Starting /dee2/code/volunteer_pipeline.sh SRR28623288 current disk space = 3049933791232 free memory = 1484378836 SRR28623288 SRAfilesize 0d782ddab6df918ed9fa2b2dc9c438c2 SRR28623288.sra SRR28623288.sra file validated SRR28623288 is paired end SRR28623288 is conventional basespace SRR28623288 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623288_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.401 37.0 37.0 37.0 37.0 37.0 2 36.435 37.0 37.0 37.0 37.0 37.0 3 36.5955 37.0 37.0 37.0 37.0 37.0 4 36.6435 37.0 37.0 37.0 37.0 37.0 5 36.6805 37.0 37.0 37.0 37.0 37.0 6 36.7805 37.0 37.0 37.0 37.0 37.0 7 36.649 37.0 37.0 37.0 37.0 37.0 8 36.4935 37.0 37.0 37.0 37.0 37.0 9 36.643 37.0 37.0 37.0 37.0 37.0 10-14 36.6113 37.0 37.0 37.0 37.0 37.0 15-19 36.567299999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.580200000000005 37.0 37.0 37.0 37.0 37.0 25-29 36.5125 37.0 37.0 37.0 37.0 37.0 30-34 36.5125 37.0 37.0 37.0 37.0 37.0 35-39 36.4473 37.0 37.0 37.0 37.0 37.0 40-44 36.4179 37.0 37.0 37.0 37.0 37.0 45-49 36.363 37.0 37.0 37.0 37.0 37.0 50-54 36.3507 37.0 37.0 37.0 37.0 37.0 55-59 36.26989999999999 37.0 37.0 37.0 37.0 37.0 60-64 36.313599999999994 37.0 37.0 37.0 37.0 37.0 65-69 36.25790000000001 37.0 37.0 37.0 37.0 37.0 70-74 36.1922 37.0 37.0 37.0 37.0 37.0 75-79 36.1405 37.0 37.0 37.0 37.0 37.0 80-84 36.0584 37.0 37.0 37.0 37.0 37.0 85-89 36.159499999999994 37.0 37.0 37.0 37.0 37.0 90-94 36.12259999999999 37.0 37.0 37.0 37.0 37.0 95-99 35.9209 37.0 37.0 37.0 37.0 37.0 100-104 36.026799999999994 37.0 37.0 37.0 37.0 37.0 105-109 36.0232 37.0 37.0 37.0 37.0 37.0 110-114 35.915 37.0 37.0 37.0 37.0 37.0 115-119 35.9596 37.0 37.0 37.0 37.0 37.0 120-124 35.7693 37.0 37.0 37.0 37.0 37.0 125-129 35.7441 37.0 37.0 37.0 37.0 37.0 130-134 35.9236 37.0 37.0 37.0 37.0 37.0 135-139 35.7506 37.0 37.0 37.0 37.0 37.0 140-144 35.4812 37.0 37.0 37.0 37.0 37.0 145-149 35.4971 37.0 37.0 37.0 37.0 37.0 150-151 35.27475 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 0.0 22 0.0 23 3.0 24 3.0 25 5.0 26 8.0 27 2.0 28 13.0 29 18.0 30 29.0 31 37.0 32 64.0 33 86.0 34 134.0 35 370.0 36 2932.0 37 295.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.4110275689223 12.606516290726816 9.197994987468672 43.7844611528822 2 17.375 15.225 38.574999999999996 28.825 3 17.849999999999998 17.9 27.3 36.95 4 22.05 26.974999999999998 24.8 26.174999999999997 5 23.35 33.125 24.65 18.875 6 20.275000000000002 36.575 22.325 20.825 7 15.024999999999999 28.999999999999996 40.325 15.65 8 18.75 26.224999999999998 31.95 23.075000000000003 9 17.150000000000002 25.1 34.575 23.175 10-14 19.45 30.125 27.725 22.7 15-19 20.064999999999998 28.78 27.46 23.695 20-24 19.505 28.79 28.035 23.669999999999998 25-29 19.285 29.14 27.584999999999997 23.990000000000002 30-34 19.139999999999997 28.444999999999997 28.095 24.32 35-39 19.555 29.165000000000003 27.99 23.29 40-44 19.89 28.544999999999998 28.565 23.0 45-49 19.994999999999997 28.49 27.825 23.69 50-54 19.82 28.77 28.084999999999997 23.325000000000003 55-59 19.63 28.925 28.185 23.26 60-64 19.78 28.815 27.355 24.05 65-69 19.805 29.215000000000003 26.995 23.985 70-74 19.835 29.515 26.745 23.905 75-79 19.67 28.835 28.044999999999998 23.45 80-84 19.31 28.71 27.99 23.990000000000002 85-89 20.294999999999998 28.035 28.235 23.435 90-94 20.785 28.59 27.134999999999998 23.49 95-99 20.544999999999998 28.715000000000003 27.725 23.015 100-104 20.544999999999998 28.544999999999998 27.32 23.59 105-109 20.485 28.235 27.715 23.565 110-114 20.16 28.09 27.500000000000004 24.25 115-119 19.955000000000002 28.660000000000004 28.125 23.26 120-124 21.04 27.88 27.315 23.765 125-129 20.52 28.675 27.284999999999997 23.52 130-134 19.935 28.53 27.939999999999998 23.595 135-139 20.1 28.749999999999996 27.205000000000002 23.945 140-144 20.715 28.199999999999996 27.250000000000004 23.835 145-149 20.16 28.49 26.845000000000002 24.505 150-151 20.674999999999997 27.950000000000003 26.75 24.625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 1.0 20 0.5 21 1.0 22 1.5 23 2.0 24 2.5 25 2.0 26 1.5 27 3.0 28 9.0 29 17.5 30 26.5 31 35.0 32 44.5 33 54.0 34 67.0 35 82.5 36 92.5 37 105.5 38 122.0 39 159.5 40 212.0 41 232.5 42 238.0 43 252.5 44 277.5 45 274.0 46 262.0 47 259.5 48 241.0 49 202.0 50 149.5 51 128.0 52 110.5 53 75.5 54 59.5 55 49.5 56 34.5 57 29.5 58 19.0 59 12.5 60 10.5 61 8.0 62 8.0 63 6.5 64 4.5 65 2.0 66 2.5 67 3.0 68 1.0 69 1.5 70 1.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.25 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.725 #Duplication Level Percentage of deduplicated Percentage of total 1 85.01032753024491 72.02499999999999 2 12.393036293892004 21.0 3 2.183534966066686 5.55 4 0.3835939805252287 1.3 5 0.029507229271171435 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TGGAAAACTGAGTGTGCACGTGCTTCATGATCATCTGCACTTCAAGCGGA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.1625 0.0 0.0 0.0 0.0 88-89 0.2625 0.0 0.0 0.0 0.0 90-91 0.4125 0.0 0.0 0.0 0.0 92-93 0.5625 0.0 0.0 0.0 0.0 94-95 0.7875 0.0 0.0 0.0 0.0 96-97 1.075 0.0 0.0 0.0 0.0 98-99 1.225 0.0 0.0 0.0 0.0 100-101 1.375 0.0 0.0 0.0 0.0 102-103 1.7 0.0 0.0 0.0 0.0 104-105 2.0 0.0 0.0 0.0 0.0 106-107 2.2249999999999996 0.0 0.0 0.0 0.0 108-109 2.5625 0.0 0.0 0.0 0.0 110-111 2.7375 0.0 0.0 0.0 0.0 112-113 3.0375 0.0 0.0 0.0 0.0 114-115 3.375 0.0 0.0 0.0 0.0 116-117 3.75 0.0 0.0 0.0 0.0 118-119 4.175000000000001 0.0 0.0 0.0 0.0 120-121 4.6 0.0 0.0 0.0 0.0 122-123 5.0 0.0 0.0 0.0 0.0 124-125 5.5375 0.0 0.0 0.0 0.0 126-127 6.025 0.0 0.0 0.0 0.0 128-129 6.55 0.0 0.0 0.0 0.0 130-131 7.1875 0.0 0.0 0.0 0.0 132-133 7.512499999999999 0.0 0.0 0.0 0.0 134-135 8.2 0.0 0.0 0.0 0.0 136-137 9.0 0.0 0.0 0.0 0.0 138-139 9.6375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCAGCTC 10 0.006830828 145.0 3 TGCTGTA 10 0.006830828 145.0 4 AGGGTGA 10 0.006830828 145.0 4 AGTGCTG 10 0.006830828 145.0 2 GGGTGAA 10 0.006830828 145.0 5 GTGCTGT 10 0.006830828 145.0 3 GAGAGAG 55 0.0025160722 15.818182 115-119 >>END_MODULE SRR28623288 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623288_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.6175 37.0 37.0 37.0 37.0 37.0 2 36.244 37.0 37.0 37.0 37.0 37.0 3 36.1095 37.0 37.0 37.0 37.0 37.0 4 36.1285 37.0 37.0 37.0 37.0 37.0 5 36.195 37.0 37.0 37.0 37.0 37.0 6 36.111 37.0 37.0 37.0 37.0 37.0 7 36.18 37.0 37.0 37.0 37.0 37.0 8 36.053 37.0 37.0 37.0 37.0 37.0 9 35.9915 37.0 37.0 37.0 37.0 37.0 10-14 36.0541 37.0 37.0 37.0 37.0 37.0 15-19 36.074 37.0 37.0 37.0 37.0 37.0 20-24 36.0249 37.0 37.0 37.0 37.0 37.0 25-29 35.9519 37.0 37.0 37.0 37.0 37.0 30-34 35.8857 37.0 37.0 37.0 37.0 37.0 35-39 35.8538 37.0 37.0 37.0 37.0 37.0 40-44 35.8098 37.0 37.0 37.0 37.0 37.0 45-49 35.801 37.0 37.0 37.0 37.0 37.0 50-54 35.8343 37.0 37.0 37.0 37.0 37.0 55-59 35.726299999999995 37.0 37.0 37.0 37.0 37.0 60-64 35.6533 37.0 37.0 37.0 37.0 37.0 65-69 35.767700000000005 37.0 37.0 37.0 37.0 37.0 70-74 35.7159 37.0 37.0 37.0 37.0 37.0 75-79 35.6854 37.0 37.0 37.0 37.0 37.0 80-84 35.566700000000004 37.0 37.0 37.0 37.0 37.0 85-89 35.573 37.0 37.0 37.0 37.0 37.0 90-94 35.5077 37.0 37.0 37.0 37.0 37.0 95-99 35.495400000000004 37.0 37.0 37.0 37.0 37.0 100-104 35.37220000000001 37.0 37.0 37.0 34.6 37.0 105-109 35.319 37.0 37.0 37.0 34.6 37.0 110-114 35.3976 37.0 37.0 37.0 37.0 37.0 115-119 35.343 37.0 37.0 37.0 37.0 37.0 120-124 35.3206 37.0 37.0 37.0 34.6 37.0 125-129 34.8977 37.0 37.0 37.0 25.0 37.0 130-134 35.1989 37.0 37.0 37.0 29.8 37.0 135-139 34.92360000000001 37.0 37.0 37.0 25.0 37.0 140-144 35.0651 37.0 37.0 37.0 27.4 37.0 145-149 35.0415 37.0 37.0 37.0 27.4 37.0 150-151 34.671 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 7.0 15 6.0 16 6.0 17 5.0 18 2.0 19 4.0 20 5.0 21 4.0 22 2.0 23 3.0 24 10.0 25 9.0 26 15.0 27 11.0 28 27.0 29 30.0 30 36.0 31 47.0 32 54.0 33 116.0 34 264.0 35 721.0 36 2412.0 37 203.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.25 20.65 12.7 26.400000000000002 2 27.675 26.025 29.75 16.55 3 20.825 28.299999999999997 31.6 19.275000000000002 4 24.575 33.875 23.9 17.65 5 25.900000000000002 34.375 22.725 17.0 6 20.1 38.925 23.925 17.05 7 23.275000000000002 21.05 37.1 18.575 8 22.575 26.224999999999998 29.049999999999997 22.15 9 22.075 24.975 29.25 23.7 10-14 24.355 29.189999999999998 25.840000000000003 20.615 15-19 22.89 28.735 28.025 20.349999999999998 20-24 23.695 28.895 27.125 20.285 25-29 23.755000000000003 28.634999999999998 27.779999999999998 19.830000000000002 30-34 23.43 29.13 27.365000000000002 20.075000000000003 35-39 23.26 28.665000000000003 27.534999999999997 20.54 40-44 23.385 28.249999999999996 28.275 20.09 45-49 23.34 28.194999999999997 28.685 19.78 50-54 23.68 28.465 28.07 19.785 55-59 23.94 27.810000000000002 28.175 20.075000000000003 60-64 24.065 27.500000000000004 28.249999999999996 20.185 65-69 23.105 28.754999999999995 28.165000000000003 19.975 70-74 22.81 28.465 28.415000000000003 20.31 75-79 23.275000000000002 28.804999999999996 28.13 19.79 80-84 23.580000000000002 28.525 27.605 20.29 85-89 23.96 28.060000000000002 28.360000000000003 19.62 90-94 23.14 28.27 28.455000000000002 20.135 95-99 24.21 28.310000000000002 27.944999999999997 19.535 100-104 23.330000000000002 28.555000000000003 28.084999999999997 20.03 105-109 24.12 28.189999999999998 28.18 19.509999999999998 110-114 23.96 28.43 27.47 20.14 115-119 24.635 27.88 27.905 19.580000000000002 120-124 24.47 28.785 27.48 19.265 125-129 24.815 28.415000000000003 27.72 19.05 130-134 25.35 28.294999999999998 27.875 18.48 135-139 25.655 27.625 27.250000000000004 19.470000000000002 140-144 25.735000000000003 28.265 26.740000000000002 19.259999999999998 145-149 25.569999999999997 28.425 27.195000000000004 18.81 150-151 26.437500000000004 27.075 27.6125 18.875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.5 7 1.0 8 0.5 9 0.5 10 1.5 11 1.0 12 0.0 13 1.0 14 1.0 15 0.5 16 1.5 17 1.0 18 0.5 19 1.5 20 2.5 21 2.5 22 1.5 23 0.5 24 2.5 25 3.5 26 2.5 27 5.0 28 11.0 29 14.5 30 14.0 31 22.0 32 28.0 33 43.0 34 63.0 35 71.0 36 83.0 37 108.5 38 143.0 39 176.5 40 198.5 41 234.5 42 255.5 43 279.5 44 286.0 45 303.5 46 307.5 47 253.0 48 213.5 49 178.5 50 155.0 51 132.0 52 91.5 53 61.5 54 56.0 55 41.5 56 31.5 57 23.5 58 16.0 59 10.5 60 6.0 61 7.0 62 8.0 63 5.5 64 4.0 65 3.0 66 3.5 67 3.0 68 1.5 69 0.5 70 0.5 71 0.5 72 0.5 73 1.0 74 1.0 75 1.0 76 0.5 77 0.0 78 0.5 79 0.5 80 0.5 81 0.5 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.5 92 1.0 93 0.5 94 0.0 95 0.0 96 0.5 97 0.5 98 0.0 99 0.0 100 3.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 85.9402460456942 73.35000000000001 2 11.570005858230815 19.75 3 2.0796719390743994 5.325 4 0.35149384885764495 1.2 5 0.029291154071470416 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.029291154071470416 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 10 0.25 No Hit GTTAAATCCATAGATAGATCATACAAGAAACAGGTGGCTGTGTGTGCGTA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.1625 0.0 0.0 0.0 0.0 88-89 0.2625 0.0 0.0 0.0 0.0 90-91 0.4125 0.0 0.0 0.0 0.0 92-93 0.5625 0.0 0.0 0.0 0.0 94-95 0.7875 0.0 0.0 0.0 0.0 96-97 1.0875 0.0 0.0 0.0 0.0 98-99 1.25 0.0 0.0 0.0 0.0 100-101 1.4 0.0 0.0 0.0 0.0 102-103 1.725 0.0 0.0 0.0 0.0 104-105 2.025 0.0 0.0 0.0 0.0 106-107 2.2249999999999996 0.0 0.0 0.0 0.0 108-109 2.5625 0.0 0.0 0.0 0.0 110-111 2.7375 0.0 0.0 0.0 0.0 112-113 3.0250000000000004 0.0 0.0 0.0 0.0 114-115 3.35 0.0 0.0 0.0 0.0 116-117 3.7375 0.0 0.0 0.0 0.0 118-119 4.175000000000001 0.0 0.0 0.0 0.0 120-121 4.6 0.0 0.0 0.0 0.0 122-123 4.975 0.0 0.0 0.0 0.0 124-125 5.5625 0.0 0.0 0.0 0.0 126-127 6.0625 0.0 0.0 0.0 0.0 128-129 6.575 0.0 0.0 0.0 0.0 130-131 7.2125 0.0 0.0 0.0 0.0 132-133 7.5375 0.0 0.0 0.0 0.0 134-135 8.225 0.0 0.0 0.0 0.0 136-137 9.0125 0.0 0.0 0.0 0.0 138-139 9.649999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTTGTA 10 0.006830828 145.0 6 AGAGCGT 40 0.0076550315 18.125 140-144 >>END_MODULE Read 1701714 spots for SRR28623288.sra Written 1701714 spots for SRR28623288.sra Read 1701714 spots for SRR28623288.sra Written 1701714 spots for SRR28623288.sra Read 1701714 spots for SRR28623288.sra Written 1701714 spots for SRR28623288.sra Read 1701714 spots for SRR28623288.sra Written 1701714 spots for SRR28623288.sra Read 1701714 spots for SRR28623288.sra Written 1701714 spots for SRR28623288.sra Read 1701714 spots for SRR28623288.sra Written 1701714 spots for SRR28623288.sra Read 1701714 spots for SRR28623288.sra Written 1701714 spots for SRR28623288.sra Read 1701714 spots for SRR28623288.sra Written 1701714 spots for SRR28623288.sra Read 1701714 spots for SRR28623288.sra Written 1701714 spots for SRR28623288.sra Read 1701714 spots for SRR28623288.sra Written 1701714 spots for SRR28623288.sra Read 1701714 spots for SRR28623288.sra Written 1701714 spots for SRR28623288.sra Read 1701714 spots for SRR28623288.sra Written 1701714 spots for SRR28623288.sra Read 1701714 spots for SRR28623288.sra Written 1701714 spots for SRR28623288.sra Read 1701714 spots for SRR28623288.sra Written 1701714 spots for SRR28623288.sra Read 1701714 spots for SRR28623288.sra Written 1701714 spots for SRR28623288.sra Read 1701721 spots for SRR28623288.sra Written 1701721 spots for SRR28623288.sra Read 1701714 spots for SRR28623288.sra Written 1701714 spots for SRR28623288.sra Read 1701714 spots for SRR28623288.sra Written 1701714 spots for SRR28623288.sra Read 1701714 spots for SRR28623288.sra Written 1701714 spots for SRR28623288.sra Read 1701714 spots for SRR28623288.sra Written 1701714 spots for SRR28623288.sra SRR ids: ['SRR28623288.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_q38mohzz SRR28623288.sra spots: 34034287 blocks: [[1, 1701714], [1701715, 3403428], [3403429, 5105142], [5105143, 6806856], [6806857, 8508570], [8508571, 10210284], [10210285, 11911998], [11911999, 13613712], [13613713, 15315426], [15315427, 17017140], [17017141, 18718854], [18718855, 20420568], [20420569, 22122282], [22122283, 23823996], [23823997, 25525710], [25525711, 27227424], [27227425, 28929138], [28929139, 30630852], [30630853, 32332566], [32332567, 34034287]] SRR28623288 file size 12568036 SRR28623288 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR28623288 SRR28623288_1.fastq SRR28623288_2.fastq Input file: SRR28623288_1.fastq Paired file: SRR28623288_2.fastq trimmed: SRR28623288-trimmed-pair1.fastq, SRR28623288-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 15:01:40 2025 >> started Tue Feb 11 15:02:19 2025 >> done (38.748s) 34034287 read pairs processed; of these: 31 ( 0.00%) short read pairs filtered out after trimming by size control 9987 ( 0.03%) empty read pairs filtered out after trimming by size control 34024269 (99.97%) read pairs available; of these: 4763665 (14.00%) trimmed read pairs available after processing 29260604 (86.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 3 0.00% 20 3 0.00% 21 8 0.00% 22 8 0.00% 23 10 0.00% 24 11 0.00% 25 11 0.00% 26 12 0.00% 27 16 0.00% 28 17 0.00% 29 22 0.00% 30 20 0.00% 31 23 0.00% 32 33 0.00% 33 22 0.00% 34 24 0.00% 35 30 0.00% 36 34 0.00% 37 31 0.00% 38 45 0.00% 39 55 0.00% 40 53 0.00% 41 42 0.00% 42 73 0.00% 43 72 0.00% 44 82 0.00% 45 81 0.00% 46 100 0.00% 47 101 0.00% 48 135 0.00% 49 131 0.00% 50 165 0.00% 51 183 0.00% 52 220 0.00% 53 217 0.00% 54 265 0.00% 55 274 0.00% 56 333 0.00% 57 377 0.00% 58 415 0.00% 59 527 0.00% 60 625 0.00% 61 688 0.00% 62 783 0.00% 63 872 0.00% 64 1056 0.00% 65 1119 0.00% 66 1344 0.00% 67 1433 0.00% 68 1714 0.01% 69 2035 0.01% 70 2292 0.01% 71 2536 0.01% 72 3005 0.01% 73 3491 0.01% 74 3884 0.01% 75 4383 0.01% 76 5082 0.01% 77 5576 0.02% 78 6133 0.02% 79 7134 0.02% 80 7869 0.02% 81 8829 0.03% 82 9797 0.03% 83 10969 0.03% 84 12277 0.04% 85 13450 0.04% 86 14525 0.04% 87 16123 0.05% 88 17164 0.05% 89 18749 0.06% 90 19904 0.06% 91 22113 0.06% 92 23615 0.07% 93 25292 0.07% 94 27138 0.08% 95 28670 0.08% 96 30544 0.09% 97 33083 0.10% 98 34073 0.10% 99 35927 0.11% 100 37833 0.11% 101 39085 0.11% 102 41813 0.12% 103 43578 0.13% 104 45436 0.13% 105 47921 0.14% 106 49823 0.15% 107 51449 0.15% 108 53891 0.16% 109 55435 0.16% 110 56971 0.17% 111 59174 0.17% 112 61179 0.18% 113 62900 0.18% 114 64645 0.19% 115 67354 0.20% 116 69183 0.20% 117 71251 0.21% 118 73666 0.22% 119 75533 0.22% 120 76687 0.23% 121 78805 0.23% 122 80247 0.24% 123 81864 0.24% 124 84722 0.25% 125 86086 0.25% 126 87826 0.26% 127 90253 0.27% 128 92000 0.27% 129 93176 0.27% 130 95844 0.28% 131 96485 0.28% 132 97851 0.29% 133 100486 0.30% 134 101435 0.30% 135 103060 0.30% 136 104841 0.31% 137 106034 0.31% 138 107988 0.32% 139 110172 0.32% 140 110482 0.32% 141 111988 0.33% 142 114380 0.34% 143 114749 0.34% 144 116356 0.34% 145 118722 0.35% 146 118568 0.35% 147 119767 0.35% 148 121614 0.36% 149 120693 0.35% 150 122781 0.36% 151 29260604 86.00% 34024269 reads passed initial QC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=37 prefix-density=0.13 prefix-fanout=2.0 sequence=TGCGACATGGTTGGCAAGAATCCTTCTGCGAATTTAGCAACAACCGAAGAATCAAGATACTCCTGCAAGCCCTCCAGATCATCAAAGGTAGTTTCAAAAGCATGAGTATATCCGAAATTGAGGTCGTGAATACCCAGATTAGTGCCCCAGTGTAAGCTCTTCAAGGGTTCAACTTGATTGACCAGATGAGTGAAGTCGTTTATGATTTTCTCAATTT criterion=fanout-score sequence-density=0.07 sequence-density-rank=17 fanout-score=241.19 fanout-score-rank=1 prefix-density=0.52 prefix-fanout=30.1 sequence=TCTTCATCATCAT criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=15.13 fanout-score-rank=14 prefix-density=0.16 prefix-fanout=15.1 sequence=GAGAGAGAGAGTTAAGACAATGGCCTCGAAGAAATCTGCAATCGTATTACCTGGTTCAAAGGTGTTGAAGCACATAGTTTTTGTACGGTTTAATGATGGGATCACTGATGAACAAATTGAGAA criterion=fanout-score sequence-density=0.08 sequence-density-rank=12 fanout-score=344.26 fanout-score-rank=1 prefix-density=0.86 prefix-fanout=30.0 sequence=AAGAAGAAGAAA SRR28623288 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 15:03:03 Started mapping on | Feb 11 15:03:03 Finished on | Feb 11 15:06:22 Mapping speed, Million of reads per hour | 615.51 Number of input reads | 34024269 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 31897873 Uniquely mapped reads % | 93.75% Average mapped length | 293.27 Number of splices: Total | 28633045 Number of splices: Annotated (sjdb) | 27998852 Number of splices: GT/AG | 28130813 Number of splices: GC/AG | 388319 Number of splices: AT/AC | 26089 Number of splices: Non-canonical | 87824 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.03% Deletion average length | 2.99 Insertion rate per base | 0.03% Insertion average length | 2.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 900820 % of reads mapped to multiple loci | 2.65% Number of reads mapped to too many loci | 152408 % of reads mapped to too many loci | 0.45% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.97% % of reads unmapped: other | 0.19% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1225576 1225576 1225576 N_multimapping 900820 900820 900820 N_noFeature 1226101 31570103 1394442 N_ambiguous 338318 2340 177174 UnstrandedReadsAssigned:30333454 PositiveStrandReadsAssigned:325430 NegativeStrandReadsAssigned:30326257 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR28623288 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR28623288-trimmed-pair1.fastq SRR28623288-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 34,024,269 reads, 30,747,776 reads pseudoaligned [quant] estimated average fragment length: 233.567 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,074 rounds 52401 SRR28623288.ke.tsv 34699 SRR28623288.se.tsv 87100 total ==> SRR28623288.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1785.43 1341 25.0144 Potri.005G024800.1.v4.1 1035 802.433 453 18.8016 Potri.004G059700.1.v4.1 961 728.44 134 6.12656 Potri.007G009000.2.v4.1 1416 1183.43 0 0 Potri.003G141000.2.v4.1 2943 2710.43 858.884 10.5536 Potri.016G087400.1.v4.1 270 90.6843 1842.09 676.528 Potri.015G069301.1.v4.1 564 337.146 0 0 Potri.010G195200.1.v4.1 1773 1540.43 39 0.843194 Potri.012G127500.1.v4.1 977 744.433 11869 530.999 ==> SRR28623288.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 861 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 520 Potri.001G212900.v4.1 147 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 4 Potri.001G452600.v4.1 1 SRR28623288 completed mapping pipeline successfully