Starting /dee2/code/volunteer_pipeline.sh SRR28623287 current disk space = 3049804505088 free memory = 1578856200 SRR28623287 SRAfilesize 62bea45a85dc19db4537f8b5787c972c SRR28623287.sra SRR28623287.sra file validated SRR28623287 is paired end SRR28623287 is conventional basespace SRR28623287 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623287_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4085 37.0 37.0 37.0 37.0 37.0 2 36.4595 37.0 37.0 37.0 37.0 37.0 3 36.5725 37.0 37.0 37.0 37.0 37.0 4 36.5975 37.0 37.0 37.0 37.0 37.0 5 36.6095 37.0 37.0 37.0 37.0 37.0 6 36.65 37.0 37.0 37.0 37.0 37.0 7 36.5915 37.0 37.0 37.0 37.0 37.0 8 36.5115 37.0 37.0 37.0 37.0 37.0 9 36.6365 37.0 37.0 37.0 37.0 37.0 10-14 36.56150000000001 37.0 37.0 37.0 37.0 37.0 15-19 36.5131 37.0 37.0 37.0 37.0 37.0 20-24 36.4949 37.0 37.0 37.0 37.0 37.0 25-29 36.421099999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.4458 37.0 37.0 37.0 37.0 37.0 35-39 36.400600000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.364999999999995 37.0 37.0 37.0 37.0 37.0 45-49 36.3526 37.0 37.0 37.0 37.0 37.0 50-54 36.3024 37.0 37.0 37.0 37.0 37.0 55-59 36.304500000000004 37.0 37.0 37.0 37.0 37.0 60-64 36.305099999999996 37.0 37.0 37.0 37.0 37.0 65-69 36.27040000000001 37.0 37.0 37.0 37.0 37.0 70-74 36.164100000000005 37.0 37.0 37.0 37.0 37.0 75-79 36.1081 37.0 37.0 37.0 37.0 37.0 80-84 36.0188 37.0 37.0 37.0 37.0 37.0 85-89 36.0544 37.0 37.0 37.0 37.0 37.0 90-94 36.0158 37.0 37.0 37.0 37.0 37.0 95-99 35.8885 37.0 37.0 37.0 37.0 37.0 100-104 35.932500000000005 37.0 37.0 37.0 37.0 37.0 105-109 35.846500000000006 37.0 37.0 37.0 37.0 37.0 110-114 35.7714 37.0 37.0 37.0 37.0 37.0 115-119 35.8568 37.0 37.0 37.0 37.0 37.0 120-124 35.689499999999995 37.0 37.0 37.0 37.0 37.0 125-129 35.6231 37.0 37.0 37.0 37.0 37.0 130-134 35.712900000000005 37.0 37.0 37.0 37.0 37.0 135-139 35.550599999999996 37.0 37.0 37.0 37.0 37.0 140-144 35.213499999999996 37.0 37.0 37.0 27.4 37.0 145-149 35.2345 37.0 37.0 37.0 29.8 37.0 150-151 34.857749999999996 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 0.0 21 2.0 22 5.0 23 0.0 24 7.0 25 7.0 26 3.0 27 8.0 28 14.0 29 18.0 30 25.0 31 44.0 32 60.0 33 89.0 34 176.0 35 426.0 36 2868.0 37 247.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.13654618473896 13.60441767068273 8.483935742971887 43.77510040160642 2 17.224999999999998 16.25 37.675 28.849999999999998 3 17.075000000000003 19.125 27.800000000000004 36.0 4 20.075000000000003 27.35 25.05 27.525 5 23.575 33.324999999999996 24.6 18.5 6 20.724999999999998 35.375 22.575 21.325 7 15.275 28.299999999999997 40.5 15.925 8 18.575 27.775 30.9 22.75 9 17.775 24.675 33.4 24.15 10-14 19.08 30.520000000000003 27.935 22.465 15-19 19.785 28.88 28.205000000000002 23.13 20-24 19.564999999999998 29.709999999999997 27.029999999999998 23.695 25-29 19.23 29.160000000000004 28.33 23.28 30-34 19.36 28.67 27.650000000000002 24.32 35-39 19.38 29.4 27.105 24.115000000000002 40-44 19.66 28.98 27.51 23.849999999999998 45-49 19.835 28.705000000000002 27.675 23.785 50-54 19.735 28.970000000000002 27.779999999999998 23.515 55-59 19.814999999999998 29.375 27.779999999999998 23.03 60-64 19.48 29.26 27.35 23.91 65-69 20.145 28.435 27.839999999999996 23.580000000000002 70-74 20.495 28.854999999999997 27.055 23.595 75-79 19.595000000000002 29.57 27.445000000000004 23.39 80-84 20.085 28.48 27.810000000000002 23.625 85-89 20.215 29.125 27.465 23.195 90-94 19.74 28.62 27.639999999999997 24.0 95-99 19.985 29.110000000000003 27.515 23.39 100-104 20.495 28.565 27.21 23.73 105-109 20.07 28.275 27.855 23.799999999999997 110-114 20.835 29.375 27.055 22.735 115-119 21.09 27.865000000000002 27.500000000000004 23.544999999999998 120-124 20.3 29.14 26.765 23.794999999999998 125-129 20.815 28.854999999999997 26.700000000000003 23.630000000000003 130-134 20.630000000000003 28.38 26.705000000000002 24.285 135-139 20.715 28.410000000000004 26.474999999999998 24.4 140-144 21.015 28.15 27.1 23.735 145-149 20.8 28.499999999999996 26.450000000000003 24.25 150-151 21.25 28.025 26.2125 24.5125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.5 12 1.0 13 0.5 14 1.0 15 1.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 1.5 22 2.5 23 1.5 24 2.5 25 2.5 26 7.5 27 11.0 28 11.0 29 21.5 30 33.0 31 41.5 32 47.0 33 56.5 34 67.5 35 74.0 36 92.5 37 119.0 38 138.0 39 160.0 40 192.0 41 220.5 42 243.5 43 260.0 44 269.0 45 266.5 46 247.0 47 233.0 48 211.5 49 184.5 50 156.0 51 123.0 52 109.0 53 93.0 54 69.5 55 49.5 56 40.0 57 30.5 58 22.0 59 20.0 60 15.5 61 14.5 62 11.5 63 6.0 64 4.0 65 3.5 66 3.0 67 1.5 68 0.5 69 1.0 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.4 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 86.4 #Duplication Level Percentage of deduplicated Percentage of total 1 86.54513888888889 74.775 2 11.60300925925926 20.05 3 1.5046296296296295 3.9 4 0.26041666666666663 0.8999999999999999 5 0.08680555555555555 0.375 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TGCTTCTTCTTTAGGAACTCCCATTTCCCTGTAGGCCAAGTGCCTCCCAT 5 0.125 No Hit GTGCTGCCCACGCACTCGGAGACCCCAGTAGTGACGGAGACCACGGTGAT 5 0.125 No Hit ACCGATTTCACATAGATAAACCAGAGTTAATAATTATTATTTTGTTTTCG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.1875 0.0 0.0 0.0 0.0 74-75 0.275 0.0 0.0 0.0 0.0 76-77 0.3375 0.0 0.0 0.0 0.0 78-79 0.35 0.0 0.0 0.0 0.0 80-81 0.4 0.0 0.0 0.0 0.0 82-83 0.4 0.0 0.0 0.0 0.0 84-85 0.4375 0.0 0.0 0.0 0.0 86-87 0.55 0.0 0.0 0.0 0.0 88-89 0.7125 0.0 0.0 0.0 0.0 90-91 0.85 0.0 0.0 0.0 0.0 92-93 1.0375 0.0 0.0 0.0 0.0 94-95 1.2 0.0 0.0 0.0 0.0 96-97 1.5125000000000002 0.0 0.0 0.0 0.0 98-99 1.9125 0.0 0.0 0.0 0.0 100-101 2.2375 0.0 0.0 0.0 0.0 102-103 2.5625 0.0 0.0 0.0 0.0 104-105 2.9375 0.0 0.0 0.0 0.0 106-107 3.275 0.0 0.0 0.0 0.0 108-109 3.6624999999999996 0.0 0.0 0.0 0.0 110-111 3.975 0.0 0.0 0.0 0.0 112-113 4.3625 0.0 0.0 0.0 0.0 114-115 5.0 0.0 0.0 0.0 0.0 116-117 5.7 0.0 0.0 0.0 0.0 118-119 6.487500000000001 0.0 0.0 0.0 0.0 120-121 7.0625 0.0 0.0 0.0 0.0 122-123 7.6625 0.0 0.0 0.0 0.0 124-125 8.2625 0.0 0.0 0.0 0.0 126-127 9.025 0.0 0.0 0.0 0.0 128-129 9.625 0.0 0.0 0.0 0.0 130-131 10.325 0.0 0.0 0.0 0.0 132-133 10.9875 0.0 0.0 0.0 0.0 134-135 11.625 0.0 0.0 0.0 0.0 136-137 12.35 0.0 0.0 0.0 0.0 138-139 13.2875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR28623287 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623287_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1035 37.0 37.0 37.0 37.0 37.0 2 36.236 37.0 37.0 37.0 37.0 37.0 3 36.1755 37.0 37.0 37.0 37.0 37.0 4 36.212 37.0 37.0 37.0 37.0 37.0 5 36.3625 37.0 37.0 37.0 37.0 37.0 6 36.2805 37.0 37.0 37.0 37.0 37.0 7 36.383 37.0 37.0 37.0 37.0 37.0 8 36.2425 37.0 37.0 37.0 37.0 37.0 9 36.213 37.0 37.0 37.0 37.0 37.0 10-14 36.184999999999995 37.0 37.0 37.0 37.0 37.0 15-19 36.19109999999999 37.0 37.0 37.0 37.0 37.0 20-24 36.1271 37.0 37.0 37.0 37.0 37.0 25-29 36.09929999999999 37.0 37.0 37.0 37.0 37.0 30-34 35.9893 37.0 37.0 37.0 37.0 37.0 35-39 36.038799999999995 37.0 37.0 37.0 37.0 37.0 40-44 36.00169999999999 37.0 37.0 37.0 37.0 37.0 45-49 36.01610000000001 37.0 37.0 37.0 37.0 37.0 50-54 35.96470000000001 37.0 37.0 37.0 37.0 37.0 55-59 35.840999999999994 37.0 37.0 37.0 37.0 37.0 60-64 35.8391 37.0 37.0 37.0 37.0 37.0 65-69 35.8587 37.0 37.0 37.0 37.0 37.0 70-74 35.83970000000001 37.0 37.0 37.0 37.0 37.0 75-79 35.8528 37.0 37.0 37.0 37.0 37.0 80-84 35.7381 37.0 37.0 37.0 37.0 37.0 85-89 35.627599999999994 37.0 37.0 37.0 37.0 37.0 90-94 35.6018 37.0 37.0 37.0 37.0 37.0 95-99 35.5997 37.0 37.0 37.0 37.0 37.0 100-104 35.51780000000001 37.0 37.0 37.0 37.0 37.0 105-109 35.5248 37.0 37.0 37.0 37.0 37.0 110-114 35.541900000000005 37.0 37.0 37.0 37.0 37.0 115-119 35.4209 37.0 37.0 37.0 37.0 37.0 120-124 35.4159 37.0 37.0 37.0 34.6 37.0 125-129 34.9976 37.0 37.0 37.0 29.8 37.0 130-134 35.291999999999994 37.0 37.0 37.0 34.6 37.0 135-139 35.1177 37.0 37.0 37.0 27.4 37.0 140-144 35.084 37.0 37.0 37.0 27.4 37.0 145-149 34.9605 37.0 37.0 37.0 25.0 37.0 150-151 34.561499999999995 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 3.0 13 3.0 14 4.0 15 2.0 16 3.0 17 1.0 18 1.0 19 2.0 20 2.0 21 5.0 22 4.0 23 5.0 24 8.0 25 9.0 26 14.0 27 17.0 28 14.0 29 21.0 30 32.0 31 43.0 32 70.0 33 114.0 34 231.0 35 652.0 36 2498.0 37 242.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.775 18.875 13.025 27.325 2 26.85 24.675 31.4 17.075000000000003 3 22.1 26.55 32.025 19.325 4 23.95 32.925 24.575 18.55 5 25.025 36.075 22.425 16.475 6 20.375 38.425 23.974999999999998 17.224999999999998 7 21.15 21.45 39.775 17.625 8 21.4 26.025 28.849999999999998 23.724999999999998 9 22.925 25.2 30.3 21.575 10-14 23.84 29.07 26.41 20.68 15-19 23.395 28.275 28.015 20.315 20-24 23.25 28.815 27.725 20.21 25-29 23.695 27.87 27.765 20.669999999999998 30-34 22.715 28.64 28.03 20.615 35-39 22.75 28.59 27.939999999999998 20.72 40-44 23.599999999999998 28.799999999999997 27.57 20.03 45-49 23.29 27.400000000000002 28.655 20.655 50-54 23.785 28.000000000000004 27.265 20.95 55-59 23.515 27.565 28.485 20.435 60-64 23.544999999999998 27.544999999999998 28.000000000000004 20.91 65-69 23.02 28.389999999999997 28.110000000000003 20.48 70-74 23.200000000000003 28.17 27.92 20.71 75-79 23.455000000000002 27.405 28.13 21.01 80-84 23.465 28.465 27.994999999999997 20.075000000000003 85-89 23.665 27.889999999999997 28.465 19.98 90-94 23.45 28.494999999999997 28.044999999999998 20.01 95-99 23.544999999999998 28.349999999999998 28.189999999999998 19.915 100-104 23.68 27.91 28.28 20.13 105-109 24.22 27.98 27.98 19.82 110-114 24.15 27.665 27.485 20.7 115-119 25.509999999999998 27.139999999999997 27.845 19.505 120-124 24.575 28.244999999999997 28.15 19.03 125-129 25.185000000000002 28.115000000000002 27.04 19.66 130-134 25.52 28.355000000000004 27.265 18.86 135-139 25.785000000000004 28.355000000000004 27.29 18.57 140-144 25.619999999999997 28.199999999999996 26.790000000000003 19.39 145-149 26.07 28.595 26.955000000000002 18.38 150-151 26.0125 27.8125 27.05 19.125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 1.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.0 16 0.0 17 1.5 18 1.5 19 0.0 20 0.5 21 2.0 22 2.5 23 2.5 24 4.0 25 7.0 26 7.5 27 8.5 28 13.5 29 12.5 30 17.0 31 24.5 32 33.5 33 44.5 34 58.5 35 85.0 36 96.0 37 117.0 38 130.0 39 158.0 40 199.0 41 215.0 42 242.0 43 249.0 44 256.0 45 259.0 46 250.5 47 253.0 48 251.5 49 211.5 50 165.0 51 135.5 52 102.0 53 80.5 54 65.5 55 50.5 56 41.5 57 34.5 58 23.5 59 15.0 60 12.5 61 12.5 62 8.0 63 5.5 64 6.0 65 4.0 66 2.0 67 3.5 68 2.5 69 2.0 70 2.0 71 1.0 72 1.5 73 0.5 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 86.775 #Duplication Level Percentage of deduplicated Percentage of total 1 87.03543647363871 75.52499999999999 2 11.1495246326707 19.35 3 1.4405070584845865 3.75 4 0.2881014116969173 1.0 5 0.08643042350907519 0.375 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCAACATTGTCTGCAAGAAGGCCGATGTAGACATGAACAAGAGAGCTGG 5 0.125 No Hit GACTAGAAGACTAGCTGTTTTAAAGCAGAATGGTAGGCGTTGAATCTGGC 5 0.125 No Hit CCTAGCAGTGCATCATTTCTGAAGTAGTATCATCCTAGCTCACACACCAG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.1875 0.0 0.0 0.0 0.0 74-75 0.275 0.0 0.0 0.0 0.0 76-77 0.3125 0.0 0.0 0.0 0.0 78-79 0.325 0.0 0.0 0.0 0.0 80-81 0.375 0.0 0.0 0.0 0.0 82-83 0.4 0.0 0.0 0.0 0.0 84-85 0.4375 0.0 0.0 0.0 0.0 86-87 0.55 0.0 0.0 0.0 0.0 88-89 0.7125 0.0 0.0 0.0 0.0 90-91 0.85 0.0 0.0 0.0 0.0 92-93 1.0375 0.0 0.0 0.0 0.0 94-95 1.2 0.0 0.0 0.0 0.0 96-97 1.5125000000000002 0.0 0.0 0.0 0.0 98-99 1.9125 0.0 0.0 0.0 0.0 100-101 2.2249999999999996 0.0 0.0 0.0 0.0 102-103 2.5125 0.0 0.0 0.0 0.0 104-105 2.8875 0.0 0.0 0.0 0.0 106-107 3.225 0.0 0.0 0.0 0.0 108-109 3.6125 0.0 0.0 0.0 0.0 110-111 3.925 0.0 0.0 0.0 0.0 112-113 4.3125 0.0 0.0 0.0 0.0 114-115 4.9375 0.0 0.0 0.0 0.0 116-117 5.6375 0.0 0.0 0.0 0.0 118-119 6.4375 0.0 0.0 0.0 0.0 120-121 7.0125 0.0 0.0 0.0 0.0 122-123 7.6125 0.0 0.0 0.0 0.0 124-125 8.1875 0.0 0.0 0.0 0.0 126-127 8.95 0.0 0.0 0.0 0.0 128-129 9.5375 0.0 0.0 0.0 0.0 130-131 10.225000000000001 0.0 0.0 0.0 0.0 132-133 10.9 0.0 0.0 0.0 0.0 134-135 11.5 0.0 0.0 0.0 0.0 136-137 12.15 0.0 0.0 0.0 0.0 138-139 13.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGAGGAG 20 0.00593511 29.0 110-114 >>END_MODULE Read 1575290 spots for SRR28623287.sra Written 1575290 spots for SRR28623287.sra Read 1575290 spots for SRR28623287.sra Written 1575290 spots for SRR28623287.sra Read 1575290 spots for SRR28623287.sra Written 1575290 spots for SRR28623287.sra Read 1575290 spots for SRR28623287.sra Written 1575290 spots for SRR28623287.sra Read 1575290 spots for SRR28623287.sra Written 1575290 spots for SRR28623287.sra Read 1575290 spots for SRR28623287.sra Written 1575290 spots for SRR28623287.sra Read 1575290 spots for SRR28623287.sra Written 1575290 spots for SRR28623287.sra Read 1575290 spots for SRR28623287.sra Written 1575290 spots for SRR28623287.sra Read 1575290 spots for SRR28623287.sra Written 1575290 spots for SRR28623287.sra Read 1575290 spots for SRR28623287.sra Written 1575290 spots for SRR28623287.sra Read 1575290 spots for SRR28623287.sra Written 1575290 spots for SRR28623287.sra Read 1575290 spots for SRR28623287.sra Written 1575290 spots for SRR28623287.sra Read 1575290 spots for SRR28623287.sra Written 1575290 spots for SRR28623287.sra Read 1575290 spots for SRR28623287.sra Written 1575290 spots for SRR28623287.sra Read 1575303 spots for SRR28623287.sra Written 1575303 spots for SRR28623287.sra Read 1575290 spots for SRR28623287.sra Written 1575290 spots for SRR28623287.sra Read 1575290 spots for SRR28623287.sra Written 1575290 spots for SRR28623287.sra Read 1575290 spots for SRR28623287.sra Written 1575290 spots for SRR28623287.sra Read 1575290 spots for SRR28623287.sra Written 1575290 spots for SRR28623287.sra Read 1575290 spots for SRR28623287.sra Written 1575290 spots for SRR28623287.sra SRR ids: ['SRR28623287.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5yo5l2kj SRR28623287.sra spots: 31505813 blocks: [[1, 1575290], [1575291, 3150580], [3150581, 4725870], [4725871, 6301160], [6301161, 7876450], [7876451, 9451740], [9451741, 11027030], [11027031, 12602320], [12602321, 14177610], [14177611, 15752900], [15752901, 17328190], [17328191, 18903480], [18903481, 20478770], [20478771, 22054060], [22054061, 23629350], [23629351, 25204640], [25204641, 26779930], [26779931, 28355220], [28355221, 29930510], [29930511, 31505813]] SRR28623287 file size 11633540 SRR28623287 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR28623287 SRR28623287_1.fastq SRR28623287_2.fastq Input file: SRR28623287_1.fastq Paired file: SRR28623287_2.fastq trimmed: SRR28623287-trimmed-pair1.fastq, SRR28623287-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 15:18:41 2025 >> started Tue Feb 11 15:19:34 2025 >> done (52.732s) 31505813 read pairs processed; of these: 32 ( 0.00%) short read pairs filtered out after trimming by size control 8692 ( 0.03%) empty read pairs filtered out after trimming by size control 31497089 (99.97%) read pairs available; of these: 5326752 (16.91%) trimmed read pairs available after processing 26170337 (83.09%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 6 0.00% 20 2 0.00% 21 5 0.00% 22 5 0.00% 23 8 0.00% 24 9 0.00% 25 7 0.00% 26 11 0.00% 27 10 0.00% 28 8 0.00% 29 14 0.00% 30 13 0.00% 31 23 0.00% 32 12 0.00% 33 30 0.00% 34 31 0.00% 35 24 0.00% 36 35 0.00% 37 51 0.00% 38 46 0.00% 39 51 0.00% 40 53 0.00% 41 66 0.00% 42 79 0.00% 43 75 0.00% 44 76 0.00% 45 97 0.00% 46 133 0.00% 47 137 0.00% 48 184 0.00% 49 195 0.00% 50 218 0.00% 51 234 0.00% 52 292 0.00% 53 297 0.00% 54 382 0.00% 55 396 0.00% 56 419 0.00% 57 535 0.00% 58 610 0.00% 59 734 0.00% 60 854 0.00% 61 922 0.00% 62 1051 0.00% 63 1236 0.00% 64 1438 0.00% 65 1551 0.00% 66 1716 0.01% 67 2011 0.01% 68 2333 0.01% 69 2577 0.01% 70 3061 0.01% 71 3441 0.01% 72 3969 0.01% 73 4575 0.01% 74 5151 0.02% 75 5689 0.02% 76 6364 0.02% 77 7041 0.02% 78 7840 0.02% 79 9088 0.03% 80 9766 0.03% 81 11077 0.04% 82 12447 0.04% 83 13787 0.04% 84 15454 0.05% 85 17009 0.05% 86 18362 0.06% 87 19852 0.06% 88 21960 0.07% 89 23462 0.07% 90 24983 0.08% 91 27487 0.09% 92 29325 0.09% 93 32021 0.10% 94 34063 0.11% 95 36518 0.12% 96 39226 0.12% 97 40970 0.13% 98 43114 0.14% 99 44921 0.14% 100 47501 0.15% 101 49002 0.16% 102 51233 0.16% 103 54864 0.17% 104 56612 0.18% 105 59739 0.19% 106 62156 0.20% 107 63694 0.20% 108 66192 0.21% 109 68123 0.22% 110 69363 0.22% 111 70946 0.23% 112 73485 0.23% 113 74576 0.24% 114 77861 0.25% 115 80038 0.25% 116 81524 0.26% 117 83828 0.27% 118 86079 0.27% 119 86497 0.27% 120 89129 0.28% 121 90134 0.29% 122 91499 0.29% 123 93320 0.30% 124 96143 0.31% 125 97069 0.31% 126 98693 0.31% 127 100818 0.32% 128 102010 0.32% 129 103145 0.33% 130 105104 0.33% 131 104497 0.33% 132 106057 0.34% 133 107503 0.34% 134 107135 0.34% 135 109922 0.35% 136 111785 0.35% 137 112444 0.36% 138 113859 0.36% 139 114793 0.36% 140 115576 0.37% 141 116055 0.37% 142 117813 0.37% 143 117611 0.37% 144 118708 0.38% 145 120245 0.38% 146 119736 0.38% 147 120770 0.38% 148 122703 0.39% 149 122641 0.39% 150 123196 0.39% 151 26170337 83.09% 31497089 reads passed initial QC criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=2.60 fanout-score-rank=38 prefix-density=0.13 prefix-fanout=2.5 sequence=GTGGACTCCTTCTGGAT criterion=fanout-score sequence-density=0.07 sequence-density-rank=16 fanout-score=364.41 fanout-score-rank=1 prefix-density=0.99 prefix-fanout=24.4 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=3.66 fanout-score-rank=30 prefix-density=0.17 prefix-fanout=3.0 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.08 sequence-density-rank=8 fanout-score=378.83 fanout-score-rank=1 prefix-density=0.98 prefix-fanout=29.7 sequence=AAGAAGAAGAAA SRR28623287 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 15:20:24 Started mapping on | Feb 11 15:20:24 Finished on | Feb 11 15:24:01 Mapping speed, Million of reads per hour | 522.53 Number of input reads | 31497089 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 29550662 Uniquely mapped reads % | 93.82% Average mapped length | 291.37 Number of splices: Total | 26074517 Number of splices: Annotated (sjdb) | 25458981 Number of splices: GT/AG | 25624671 Number of splices: GC/AG | 343960 Number of splices: AT/AC | 26249 Number of splices: Non-canonical | 79637 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.03% Deletion average length | 2.97 Insertion rate per base | 0.03% Insertion average length | 2.40 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 757303 % of reads mapped to multiple loci | 2.40% Number of reads mapped to too many loci | 186066 % of reads mapped to too many loci | 0.59% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.00% % of reads unmapped: other | 0.18% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1189124 1189124 1189124 N_multimapping 757303 757303 757303 N_noFeature 1297781 29188456 1468271 N_ambiguous 371349 2881 177566 UnstrandedReadsAssigned:27881532 PositiveStrandReadsAssigned:359325 NegativeStrandReadsAssigned:27904825 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR28623287 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR28623287-trimmed-pair1.fastq SRR28623287-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 31,497,089 reads, 28,201,562 reads pseudoaligned [quant] estimated average fragment length: 228.336 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,109 rounds 52401 SRR28623287.ke.tsv 34699 SRR28623287.se.tsv 87100 total ==> SRR28623287.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1790.66 1876 36.9043 Potri.005G024800.1.v4.1 1035 807.664 3100 135.204 Potri.004G059700.1.v4.1 961 733.685 104 4.99323 Potri.007G009000.2.v4.1 1416 1188.66 0 0 Potri.003G141000.2.v4.1 2943 2715.66 978.001 12.6859 Potri.016G087400.1.v4.1 270 95.2628 2276.95 841.953 Potri.015G069301.1.v4.1 564 342.964 0 0 Potri.010G195200.1.v4.1 1773 1545.66 158 3.60081 Potri.012G127500.1.v4.1 977 749.678 9362 439.898 ==> SRR28623287.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1109 Potri.001G233950.v4.1 3 Potri.001G122700.v4.1 622 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 17 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 6 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR28623287 completed mapping pipeline successfully