Starting /dee2/code/volunteer_pipeline.sh SRR28623289 current disk space = 3050108379136 free memory = 1428283352 SRR28623289 SRAfilesize 06f4324df9e08aabcb61a3a61c8fc709 SRR28623289.sra SRR28623289.sra file validated SRR28623289 is paired end SRR28623289 is conventional basespace SRR28623289 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623289_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.467 37.0 37.0 37.0 37.0 37.0 2 36.377 37.0 37.0 37.0 37.0 37.0 3 36.589 37.0 37.0 37.0 37.0 37.0 4 36.5985 37.0 37.0 37.0 37.0 37.0 5 36.6575 37.0 37.0 37.0 37.0 37.0 6 36.6275 37.0 37.0 37.0 37.0 37.0 7 36.5915 37.0 37.0 37.0 37.0 37.0 8 36.381 37.0 37.0 37.0 37.0 37.0 9 36.622 37.0 37.0 37.0 37.0 37.0 10-14 36.5884 37.0 37.0 37.0 37.0 37.0 15-19 36.5784 37.0 37.0 37.0 37.0 37.0 20-24 36.5197 37.0 37.0 37.0 37.0 37.0 25-29 36.466899999999995 37.0 37.0 37.0 37.0 37.0 30-34 36.4529 37.0 37.0 37.0 37.0 37.0 35-39 36.4345 37.0 37.0 37.0 37.0 37.0 40-44 36.4148 37.0 37.0 37.0 37.0 37.0 45-49 36.3324 37.0 37.0 37.0 37.0 37.0 50-54 36.3305 37.0 37.0 37.0 37.0 37.0 55-59 36.2154 37.0 37.0 37.0 37.0 37.0 60-64 36.3324 37.0 37.0 37.0 37.0 37.0 65-69 36.2714 37.0 37.0 37.0 37.0 37.0 70-74 36.1688 37.0 37.0 37.0 37.0 37.0 75-79 36.15390000000001 37.0 37.0 37.0 37.0 37.0 80-84 36.0676 37.0 37.0 37.0 37.0 37.0 85-89 36.184900000000006 37.0 37.0 37.0 37.0 37.0 90-94 36.0981 37.0 37.0 37.0 37.0 37.0 95-99 35.922700000000006 37.0 37.0 37.0 37.0 37.0 100-104 36.0355 37.0 37.0 37.0 37.0 37.0 105-109 35.942600000000006 37.0 37.0 37.0 37.0 37.0 110-114 35.8611 37.0 37.0 37.0 37.0 37.0 115-119 35.931799999999996 37.0 37.0 37.0 37.0 37.0 120-124 35.7342 37.0 37.0 37.0 37.0 37.0 125-129 35.759499999999996 37.0 37.0 37.0 37.0 37.0 130-134 35.8456 37.0 37.0 37.0 37.0 37.0 135-139 35.7328 37.0 37.0 37.0 37.0 37.0 140-144 35.492 37.0 37.0 37.0 37.0 37.0 145-149 35.3977 37.0 37.0 37.0 34.6 37.0 150-151 35.158 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 1.0 21 0.0 22 1.0 23 2.0 24 2.0 25 4.0 26 5.0 27 5.0 28 15.0 29 23.0 30 22.0 31 40.0 32 69.0 33 87.0 34 151.0 35 384.0 36 2916.0 37 272.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.50325488232349 13.370055082623935 8.813219829744618 42.313470205307965 2 17.175 15.7 37.25 29.875 3 18.7 18.075 29.325000000000003 33.900000000000006 4 21.725 25.874999999999996 25.025 27.375 5 24.474999999999998 33.025 24.825 17.675 6 20.875 35.85 23.674999999999997 19.6 7 14.649999999999999 27.85 40.675 16.825000000000003 8 17.525 26.775 31.474999999999998 24.224999999999998 9 17.4 24.224999999999998 35.775 22.6 10-14 19.865 29.799999999999997 27.655 22.68 15-19 19.505 28.765 28.095 23.635 20-24 19.265 28.9 28.095 23.74 25-29 20.200000000000003 28.335 28.235 23.23 30-34 19.384999999999998 29.09 27.775 23.75 35-39 19.48 28.575 27.900000000000002 24.044999999999998 40-44 19.89 29.615000000000002 27.1 23.395 45-49 19.725 29.439999999999998 27.345000000000002 23.49 50-54 20.135 28.055000000000003 27.76 24.05 55-59 20.165 29.189999999999998 27.29 23.355 60-64 19.985 27.800000000000004 27.915 24.3 65-69 19.785 28.444999999999997 28.375 23.395 70-74 20.31 27.915 27.705000000000002 24.07 75-79 20.625 27.87 28.425 23.080000000000002 80-84 20.49 28.765 27.38 23.365 85-89 20.57 28.16 27.400000000000002 23.87 90-94 20.335 28.765 27.32 23.580000000000002 95-99 20.445 28.28 27.275 24.0 100-104 20.96 28.12 27.265 23.655 105-109 20.19 28.57 27.615000000000002 23.625 110-114 20.49 28.310000000000002 27.83 23.369999999999997 115-119 20.445 28.134999999999998 27.825 23.595 120-124 20.925 27.955000000000002 27.315 23.805 125-129 21.099999999999998 28.02 26.745 24.135 130-134 21.65 28.110000000000003 26.82 23.419999999999998 135-139 21.41 28.389999999999997 26.185000000000002 24.015 140-144 21.08 28.470000000000002 26.490000000000002 23.96 145-149 21.725 28.035 26.174999999999997 24.065 150-151 21.825 29.75 24.8 23.625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 0.5 21 1.0 22 1.5 23 3.5 24 5.0 25 6.0 26 6.5 27 7.5 28 11.5 29 15.5 30 20.0 31 27.0 32 41.5 33 50.5 34 64.5 35 75.0 36 83.0 37 122.0 38 143.5 39 162.0 40 202.5 41 219.0 42 220.5 43 249.5 44 258.5 45 245.0 46 254.5 47 244.5 48 223.0 49 210.0 50 171.5 51 135.5 52 116.0 53 89.0 54 81.5 55 68.5 56 43.0 57 27.5 58 18.5 59 19.0 60 18.5 61 13.5 62 7.0 63 3.0 64 3.0 65 1.0 66 1.0 67 1.0 68 0.0 69 0.5 70 0.5 71 1.0 72 1.5 73 1.5 74 1.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.15 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.625 #Duplication Level Percentage of deduplicated Percentage of total 1 85.95620437956204 73.6 2 11.64963503649635 19.950000000000003 3 2.072992700729927 5.325 4 0.291970802919708 1.0 5 0.029197080291970805 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAAC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0125 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.0875 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.175 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.2 0.0 0.0 0.0 0.0 76-77 0.225 0.0 0.0 0.0 0.0 78-79 0.25 0.0 0.0 0.0 0.0 80-81 0.275 0.0 0.0 0.0 0.0 82-83 0.3375 0.0 0.0 0.0 0.0 84-85 0.375 0.0 0.0 0.0 0.0 86-87 0.425 0.0 0.0 0.0 0.0 88-89 0.4625 0.0 0.0 0.0 0.0 90-91 0.55 0.0 0.0 0.0 0.0 92-93 0.6625 0.0 0.0 0.0 0.0 94-95 0.8375 0.0 0.0 0.0 0.0 96-97 1.1125 0.0 0.0 0.0 0.0 98-99 1.375 0.0 0.0 0.0 0.0 100-101 1.5125 0.0 0.0 0.0 0.0 102-103 1.8875 0.0 0.0 0.0 0.0 104-105 2.0625 0.0 0.0 0.0 0.0 106-107 2.225 0.0 0.0 0.0 0.0 108-109 2.5125 0.0 0.0 0.0 0.0 110-111 2.7625 0.0 0.0 0.0 0.0 112-113 3.1500000000000004 0.0 0.0 0.0 0.0 114-115 3.4625 0.0 0.0 0.0 0.0 116-117 3.8375 0.0 0.0 0.0 0.0 118-119 4.2125 0.0 0.0 0.0 0.0 120-121 4.5375 0.0 0.0 0.0 0.0 122-123 5.15 0.0 0.0 0.0 0.0 124-125 5.6875 0.0 0.0 0.0 0.0 126-127 6.625 0.0 0.0 0.0 0.0 128-129 7.375 0.0 0.0 0.0 0.0 130-131 7.7625 0.0 0.0 0.0 0.0 132-133 8.3875 0.0 0.0 0.0 0.0 134-135 9.0625 0.0 0.0 0.0 0.0 136-137 9.7125 0.0 0.0 0.0 0.0 138-139 10.4375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAGTGG 10 0.006830828 145.0 8 >>END_MODULE SRR28623289 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623289_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.942 37.0 37.0 37.0 37.0 37.0 2 36.2165 37.0 37.0 37.0 37.0 37.0 3 36.17 37.0 37.0 37.0 37.0 37.0 4 36.194 37.0 37.0 37.0 37.0 37.0 5 36.385 37.0 37.0 37.0 37.0 37.0 6 36.1865 37.0 37.0 37.0 37.0 37.0 7 36.2855 37.0 37.0 37.0 37.0 37.0 8 36.229 37.0 37.0 37.0 37.0 37.0 9 36.2305 37.0 37.0 37.0 37.0 37.0 10-14 36.1671 37.0 37.0 37.0 37.0 37.0 15-19 36.1811 37.0 37.0 37.0 37.0 37.0 20-24 36.1726 37.0 37.0 37.0 37.0 37.0 25-29 36.1653 37.0 37.0 37.0 37.0 37.0 30-34 36.0184 37.0 37.0 37.0 37.0 37.0 35-39 36.1143 37.0 37.0 37.0 37.0 37.0 40-44 36.027300000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.0981 37.0 37.0 37.0 37.0 37.0 50-54 36.05069999999999 37.0 37.0 37.0 37.0 37.0 55-59 35.91029999999999 37.0 37.0 37.0 37.0 37.0 60-64 35.9415 37.0 37.0 37.0 37.0 37.0 65-69 35.9057 37.0 37.0 37.0 37.0 37.0 70-74 35.98800000000001 37.0 37.0 37.0 37.0 37.0 75-79 36.00599999999999 37.0 37.0 37.0 37.0 37.0 80-84 35.8213 37.0 37.0 37.0 37.0 37.0 85-89 35.8422 37.0 37.0 37.0 37.0 37.0 90-94 35.737199999999994 37.0 37.0 37.0 37.0 37.0 95-99 35.6983 37.0 37.0 37.0 37.0 37.0 100-104 35.6457 37.0 37.0 37.0 37.0 37.0 105-109 35.5863 37.0 37.0 37.0 37.0 37.0 110-114 35.6707 37.0 37.0 37.0 37.0 37.0 115-119 35.596900000000005 37.0 37.0 37.0 37.0 37.0 120-124 35.5926 37.0 37.0 37.0 37.0 37.0 125-129 35.1312 37.0 37.0 37.0 32.2 37.0 130-134 35.3557 37.0 37.0 37.0 37.0 37.0 135-139 35.2352 37.0 37.0 37.0 32.2 37.0 140-144 35.2712 37.0 37.0 37.0 32.2 37.0 145-149 35.19840000000001 37.0 37.0 37.0 32.2 37.0 150-151 34.876999999999995 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 6.0 15 1.0 16 1.0 17 2.0 18 1.0 19 1.0 20 6.0 21 4.0 22 8.0 23 7.0 24 12.0 25 5.0 26 5.0 27 13.0 28 11.0 29 19.0 30 37.0 31 40.0 32 44.0 33 99.0 34 215.0 35 597.0 36 2591.0 37 273.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.425 20.974999999999998 14.124999999999998 26.474999999999998 2 27.575 25.324999999999996 29.175 17.925 3 21.4 27.725 32.375 18.5 4 24.9 32.4 24.725 17.974999999999998 5 25.624999999999996 36.675000000000004 21.4 16.3 6 19.7 39.800000000000004 23.3 17.2 7 21.0 22.325 37.6 19.075 8 22.075 24.9 28.325 24.7 9 21.95 25.224999999999998 29.675 23.150000000000002 10-14 22.91 29.515 26.115 21.46 15-19 23.025000000000002 28.325 27.91 20.74 20-24 22.985 28.535 27.744999999999997 20.735 25-29 23.080000000000002 28.09 27.815 21.015 30-34 22.63 28.785 28.105000000000004 20.48 35-39 22.34 28.99 27.41 21.26 40-44 23.52 28.435 28.294999999999998 19.75 45-49 22.994999999999997 28.58 27.650000000000002 20.775 50-54 22.915 29.29 27.115000000000002 20.68 55-59 22.81 28.215 28.16 20.815 60-64 22.884999999999998 28.810000000000002 27.54 20.765 65-69 23.575 27.525 28.025 20.875 70-74 23.34 28.705000000000002 26.91 21.044999999999998 75-79 22.59 27.950000000000003 28.285 21.175 80-84 22.53 27.73 28.27 21.47 85-89 23.34 28.21 27.544999999999998 20.905 90-94 23.64 28.189999999999998 27.13 21.04 95-99 23.305 28.625 27.589999999999996 20.48 100-104 23.805 28.335 27.095000000000002 20.765 105-109 24.355 28.02 27.325 20.3 110-114 23.985 28.115000000000002 27.195000000000004 20.705000000000002 115-119 23.915 29.455 26.515 20.115 120-124 24.21 28.665000000000003 27.295 19.830000000000002 125-129 24.560000000000002 28.925 26.884999999999998 19.63 130-134 24.9 28.63 26.334999999999997 20.135 135-139 24.905 28.225 27.375 19.495 140-144 25.424999999999997 28.525 26.83 19.220000000000002 145-149 26.775 28.595 25.580000000000002 19.05 150-151 26.55 29.8875 25.674999999999997 17.8875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 1.5 11 2.5 12 2.0 13 1.0 14 0.0 15 0.0 16 1.0 17 1.5 18 2.0 19 3.5 20 2.5 21 2.5 22 2.5 23 1.5 24 2.5 25 3.0 26 4.0 27 7.0 28 10.5 29 13.0 30 18.5 31 25.0 32 28.5 33 42.0 34 58.5 35 69.5 36 93.5 37 115.0 38 134.5 39 176.5 40 200.0 41 214.5 42 255.5 43 265.5 44 239.0 45 250.0 46 262.0 47 246.5 48 226.0 49 196.5 50 173.5 51 139.0 52 94.5 53 81.5 54 77.5 55 66.5 56 49.5 57 31.5 58 26.5 59 19.0 60 14.0 61 9.5 62 10.0 63 7.5 64 2.5 65 4.0 66 2.5 67 0.0 68 1.5 69 1.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.975 #Duplication Level Percentage of deduplicated Percentage of total 1 86.7112532712998 74.55000000000001 2 10.846176214015703 18.65 3 2.035475428903751 5.25 4 0.2907822041291073 1.0 5 0.05815644082582146 0.25 6 0.05815644082582146 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 6 0.15 No Hit ATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAAT 6 0.15 No Hit GAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCA 5 0.125 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0125 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.0875 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.175 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.2 0.0 0.0 0.0 0.0 76-77 0.225 0.0 0.0 0.0 0.0 78-79 0.25 0.0 0.0 0.0 0.0 80-81 0.275 0.0 0.0 0.0 0.0 82-83 0.3375 0.0 0.0 0.0 0.0 84-85 0.375 0.0 0.0 0.0 0.0 86-87 0.4375 0.0 0.0 0.0 0.0 88-89 0.475 0.0 0.0 0.0 0.0 90-91 0.55 0.0 0.0 0.0 0.0 92-93 0.6625 0.0 0.0 0.0 0.0 94-95 0.825 0.0 0.0 0.0 0.0 96-97 1.0875 0.0 0.0 0.0 0.0 98-99 1.35 0.0 0.0 0.0 0.0 100-101 1.4875 0.0 0.0 0.0 0.0 102-103 1.8625 0.0 0.0 0.0 0.0 104-105 2.0125 0.0 0.0 0.0 0.0 106-107 2.1875 0.0 0.0 0.0 0.0 108-109 2.4875 0.0 0.0 0.0 0.0 110-111 2.7375 0.0 0.0 0.0 0.0 112-113 3.1500000000000004 0.0 0.0 0.0 0.0 114-115 3.4625 0.0 0.0 0.0 0.0 116-117 3.8375 0.0 0.0 0.0 0.0 118-119 4.225 0.0 0.0 0.0 0.0 120-121 4.5625 0.0 0.0 0.0 0.0 122-123 5.1625 0.0 0.0 0.0 0.0 124-125 5.6875 0.0 0.0 0.0 0.0 126-127 6.6 0.0 0.0 0.0 0.0 128-129 7.375 0.0 0.0 0.0 0.0 130-131 7.75 0.0 0.0 0.0 0.0 132-133 8.3375 0.0 0.0 0.0 0.0 134-135 9.0125 0.0 0.0 0.0 0.0 136-137 9.6375 0.0 0.0 0.0 0.0 138-139 10.3375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATGATTC 10 0.006830828 145.0 3 CCATGAT 10 0.006830828 145.0 1 >>END_MODULE Read 1764908 spots for SRR28623289.sra Written 1764908 spots for SRR28623289.sra Read 1764908 spots for SRR28623289.sra Written 1764908 spots for SRR28623289.sra Read 1764908 spots for SRR28623289.sra Written 1764908 spots for SRR28623289.sra Read 1764908 spots for SRR28623289.sra Written 1764908 spots for SRR28623289.sra Read 1764908 spots for SRR28623289.sra Written 1764908 spots for SRR28623289.sra Read 1764908 spots for SRR28623289.sra Written 1764908 spots for SRR28623289.sra Read 1764908 spots for SRR28623289.sra Written 1764908 spots for SRR28623289.sra Read 1764921 spots for SRR28623289.sra Written 1764921 spots for SRR28623289.sra Read 1764908 spots for SRR28623289.sra Written 1764908 spots for SRR28623289.sra Read 1764908 spots for SRR28623289.sra Written 1764908 spots for SRR28623289.sra Read 1764908 spots for SRR28623289.sra Written 1764908 spots for SRR28623289.sra Read 1764908 spots for SRR28623289.sra Written 1764908 spots for SRR28623289.sra Read 1764908 spots for SRR28623289.sra Written 1764908 spots for SRR28623289.sra Read 1764908 spots for SRR28623289.sra Written 1764908 spots for SRR28623289.sra Read 1764908 spots for SRR28623289.sra Written 1764908 spots for SRR28623289.sra Read 1764908 spots for SRR28623289.sra Written 1764908 spots for SRR28623289.sra Read 1764908 spots for SRR28623289.sra Written 1764908 spots for SRR28623289.sra Read 1764908 spots for SRR28623289.sra Written 1764908 spots for SRR28623289.sra Read 1764908 spots for SRR28623289.sra Written 1764908 spots for SRR28623289.sra Read 1764908 spots for SRR28623289.sra Written 1764908 spots for SRR28623289.sra SRR ids: ['SRR28623289.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5w20eidm SRR28623289.sra spots: 35298173 blocks: [[1, 1764908], [1764909, 3529816], [3529817, 5294724], [5294725, 7059632], [7059633, 8824540], [8824541, 10589448], [10589449, 12354356], [12354357, 14119264], [14119265, 15884172], [15884173, 17649080], [17649081, 19413988], [19413989, 21178896], [21178897, 22943804], [22943805, 24708712], [24708713, 26473620], [26473621, 28238528], [28238529, 30003436], [30003437, 31768344], [31768345, 33533252], [33533253, 35298173]] SRR28623289 file size 13035167 SRR28623289 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR28623289 SRR28623289_1.fastq SRR28623289_2.fastq Input file: SRR28623289_1.fastq Paired file: SRR28623289_2.fastq trimmed: SRR28623289-trimmed-pair1.fastq, SRR28623289-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 14:39:05 2025 >> started Tue Feb 11 14:39:46 2025 >> done (41.188s) 35298173 read pairs processed; of these: 16 ( 0.00%) short read pairs filtered out after trimming by size control 12368 ( 0.04%) empty read pairs filtered out after trimming by size control 35285789 (99.96%) read pairs available; of these: 5556268 (15.75%) trimmed read pairs available after processing 29729521 (84.25%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 3 0.00% 20 6 0.00% 21 4 0.00% 22 4 0.00% 23 1 0.00% 24 3 0.00% 25 6 0.00% 26 8 0.00% 27 8 0.00% 28 13 0.00% 29 8 0.00% 30 12 0.00% 31 14 0.00% 32 14 0.00% 33 12 0.00% 34 24 0.00% 35 20 0.00% 36 24 0.00% 37 19 0.00% 38 39 0.00% 39 35 0.00% 40 44 0.00% 41 46 0.00% 42 50 0.00% 43 64 0.00% 44 72 0.00% 45 73 0.00% 46 84 0.00% 47 95 0.00% 48 97 0.00% 49 141 0.00% 50 173 0.00% 51 159 0.00% 52 250 0.00% 53 225 0.00% 54 230 0.00% 55 304 0.00% 56 316 0.00% 57 421 0.00% 58 434 0.00% 59 520 0.00% 60 584 0.00% 61 752 0.00% 62 908 0.00% 63 938 0.00% 64 1070 0.00% 65 1316 0.00% 66 1461 0.00% 67 1548 0.00% 68 1800 0.01% 69 2072 0.01% 70 2551 0.01% 71 2885 0.01% 72 3177 0.01% 73 3890 0.01% 74 4332 0.01% 75 4745 0.01% 76 5485 0.02% 77 6142 0.02% 78 6786 0.02% 79 7784 0.02% 80 8576 0.02% 81 9612 0.03% 82 11369 0.03% 83 12092 0.03% 84 13737 0.04% 85 15348 0.04% 86 16727 0.05% 87 18136 0.05% 88 20012 0.06% 89 20920 0.06% 90 23004 0.07% 91 25278 0.07% 92 26864 0.08% 93 29805 0.08% 94 32085 0.09% 95 34607 0.10% 96 36689 0.10% 97 38952 0.11% 98 40375 0.11% 99 42634 0.12% 100 45011 0.13% 101 47281 0.13% 102 48909 0.14% 103 51630 0.15% 104 54873 0.16% 105 57712 0.16% 106 60237 0.17% 107 63014 0.18% 108 64401 0.18% 109 67221 0.19% 110 68825 0.20% 111 70921 0.20% 112 73370 0.21% 113 75389 0.21% 114 78450 0.22% 115 80853 0.23% 116 83435 0.24% 117 86334 0.24% 118 88509 0.25% 119 89357 0.25% 120 91477 0.26% 121 94085 0.27% 122 94860 0.27% 123 97304 0.28% 124 100201 0.28% 125 102134 0.29% 126 104914 0.30% 127 106729 0.30% 128 107338 0.30% 129 109313 0.31% 130 111856 0.32% 131 112590 0.32% 132 114037 0.32% 133 115432 0.33% 134 116609 0.33% 135 118671 0.34% 136 120625 0.34% 137 122156 0.35% 138 123453 0.35% 139 126319 0.36% 140 127039 0.36% 141 128077 0.36% 142 129829 0.37% 143 130484 0.37% 144 132963 0.38% 145 133291 0.38% 146 134900 0.38% 147 136024 0.39% 148 138337 0.39% 149 138055 0.39% 150 140310 0.40% 151 29729521 84.25% 35285789 reads passed initial QC criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=28 prefix-density=0.36 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=34 fanout-score=219.45 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=15.2 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTGTG criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=2.21 fanout-score-rank=32 prefix-density=0.39 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.07 sequence-density-rank=33 fanout-score=44.65 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=11.1 sequence=AAGGCCAAGATCCAGGACAAGGA SRR28623289 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 14:40:32 Started mapping on | Feb 11 14:40:32 Finished on | Feb 11 14:44:40 Mapping speed, Million of reads per hour | 512.21 Number of input reads | 35285789 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 32980467 Uniquely mapped reads % | 93.47% Average mapped length | 292.46 Number of splices: Total | 31848755 Number of splices: Annotated (sjdb) | 31151919 Number of splices: GT/AG | 31207857 Number of splices: GC/AG | 518483 Number of splices: AT/AC | 22355 Number of splices: Non-canonical | 100060 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 2.55 Insertion rate per base | 0.02% Insertion average length | 2.33 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 841537 % of reads mapped to multiple loci | 2.38% Number of reads mapped to too many loci | 165085 % of reads mapped to too many loci | 0.47% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.49% % of reads unmapped: other | 0.19% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1463785 1463785 1463785 N_multimapping 841537 841537 841537 N_noFeature 1321408 32407665 1501362 N_ambiguous 603601 2327 209265 UnstrandedReadsAssigned:31055458 PositiveStrandReadsAssigned:570475 NegativeStrandReadsAssigned:31269840 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR28623289 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR28623289-trimmed-pair1.fastq SRR28623289-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 35,285,789 reads, 31,452,779 reads pseudoaligned [quant] estimated average fragment length: 230.966 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,137 rounds 52401 SRR28623289.ke.tsv 34699 SRR28623289.se.tsv 87100 total ==> SRR28623289.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1788.03 2731 40.5363 Potri.005G024800.1.v4.1 1035 805.034 916 30.1981 Potri.004G059700.1.v4.1 961 731.04 123 4.46542 Potri.007G009000.2.v4.1 1416 1186.03 0 0 Potri.003G141000.2.v4.1 2943 2713.03 2052.57 20.079 Potri.016G087400.1.v4.1 270 92.1803 1547.76 445.618 Potri.015G069301.1.v4.1 564 339.48 0 0 Potri.010G195200.1.v4.1 1773 1543.03 73 1.25558 Potri.012G127500.1.v4.1 977 747.04 89 3.16187 ==> SRR28623289.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 210 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 549 Potri.001G212900.v4.1 216 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 84 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 24 SRR28623289 completed mapping pipeline successfully