010G195200.1.v4.1 1773 1546.91 23.5934 0.549128 Potri.012G127500.1.v4.1 977 750.92 12818 614.576 ==> SRR28623284.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2355 Potri.001G233950.v4.1 10 Potri.001G122700.v4.1 665 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 47 Potri.001G452600.v4.1 16 SRR28623284 completed mapping pipeline successfully