Starting /dee2/code/volunteer_pipeline.sh SRR28623286 current disk space = 3050148921344 free memory = 1414803068 SRR28623286 SRAfilesize 46cb4cc18735a805a2c44aca542b8236 SRR28623286.sra SRR28623286.sra file validated SRR28623286 is paired end SRR28623286 is conventional basespace SRR28623286 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623286_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.317 37.0 37.0 37.0 37.0 37.0 2 36.4585 37.0 37.0 37.0 37.0 37.0 3 36.5515 37.0 37.0 37.0 37.0 37.0 4 36.641 37.0 37.0 37.0 37.0 37.0 5 36.6675 37.0 37.0 37.0 37.0 37.0 6 36.6305 37.0 37.0 37.0 37.0 37.0 7 36.596 37.0 37.0 37.0 37.0 37.0 8 36.3555 37.0 37.0 37.0 37.0 37.0 9 36.574 37.0 37.0 37.0 37.0 37.0 10-14 36.5702 37.0 37.0 37.0 37.0 37.0 15-19 36.5316 37.0 37.0 37.0 37.0 37.0 20-24 36.55740000000001 37.0 37.0 37.0 37.0 37.0 25-29 36.490899999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.4818 37.0 37.0 37.0 37.0 37.0 35-39 36.4143 37.0 37.0 37.0 37.0 37.0 40-44 36.359700000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.3185 37.0 37.0 37.0 37.0 37.0 50-54 36.298199999999994 37.0 37.0 37.0 37.0 37.0 55-59 36.197199999999995 37.0 37.0 37.0 37.0 37.0 60-64 36.181200000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.19590000000001 37.0 37.0 37.0 37.0 37.0 70-74 36.1375 37.0 37.0 37.0 37.0 37.0 75-79 36.1892 37.0 37.0 37.0 37.0 37.0 80-84 36.0407 37.0 37.0 37.0 37.0 37.0 85-89 36.059000000000005 37.0 37.0 37.0 37.0 37.0 90-94 36.00840000000001 37.0 37.0 37.0 37.0 37.0 95-99 35.8919 37.0 37.0 37.0 37.0 37.0 100-104 35.9188 37.0 37.0 37.0 37.0 37.0 105-109 35.888799999999996 37.0 37.0 37.0 37.0 37.0 110-114 35.7998 37.0 37.0 37.0 37.0 37.0 115-119 35.8436 37.0 37.0 37.0 37.0 37.0 120-124 35.6811 37.0 37.0 37.0 37.0 37.0 125-129 35.593399999999995 37.0 37.0 37.0 37.0 37.0 130-134 35.693 37.0 37.0 37.0 37.0 37.0 135-139 35.532500000000006 37.0 37.0 37.0 37.0 37.0 140-144 35.310900000000004 37.0 37.0 37.0 34.6 37.0 145-149 35.2661 37.0 37.0 37.0 32.2 37.0 150-151 35.1345 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 1.0 24 1.0 25 5.0 26 4.0 27 15.0 28 11.0 29 23.0 30 37.0 31 56.0 32 61.0 33 98.0 34 171.0 35 396.0 36 2864.0 37 256.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.45445395067942 13.688978359335682 11.021640664318069 43.834927025666836 2 18.5 15.049999999999999 36.225 30.225 3 17.0 17.349999999999998 28.725 36.925000000000004 4 22.1 24.8 23.474999999999998 29.625 5 24.725 30.275000000000002 24.65 20.349999999999998 6 22.3 33.800000000000004 22.975 20.925 7 15.75 29.299999999999997 38.725 16.225 8 18.75 27.925 31.474999999999998 21.85 9 18.9 24.925 33.050000000000004 23.125 10-14 19.189999999999998 31.2 27.82 21.790000000000003 15-19 19.605 28.785 27.665 23.945 20-24 19.345000000000002 29.075 28.09 23.49 25-29 19.994999999999997 28.96 27.715 23.330000000000002 30-34 19.814999999999998 29.985 26.85 23.35 35-39 19.68 29.03 27.474999999999998 23.815 40-44 19.335 29.609999999999996 27.744999999999997 23.31 45-49 19.814999999999998 29.189999999999998 27.500000000000004 23.494999999999997 50-54 19.715 29.13 26.889999999999997 24.265 55-59 20.07 28.985 27.51 23.435 60-64 19.325 29.315 27.345000000000002 24.015 65-69 20.3 28.77 27.894999999999996 23.035 70-74 19.545 29.354999999999997 27.250000000000004 23.849999999999998 75-79 20.19 29.29 26.674999999999997 23.845 80-84 20.325 28.915000000000003 27.02 23.74 85-89 20.06 28.82 26.875 24.245 90-94 19.945 29.17 26.900000000000002 23.985 95-99 20.615 29.07 27.165 23.150000000000002 100-104 20.435 29.12 26.905 23.54 105-109 20.64 29.485 26.884999999999998 22.99 110-114 20.549999999999997 29.049999999999997 26.935 23.465 115-119 20.66 29.125 26.784999999999997 23.43 120-124 21.005 28.625 26.724999999999998 23.645 125-129 21.215 29.044999999999998 25.885 23.855 130-134 21.45 28.005000000000003 26.69 23.855 135-139 21.075 28.265 26.38 24.279999999999998 140-144 21.425 28.28 26.490000000000002 23.805 145-149 20.965 28.084999999999997 26.38 24.57 150-151 21.775 28.275 26.2875 23.6625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 1.0 10 0.5 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 1.0 23 1.0 24 2.0 25 4.5 26 12.5 27 13.5 28 13.5 29 22.0 30 31.0 31 31.5 32 35.5 33 44.5 34 67.0 35 91.0 36 106.0 37 117.5 38 136.0 39 164.5 40 179.5 41 194.5 42 241.5 43 279.5 44 275.5 45 267.5 46 244.0 47 229.0 48 212.5 49 174.5 50 160.0 51 141.0 52 104.0 53 86.5 54 69.5 55 43.5 56 32.0 57 36.0 58 30.5 59 17.5 60 9.5 61 6.5 62 10.5 63 9.5 64 8.0 65 7.5 66 6.5 67 8.5 68 7.0 69 3.0 70 0.0 71 0.0 72 2.0 73 2.5 74 0.5 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.65 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 82.39999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 83.37378640776699 68.7 2 12.955097087378642 21.349999999999998 3 2.821601941747573 6.9750000000000005 4 0.6978155339805826 2.3 5 0.12135922330097086 0.5 6 0.0 0.0 7 0.030339805825242715 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCGCTGTTATCTCGTAT 7 0.17500000000000002 TruSeq Adapter, Index 10 (97% over 38bp) CAACAAAATTTCACCTCTATTTCTAAAGTAAAGGTATAGCTTATAGTTGC 5 0.125 No Hit TGTTGATGTAGTCAGCCTGGTCCTTGGAGAGCTTGGTAAGCCTAGCTCCT 5 0.125 No Hit GTCAGCCGCCACGTCCCGGTTCAGGAATTTTAACCCGATTCCCTTTCGAA 5 0.125 No Hit CTCACAGGATAAGGAATCCTTGAACACCAAACAACCTAACAATGTCTCCC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.2625 0.0 0.0 0.0 0.0 82-83 0.35 0.0 0.0 0.0 0.0 84-85 0.4375 0.0 0.0 0.0 0.0 86-87 0.6125 0.0 0.0 0.0 0.0 88-89 0.8625 0.0 0.0 0.0 0.0 90-91 1.0625 0.0 0.0 0.0 0.0 92-93 1.1749999999999998 0.0 0.0 0.0 0.0 94-95 1.4249999999999998 0.0 0.0 0.0 0.0 96-97 1.7375 0.0 0.0 0.0 0.0 98-99 2.0875 0.0 0.0 0.0 0.0 100-101 2.375 0.0 0.0 0.0 0.0 102-103 2.9125 0.0 0.0 0.0 0.0 104-105 3.2875 0.0 0.0 0.0 0.0 106-107 3.775 0.0 0.0 0.0 0.0 108-109 4.35 0.0 0.0 0.0 0.0 110-111 4.85 0.0 0.0 0.0 0.0 112-113 5.425000000000001 0.0 0.0 0.0 0.0 114-115 6.1375 0.0 0.0 0.0 0.0 116-117 6.887499999999999 0.0 0.0 0.0 0.0 118-119 7.6125 0.0 0.0 0.0 0.0 120-121 8.45 0.0 0.0 0.0 0.0 122-123 9.2375 0.0 0.0 0.0 0.0 124-125 9.975 0.0 0.0 0.0 0.0 126-127 10.662500000000001 0.0 0.0 0.0 0.0 128-129 11.2125 0.0 0.0 0.0 0.0 130-131 11.8125 0.0 0.0 0.0 0.0 132-133 12.662500000000001 0.0 0.0 0.0 0.0 134-135 13.5875 0.0 0.0 0.0 0.0 136-137 14.350000000000001 0.0 0.0 0.0 0.0 138-139 15.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAGCCCC 10 0.006830828 145.0 9 GCAGCCC 10 0.006830828 145.0 8 GACGAAA 10 0.006830828 145.0 1 CGAAAGC 10 0.006830828 145.0 3 AATGCCT 10 0.006830828 145.0 145 ACGAAAG 10 0.006830828 145.0 2 AAGCAGC 10 0.006830828 145.0 6 CATGTGT 20 0.00593511 29.0 130-134 >>END_MODULE SRR28623286 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623286_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.454 37.0 37.0 37.0 37.0 37.0 2 36.239 37.0 37.0 37.0 37.0 37.0 3 36.1475 37.0 37.0 37.0 37.0 37.0 4 36.185 37.0 37.0 37.0 37.0 37.0 5 36.2615 37.0 37.0 37.0 37.0 37.0 6 36.3055 37.0 37.0 37.0 37.0 37.0 7 36.223 37.0 37.0 37.0 37.0 37.0 8 36.266 37.0 37.0 37.0 37.0 37.0 9 36.1 37.0 37.0 37.0 37.0 37.0 10-14 36.0866 37.0 37.0 37.0 37.0 37.0 15-19 36.127500000000005 37.0 37.0 37.0 37.0 37.0 20-24 36.0926 37.0 37.0 37.0 37.0 37.0 25-29 36.096 37.0 37.0 37.0 37.0 37.0 30-34 35.9755 37.0 37.0 37.0 37.0 37.0 35-39 36.0047 37.0 37.0 37.0 37.0 37.0 40-44 35.9042 37.0 37.0 37.0 37.0 37.0 45-49 35.9212 37.0 37.0 37.0 37.0 37.0 50-54 35.903099999999995 37.0 37.0 37.0 37.0 37.0 55-59 35.7082 37.0 37.0 37.0 37.0 37.0 60-64 35.7359 37.0 37.0 37.0 37.0 37.0 65-69 35.7847 37.0 37.0 37.0 37.0 37.0 70-74 35.792 37.0 37.0 37.0 37.0 37.0 75-79 35.8103 37.0 37.0 37.0 37.0 37.0 80-84 35.713300000000004 37.0 37.0 37.0 37.0 37.0 85-89 35.6229 37.0 37.0 37.0 37.0 37.0 90-94 35.54860000000001 37.0 37.0 37.0 37.0 37.0 95-99 35.684900000000006 37.0 37.0 37.0 37.0 37.0 100-104 35.5146 37.0 37.0 37.0 37.0 37.0 105-109 35.4581 37.0 37.0 37.0 37.0 37.0 110-114 35.5432 37.0 37.0 37.0 37.0 37.0 115-119 35.52239999999999 37.0 37.0 37.0 37.0 37.0 120-124 35.4644 37.0 37.0 37.0 34.6 37.0 125-129 34.8472 37.0 37.0 37.0 27.4 37.0 130-134 35.2968 37.0 37.0 37.0 32.2 37.0 135-139 35.0257 37.0 37.0 37.0 25.0 37.0 140-144 35.1097 37.0 37.0 37.0 27.4 37.0 145-149 35.011399999999995 37.0 37.0 37.0 25.0 37.0 150-151 34.61475 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 0.0 15 2.0 16 0.0 17 2.0 18 2.0 19 2.0 20 4.0 21 5.0 22 7.0 23 10.0 24 7.0 25 11.0 26 13.0 27 14.0 28 19.0 29 30.0 30 40.0 31 47.0 32 52.0 33 133.0 34 248.0 35 715.0 36 2411.0 37 225.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.625 21.75 14.424999999999999 28.199999999999996 2 25.8 26.700000000000003 29.849999999999998 17.65 3 20.7 28.050000000000004 31.924999999999997 19.325 4 23.65 33.45 24.224999999999998 18.675 5 26.775 34.125 22.05 17.05 6 22.15 38.35 23.0 16.5 7 22.2 21.65 38.25 17.9 8 22.125 24.9 27.925 25.05 9 22.875 25.124999999999996 30.325000000000003 21.675 10-14 23.625 28.415000000000003 27.155 20.805 15-19 23.745 27.155 28.49 20.61 20-24 23.7 27.72 27.834999999999997 20.745 25-29 23.625 28.505000000000003 27.22 20.65 30-34 23.169999999999998 28.360000000000003 28.01 20.46 35-39 23.669999999999998 27.944999999999997 28.060000000000002 20.325 40-44 23.435 27.485 28.435 20.645 45-49 23.575 27.605 28.794999999999998 20.025000000000002 50-54 22.915 27.889999999999997 28.395 20.8 55-59 23.615 27.195000000000004 28.610000000000003 20.580000000000002 60-64 23.165 27.61 28.884999999999998 20.34 65-69 23.119999999999997 27.62 28.705000000000002 20.555 70-74 23.615 28.46 28.08 19.845 75-79 23.185 27.85 28.255000000000003 20.71 80-84 23.575 27.889999999999997 28.305000000000003 20.23 85-89 23.735 27.700000000000003 28.255000000000003 20.31 90-94 23.57 28.1 28.084999999999997 20.244999999999997 95-99 24.4 27.860000000000003 27.61 20.13 100-104 24.985 28.13 27.315 19.57 105-109 24.0 27.99 28.055000000000003 19.955000000000002 110-114 25.474999999999998 27.515 27.560000000000002 19.45 115-119 25.66 27.165 27.96 19.215 120-124 25.195 27.185 27.944999999999997 19.675 125-129 25.009999999999998 28.165000000000003 27.715 19.11 130-134 26.605 27.339999999999996 27.07 18.985 135-139 26.525 26.6 28.499999999999996 18.375 140-144 26.290000000000003 27.189999999999998 27.865000000000002 18.655 145-149 26.900000000000002 27.500000000000004 26.76 18.84 150-151 26.2125 26.525 27.712500000000002 19.55 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.5 5 0.5 6 0.0 7 0.0 8 1.0 9 1.5 10 0.5 11 0.0 12 0.5 13 0.5 14 0.0 15 0.5 16 0.5 17 1.0 18 1.5 19 0.5 20 1.0 21 2.5 22 3.0 23 4.5 24 3.5 25 3.5 26 5.0 27 4.0 28 10.0 29 14.5 30 16.0 31 20.5 32 23.0 33 35.0 34 51.5 35 73.0 36 88.0 37 122.5 38 161.5 39 185.0 40 207.5 41 213.5 42 248.0 43 270.5 44 273.0 45 272.5 46 252.0 47 225.0 48 209.0 49 186.0 50 148.0 51 131.0 52 112.5 53 89.5 54 70.0 55 51.5 56 41.5 57 36.5 58 26.5 59 16.5 60 14.5 61 10.0 62 9.5 63 12.5 64 8.0 65 3.0 66 0.5 67 2.0 68 2.5 69 1.0 70 1.0 71 1.5 72 1.0 73 0.5 74 1.5 75 1.0 76 0.5 77 1.0 78 1.0 79 0.5 80 0.0 81 0.0 82 0.5 83 1.0 84 1.0 85 0.5 86 0.0 87 0.0 88 0.5 89 1.0 90 0.5 91 0.0 92 0.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.5 #Duplication Level Percentage of deduplicated Percentage of total 1 84.46107784431138 70.525 2 12.065868263473053 20.150000000000002 3 2.844311377245509 7.124999999999999 4 0.5089820359281437 1.7000000000000002 5 0.11976047904191617 0.5 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATGAATTGAGGGATGCTGTGCTACTTGTGTTTGCAAACAAGCAAGATCT 5 0.125 No Hit CATACAGAGAGGAGAAACAGGAGAAGAGCGCTATCTTACAACATTGTAAG 5 0.125 No Hit AGAACTTTGAAGGCCGAAGAGGGGAAAGGTTCCATGTGAACGGCACTTGC 5 0.125 No Hit AATCGACATGCTTGGACTTGAGACCTTCCCTGGCGTGAAGCGCATCACCA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.2625 0.0 0.0 0.0 0.0 82-83 0.3625 0.0 0.0 0.0 0.0 84-85 0.4625 0.0 0.0 0.0 0.0 86-87 0.6375 0.0 0.0 0.0 0.0 88-89 0.8875 0.0 0.0 0.0 0.0 90-91 1.0625 0.0 0.0 0.0 0.0 92-93 1.1749999999999998 0.0 0.0 0.0 0.0 94-95 1.4625 0.0 0.0 0.0 0.0 96-97 1.775 0.0 0.0 0.0 0.0 98-99 2.1125 0.0 0.0 0.0 0.0 100-101 2.4 0.0 0.0 0.0 0.0 102-103 2.9875 0.0 0.0 0.0 0.0 104-105 3.4000000000000004 0.0 0.0 0.0 0.0 106-107 3.9 0.0 0.0 0.0 0.0 108-109 4.475 0.0 0.0 0.0 0.0 110-111 4.975 0.0 0.0 0.0 0.0 112-113 5.5625 0.0 0.0 0.0 0.0 114-115 6.3 0.0 0.0 0.0 0.0 116-117 7.1 0.0 0.0 0.0 0.0 118-119 7.8375 0.0 0.0 0.0 0.0 120-121 8.675 0.0 0.0 0.0 0.0 122-123 9.4625 0.0 0.0 0.05 0.0 124-125 10.1875 0.0 0.0 0.05 0.0 126-127 10.8625 0.0 0.0 0.05 0.0 128-129 11.4375 0.0 0.0 0.05 0.0 130-131 12.0375 0.0 0.0 0.05 0.0 132-133 12.9 0.0 0.0 0.05 0.0 134-135 13.825 0.0 0.0 0.05 0.0 136-137 14.55 0.0 0.0 0.05 0.0 138-139 15.6125 0.0 0.0 0.05 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGCAAC 10 0.006830828 145.0 6 CAACTTT 10 0.006830828 145.0 9 TGCAACT 10 0.006830828 145.0 7 TATGTGC 10 0.006830828 145.0 3 TCGCGGC 10 0.006830828 145.0 145 TGTGCAA 10 0.006830828 145.0 5 >>END_MODULE Read 1923006 spots for SRR28623286.sra Written 1923006 spots for SRR28623286.sra Read 1923006 spots for SRR28623286.sra Written 1923006 spots for SRR28623286.sra Read 1923006 spots for SRR28623286.sra Written 1923006 spots for SRR28623286.sra Read 1923006 spots for SRR28623286.sra Written 1923006 spots for SRR28623286.sra Read 1923006 spots for SRR28623286.sra Written 1923006 spots for SRR28623286.sra Read 1923006 spots for SRR28623286.sra Written 1923006 spots for SRR28623286.sra Read 1923006 spots for SRR28623286.sra Written 1923006 spots for SRR28623286.sra Read 1923006 spots for SRR28623286.sra Written 1923006 spots for SRR28623286.sra Read 1923006 spots for SRR28623286.sra Written 1923006 spots for SRR28623286.sra Read 1923006 spots for SRR28623286.sra Written 1923006 spots for SRR28623286.sra Read 1923006 spots for SRR28623286.sra Written 1923006 spots for SRR28623286.sra Read 1923006 spots for SRR28623286.sra Written 1923006 spots for SRR28623286.sra Read 1923006 spots for SRR28623286.sra Written 1923006 spots for SRR28623286.sra Read 1923006 spots for SRR28623286.sra Written 1923006 spots for SRR28623286.sra Read 1923006 spots for SRR28623286.sra Written 1923006 spots for SRR28623286.sra Read 1923006 spots for SRR28623286.sra Written 1923006 spots for SRR28623286.sra Read 1923006 spots for SRR28623286.sra Written 1923006 spots for SRR28623286.sra Read 1923006 spots for SRR28623286.sra Written 1923006 spots for SRR28623286.sra Read 1923006 spots for SRR28623286.sra Written 1923006 spots for SRR28623286.sra Read 1923006 spots for SRR28623286.sra Written 1923006 spots for SRR28623286.sra SRR ids: ['SRR28623286.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_btrhzxqb SRR28623286.sra spots: 38460120 blocks: [[1, 1923006], [1923007, 3846012], [3846013, 5769018], [5769019, 7692024], [7692025, 9615030], [9615031, 11538036], [11538037, 13461042], [13461043, 15384048], [15384049, 17307054], [17307055, 19230060], [19230061, 21153066], [21153067, 23076072], [23076073, 24999078], [24999079, 26922084], [26922085, 28845090], [28845091, 30768096], [30768097, 32691102], [32691103, 34614108], [34614109, 36537114], [36537115, 38460120]] SRR28623286 file size 14203819 SRR28623286 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR28623286 SRR28623286_1.fastq SRR28623286_2.fastq Input file: SRR28623286_1.fastq Paired file: SRR28623286_2.fastq trimmed: SRR28623286-trimmed-pair1.fastq, SRR28623286-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 14:17:46 2025 >> started Tue Feb 11 14:18:44 2025 >> done (58.819s) 38460120 read pairs processed; of these: 30 ( 0.00%) short read pairs filtered out after trimming by size control 84081 ( 0.22%) empty read pairs filtered out after trimming by size control 38376009 (99.78%) read pairs available; of these: 7876784 (20.53%) trimmed read pairs available after processing 30499225 (79.47%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 11 0.00% 20 6 0.00% 21 4 0.00% 22 8 0.00% 23 2 0.00% 24 8 0.00% 25 9 0.00% 26 11 0.00% 27 5 0.00% 28 14 0.00% 29 21 0.00% 30 16 0.00% 31 21 0.00% 32 19 0.00% 33 30 0.00% 34 37 0.00% 35 34 0.00% 36 36 0.00% 37 31 0.00% 38 46 0.00% 39 57 0.00% 40 75 0.00% 41 95 0.00% 42 106 0.00% 43 116 0.00% 44 131 0.00% 45 152 0.00% 46 159 0.00% 47 181 0.00% 48 216 0.00% 49 296 0.00% 50 346 0.00% 51 412 0.00% 52 431 0.00% 53 489 0.00% 54 543 0.00% 55 648 0.00% 56 677 0.00% 57 840 0.00% 58 997 0.00% 59 1153 0.00% 60 1363 0.00% 61 1578 0.00% 62 1832 0.00% 63 1966 0.01% 64 2526 0.01% 65 2741 0.01% 66 3024 0.01% 67 3548 0.01% 68 3889 0.01% 69 4442 0.01% 70 5225 0.01% 71 5988 0.02% 72 6967 0.02% 73 8313 0.02% 74 9070 0.02% 75 10173 0.03% 76 11780 0.03% 77 12730 0.03% 78 14316 0.04% 79 15733 0.04% 80 17463 0.05% 81 19614 0.05% 82 21867 0.06% 83 24490 0.06% 84 27395 0.07% 85 30069 0.08% 86 32552 0.08% 87 35774 0.09% 88 37683 0.10% 89 40189 0.10% 90 42691 0.11% 91 45640 0.12% 92 49590 0.13% 93 52937 0.14% 94 57455 0.15% 95 61108 0.16% 96 64787 0.17% 97 68239 0.18% 98 71084 0.19% 99 73191 0.19% 100 75005 0.20% 101 78277 0.20% 102 80899 0.21% 103 85165 0.22% 104 88282 0.23% 105 93512 0.24% 106 96752 0.25% 107 99267 0.26% 108 101926 0.27% 109 103932 0.27% 110 105558 0.28% 111 107445 0.28% 112 110036 0.29% 113 112005 0.29% 114 116257 0.30% 115 121986 0.32% 116 122646 0.32% 117 125823 0.33% 118 128474 0.33% 119 129190 0.34% 120 131524 0.34% 121 132113 0.34% 122 134462 0.35% 123 135218 0.35% 124 138224 0.36% 125 140216 0.37% 126 142796 0.37% 127 146978 0.38% 128 148884 0.39% 129 150111 0.39% 130 151077 0.39% 131 150951 0.39% 132 151924 0.40% 133 153984 0.40% 134 152912 0.40% 135 154681 0.40% 136 156673 0.41% 137 159692 0.42% 138 162951 0.42% 139 163918 0.43% 140 162477 0.42% 141 163861 0.43% 142 165545 0.43% 143 163016 0.42% 144 164626 0.43% 145 166426 0.43% 146 164678 0.43% 147 166297 0.43% 148 169223 0.44% 149 169357 0.44% 150 170038 0.44% 151 30499225 79.47% 38376009 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=3.34 fanout-score-rank=26 prefix-density=0.24 prefix-fanout=2.6 sequence=GGCTTCTCCCATTTGAGGGGCTTGACAAC criterion=fanout-score sequence-density=0.03 sequence-density-rank=33 fanout-score=276.71 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=22.7 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTTGTCCCAGTAACTG criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=3.44 fanout-score-rank=21 prefix-density=0.21 prefix-fanout=3.1 sequence=TGCTTTGAGAGA criterion=fanout-score sequence-density=0.13 sequence-density-rank=6 fanout-score=28.65 fanout-score-rank=1 prefix-density=0.41 prefix-fanout=9.0 sequence=AGAAAATGGAAACCTTTCTATTCAC SRR28623286 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 14:19:25 Started mapping on | Feb 11 14:19:25 Finished on | Feb 11 14:22:54 Mapping speed, Million of reads per hour | 661.02 Number of input reads | 38376009 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 35488867 Uniquely mapped reads % | 92.48% Average mapped length | 289.03 Number of splices: Total | 26290320 Number of splices: Annotated (sjdb) | 25679905 Number of splices: GT/AG | 25876135 Number of splices: GC/AG | 301908 Number of splices: AT/AC | 25690 Number of splices: Non-canonical | 86587 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.04% Deletion average length | 2.93 Insertion rate per base | 0.03% Insertion average length | 2.24 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 774629 % of reads mapped to multiple loci | 2.02% Number of reads mapped to too many loci | 1061495 % of reads mapped to too many loci | 2.77% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.19% % of reads unmapped: other | 0.55% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2112513 2112513 2112513 N_multimapping 774629 774629 774629 N_noFeature 1568389 34884555 1819689 N_ambiguous 507461 5057 150391 UnstrandedReadsAssigned:33413017 PositiveStrandReadsAssigned:599255 NegativeStrandReadsAssigned:33518787 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR28623286 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR28623286-trimmed-pair1.fastq SRR28623286-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 38,376,009 reads, 34,703,948 reads pseudoaligned [quant] estimated average fragment length: 212.369 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,115 rounds 52401 SRR28623286.ke.tsv 34699 SRR28623286.se.tsv 87100 total ==> SRR28623286.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1806.63 1748 32.0776 Potri.005G024800.1.v4.1 1035 823.631 540 21.7366 Potri.004G059700.1.v4.1 961 749.637 88 3.8919 Potri.007G009000.2.v4.1 1416 1204.63 0 0 Potri.003G141000.2.v4.1 2943 2731.63 458.324 5.56263 Potri.016G087400.1.v4.1 270 100.184 2392.01 791.581 Potri.015G069301.1.v4.1 564 356.215 0 0 Potri.010G195200.1.v4.1 1773 1561.63 31 0.658132 Potri.012G127500.1.v4.1 977 765.637 2180 94.3982 ==> SRR28623286.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 3110 Potri.001G233950.v4.1 5 Potri.001G122700.v4.1 746 Potri.001G212900.v4.1 5 Potri.001G182400.v4.1 59 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR28623286 completed mapping pipeline successfully