Starting /dee2/code/volunteer_pipeline.sh SRR28623290 current disk space = 3050169085952 free memory = 1361936840 SRR28623290 SRAfilesize 484eadece53414682f74e365afa0cfce SRR28623290.sra SRR28623290.sra file validated SRR28623290 is paired end SRR28623290 is conventional basespace SRR28623290 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623290_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.42325 37.0 37.0 37.0 37.0 37.0 2 36.5195 37.0 37.0 37.0 37.0 37.0 3 36.6 37.0 37.0 37.0 37.0 37.0 4 36.674 37.0 37.0 37.0 37.0 37.0 5 36.6695 37.0 37.0 37.0 37.0 37.0 6 36.6755 37.0 37.0 37.0 37.0 37.0 7 36.6185 37.0 37.0 37.0 37.0 37.0 8 36.521 37.0 37.0 37.0 37.0 37.0 9 36.616 37.0 37.0 37.0 37.0 37.0 10-14 36.6072 37.0 37.0 37.0 37.0 37.0 15-19 36.5764 37.0 37.0 37.0 37.0 37.0 20-24 36.559900000000006 37.0 37.0 37.0 37.0 37.0 25-29 36.509100000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.492399999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.43429999999999 37.0 37.0 37.0 37.0 37.0 40-44 36.4101 37.0 37.0 37.0 37.0 37.0 45-49 36.348699999999994 37.0 37.0 37.0 37.0 37.0 50-54 36.36130000000001 37.0 37.0 37.0 37.0 37.0 55-59 36.306 37.0 37.0 37.0 37.0 37.0 60-64 36.309900000000006 37.0 37.0 37.0 37.0 37.0 65-69 36.288 37.0 37.0 37.0 37.0 37.0 70-74 36.2042 37.0 37.0 37.0 37.0 37.0 75-79 36.2121 37.0 37.0 37.0 37.0 37.0 80-84 36.124700000000004 37.0 37.0 37.0 37.0 37.0 85-89 36.1579 37.0 37.0 37.0 37.0 37.0 90-94 36.1299 37.0 37.0 37.0 37.0 37.0 95-99 36.0112 37.0 37.0 37.0 37.0 37.0 100-104 36.023700000000005 37.0 37.0 37.0 37.0 37.0 105-109 35.9964 37.0 37.0 37.0 37.0 37.0 110-114 35.9164 37.0 37.0 37.0 37.0 37.0 115-119 35.941500000000005 37.0 37.0 37.0 37.0 37.0 120-124 35.8291 37.0 37.0 37.0 37.0 37.0 125-129 35.735 37.0 37.0 37.0 37.0 37.0 130-134 35.8033 37.0 37.0 37.0 37.0 37.0 135-139 35.668099999999995 37.0 37.0 37.0 37.0 37.0 140-144 35.3238 37.0 37.0 37.0 34.6 37.0 145-149 35.321600000000004 37.0 37.0 37.0 34.6 37.0 150-151 35.0445 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 2.0 20 0.0 21 0.0 22 0.0 23 1.0 24 2.0 25 3.0 26 8.0 27 12.0 28 12.0 29 25.0 30 20.0 31 47.0 32 48.0 33 78.0 34 159.0 35 396.0 36 2906.0 37 281.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.721373089451266 12.402906539714358 11.175144074166877 44.700576296667506 2 17.325 16.45 37.824999999999996 28.4 3 18.45 19.475 27.450000000000003 34.625 4 21.75 26.174999999999997 23.0 29.075 5 24.125 31.900000000000002 24.5 19.475 6 21.6 36.6 21.8 20.0 7 16.900000000000002 27.650000000000002 39.550000000000004 15.9 8 18.2 27.575 31.324999999999996 22.900000000000002 9 18.099999999999998 24.275 34.55 23.075000000000003 10-14 18.990000000000002 31.28 27.169999999999998 22.56 15-19 19.86 29.78 27.495000000000005 22.865 20-24 19.650000000000002 29.409999999999997 27.339999999999996 23.599999999999998 25-29 20.255000000000003 29.770000000000003 26.875 23.1 30-34 20.169999999999998 29.13 27.224999999999998 23.474999999999998 35-39 19.89 29.89 27.52 22.7 40-44 20.080000000000002 29.595 26.405 23.919999999999998 45-49 20.285 28.939999999999998 27.644999999999996 23.13 50-54 20.255000000000003 29.4 27.005000000000003 23.34 55-59 20.45 28.694999999999997 27.615000000000002 23.24 60-64 20.665 28.610000000000003 27.29 23.435 65-69 20.7 28.965000000000003 27.284999999999997 23.05 70-74 21.529999999999998 28.060000000000002 27.47 22.939999999999998 75-79 20.555 28.095 27.810000000000002 23.54 80-84 20.485 29.13 26.779999999999998 23.605 85-89 21.0 28.26 27.034999999999997 23.705000000000002 90-94 20.765 28.775000000000002 26.965 23.494999999999997 95-99 21.645 27.755000000000003 27.275 23.325000000000003 100-104 21.33 28.315 26.97 23.385 105-109 21.615000000000002 28.98 26.150000000000002 23.255 110-114 22.335 28.895 26.06 22.71 115-119 21.93 28.299999999999997 26.450000000000003 23.32 120-124 21.59 28.660000000000004 26.445 23.305 125-129 22.825 27.93 26.095000000000002 23.150000000000002 130-134 21.55 27.339999999999996 26.68 24.43 135-139 22.085 27.439999999999998 26.340000000000003 24.135 140-144 22.5 27.495000000000005 25.69 24.315 145-149 21.98 27.644999999999996 26.235000000000003 24.14 150-151 22.35 27.525 25.137500000000003 24.9875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 1.0 2 0.5 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.5 21 2.0 22 1.0 23 2.5 24 2.5 25 3.5 26 6.0 27 11.0 28 19.0 29 19.5 30 22.5 31 40.0 32 45.0 33 52.5 34 66.5 35 81.5 36 110.0 37 127.5 38 138.5 39 153.0 40 183.0 41 202.0 42 210.5 43 236.0 44 253.5 45 223.5 46 211.0 47 220.5 48 215.0 49 223.0 50 182.5 51 124.0 52 117.0 53 111.5 54 88.5 55 71.0 56 52.5 57 41.5 58 29.0 59 22.5 60 24.5 61 15.5 62 8.5 63 5.5 64 2.0 65 1.0 66 1.5 67 3.0 68 3.5 69 2.0 70 1.5 71 1.5 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.22499999999999998 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 82.25 #Duplication Level Percentage of deduplicated Percentage of total 1 82.97872340425532 68.25 2 13.556231003039516 22.3 3 2.7051671732522795 6.675000000000001 4 0.5167173252279635 1.7000000000000002 5 0.182370820668693 0.75 6 0.030395136778115502 0.15 7 0.030395136778115502 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCAAATCCCAACAGCCTTCCTCTTCACAGCATACTTCCCACAAAATTCA 7 0.17500000000000002 No Hit CAAGAATCTCTCACTTTCCGGGGGCGAAGTTTGTGGCATATGCCCAGGCG 6 0.15 No Hit AAGCAATCTCAGGATTATACATCTCTTAACTCCGCCTGACCGGGTCGAAA 5 0.125 No Hit CCCACAGTCATTACAAAGAATCCAAACCATCTTATTCAACATTTGAGGCA 5 0.125 No Hit CTCTAACAAACTTCTTCAGCCAGAAGCCGAGTTATTTTGGCATGTGGATG 5 0.125 No Hit GTCATTGTTAGCCTTTCTGGTGACCGGGAAAGCTGAGGTAGACTTGAGGC 5 0.125 No Hit CTGCACTTGACGAGTGTTGTCGAATCCAATGATACGGATAAAGGAGTTAG 5 0.125 No Hit TATACAGATCTCCATAGAAATATAACACCAAATAGATACAGAGTGTTCTC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.1875 0.0 0.0 0.0 0.0 78-79 0.30000000000000004 0.0 0.0 0.0 0.0 80-81 0.4 0.0 0.0 0.0 0.0 82-83 0.475 0.0 0.0 0.0 0.0 84-85 0.6375 0.0 0.0 0.0 0.0 86-87 0.7625 0.0 0.0 0.0 0.0 88-89 0.95 0.0 0.0 0.0 0.0 90-91 1.1625 0.0 0.0 0.0 0.0 92-93 1.55 0.0 0.0 0.0 0.0 94-95 1.875 0.0 0.0 0.0 0.0 96-97 2.2625 0.0 0.0 0.0 0.0 98-99 2.7375 0.0 0.0 0.0 0.0 100-101 3.2 0.0 0.0 0.0 0.0 102-103 3.5625 0.0 0.0 0.0 0.0 104-105 4.0125 0.0 0.0 0.0 0.0 106-107 4.775 0.0 0.0 0.0 0.0 108-109 5.2125 0.0 0.0 0.0 0.0 110-111 5.5 0.0 0.0 0.0 0.0 112-113 6.3 0.0 0.0 0.0 0.0 114-115 7.362500000000001 0.0 0.0 0.0 0.0 116-117 8.1875 0.0 0.0 0.0 0.0 118-119 8.9 0.0 0.0 0.0 0.0 120-121 9.6875 0.0 0.0 0.0 0.0 122-123 10.5 0.0 0.0 0.0 0.0 124-125 11.3625 0.0 0.0 0.0 0.0 126-127 12.0875 0.0 0.0 0.0 0.0 128-129 12.8625 0.0 0.0 0.0 0.0 130-131 13.475 0.0 0.0 0.0 0.0 132-133 14.4875 0.0 0.0 0.0 0.0 134-135 15.100000000000001 0.0 0.0 0.0 0.0 136-137 16.0125 0.0 0.0 0.0 0.0 138-139 16.95 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCTTGAG 10 0.006830828 145.0 2 TTGAAAA 10 0.006830828 145.0 9 >>END_MODULE SRR28623290 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623290_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.98 37.0 37.0 37.0 37.0 37.0 2 36.3945 37.0 37.0 37.0 37.0 37.0 3 36.2665 37.0 37.0 37.0 37.0 37.0 4 36.295 37.0 37.0 37.0 37.0 37.0 5 36.402 37.0 37.0 37.0 37.0 37.0 6 36.3735 37.0 37.0 37.0 37.0 37.0 7 36.254 37.0 37.0 37.0 37.0 37.0 8 36.271 37.0 37.0 37.0 37.0 37.0 9 36.2555 37.0 37.0 37.0 37.0 37.0 10-14 36.2463 37.0 37.0 37.0 37.0 37.0 15-19 36.2476 37.0 37.0 37.0 37.0 37.0 20-24 36.254999999999995 37.0 37.0 37.0 37.0 37.0 25-29 36.2241 37.0 37.0 37.0 37.0 37.0 30-34 36.1427 37.0 37.0 37.0 37.0 37.0 35-39 36.1695 37.0 37.0 37.0 37.0 37.0 40-44 36.1274 37.0 37.0 37.0 37.0 37.0 45-49 36.1386 37.0 37.0 37.0 37.0 37.0 50-54 36.0677 37.0 37.0 37.0 37.0 37.0 55-59 35.950599999999994 37.0 37.0 37.0 37.0 37.0 60-64 35.9932 37.0 37.0 37.0 37.0 37.0 65-69 36.013 37.0 37.0 37.0 37.0 37.0 70-74 36.0546 37.0 37.0 37.0 37.0 37.0 75-79 35.9975 37.0 37.0 37.0 37.0 37.0 80-84 35.908100000000005 37.0 37.0 37.0 37.0 37.0 85-89 35.8527 37.0 37.0 37.0 37.0 37.0 90-94 35.826299999999996 37.0 37.0 37.0 37.0 37.0 95-99 35.8275 37.0 37.0 37.0 37.0 37.0 100-104 35.792199999999994 37.0 37.0 37.0 37.0 37.0 105-109 35.7803 37.0 37.0 37.0 37.0 37.0 110-114 35.745400000000004 37.0 37.0 37.0 37.0 37.0 115-119 35.6904 37.0 37.0 37.0 37.0 37.0 120-124 35.7005 37.0 37.0 37.0 37.0 37.0 125-129 35.254 37.0 37.0 37.0 32.2 37.0 130-134 35.565999999999995 37.0 37.0 37.0 37.0 37.0 135-139 35.244699999999995 37.0 37.0 37.0 29.8 37.0 140-144 35.4187 37.0 37.0 37.0 37.0 37.0 145-149 35.295 37.0 37.0 37.0 34.6 37.0 150-151 34.9035 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 0.0 14 3.0 15 3.0 16 2.0 17 4.0 18 1.0 19 4.0 20 1.0 21 2.0 22 5.0 23 9.0 24 6.0 25 7.0 26 11.0 27 11.0 28 15.0 29 17.0 30 21.0 31 31.0 32 51.0 33 95.0 34 189.0 35 578.0 36 2624.0 37 309.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.55 20.65 14.85 28.95 2 27.775 24.75 30.375000000000004 17.1 3 22.3 26.174999999999997 31.125000000000004 20.4 4 24.65 32.175 24.425 18.75 5 25.7 35.975 20.8 17.525 6 21.075 38.175 22.900000000000002 17.849999999999998 7 21.075 20.175 38.775 19.975 8 21.575 25.275 29.549999999999997 23.599999999999998 9 23.275000000000002 24.775 29.75 22.2 10-14 24.565 28.205000000000002 26.19 21.04 15-19 23.71 28.884999999999998 26.58 20.825 20-24 22.919999999999998 28.444999999999997 27.279999999999998 21.355 25-29 23.919999999999998 28.595 26.650000000000002 20.835 30-34 23.630000000000003 27.91 26.765 21.695 35-39 22.775000000000002 27.994999999999997 27.855 21.375 40-44 23.84 27.96 26.945000000000004 21.255 45-49 23.51 28.16 27.439999999999998 20.89 50-54 23.26 28.095 27.284999999999997 21.36 55-59 23.885 27.029999999999998 28.1 20.985 60-64 23.32 27.450000000000003 28.07 21.16 65-69 22.825 27.85 28.12 21.205 70-74 23.724999999999998 26.924999999999997 27.834999999999997 21.515 75-79 23.425 28.23 27.145000000000003 21.2 80-84 23.09 27.855 28.000000000000004 21.055 85-89 23.96 27.355 28.09 20.595 90-94 23.46 27.92 27.455000000000002 21.165 95-99 23.580000000000002 27.845 27.950000000000003 20.625 100-104 24.145 27.985 27.46 20.41 105-109 24.11 28.215 26.875 20.8 110-114 25.28 28.325 26.72 19.675 115-119 25.480000000000004 28.02 26.669999999999998 19.830000000000002 120-124 25.81 28.655 26.479999999999997 19.055 125-129 26.255 27.12 26.72 19.905 130-134 26.290000000000003 27.529999999999998 27.05 19.13 135-139 26.235000000000003 27.095000000000002 27.060000000000002 19.61 140-144 26.314999999999998 27.765 26.995 18.925 145-149 27.744999999999997 26.740000000000002 27.305 18.21 150-151 28.199999999999996 27.237499999999997 26.150000000000002 18.4125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 1.0 10 1.5 11 1.0 12 0.5 13 1.0 14 1.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.5 21 2.5 22 3.5 23 2.5 24 2.0 25 2.5 26 4.5 27 7.5 28 8.0 29 13.0 30 18.0 31 22.0 32 34.0 33 46.0 34 54.5 35 60.5 36 84.5 37 111.0 38 122.5 39 135.0 40 172.0 41 191.0 42 214.5 43 242.5 44 255.0 45 252.0 46 247.0 47 251.5 48 231.0 49 234.5 50 218.0 51 153.0 52 114.5 53 97.0 54 77.0 55 67.5 56 52.5 57 38.0 58 36.5 59 33.0 60 19.5 61 17.0 62 13.0 63 4.0 64 1.5 65 1.5 66 2.0 67 1.5 68 1.0 69 0.5 70 1.0 71 1.0 72 0.0 73 0.5 74 1.5 75 1.5 76 0.5 77 0.5 78 0.5 79 0.5 80 0.5 81 0.0 82 0.5 83 0.5 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.5 93 0.5 94 0.0 95 0.5 96 0.5 97 0.0 98 0.5 99 0.5 100 2.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 82.72500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 83.59020852221215 69.15 2 13.115744938047749 21.7 3 2.629193109700816 6.525 4 0.423088546388637 1.4000000000000001 5 0.12088244182532487 0.5 6 0.030220610456331218 0.15 7 0.060441220912662436 0.35000000000000003 8 0.0 0.0 9 0.030220610456331218 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTGACTACTTGGGCAACCCAAGCTTGATCCACGCACAAAGCATCTTGGC 9 0.22499999999999998 No Hit CCCAGAGATCCTTCAAGGCGACCACCATGGTTGCAGACTAAGAGAACTAA 7 0.17500000000000002 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 7 0.17500000000000002 No Hit CTGCATAGCTTATAAGCTTGTAAGAGATGGCTTCCTCCTCTATGATCTCA 6 0.15 No Hit GGAAAGAGCAATGCACCATAATTGCCCTGTTTGCTTTGAGTTTCTCTTTG 5 0.125 No Hit CCCCAGTTGAAGCCACAAAAGCCTAATTTACATATTGAACAAGGCACTCA 5 0.125 No Hit GTTGACATGTATATGAATAAGGAAATCCAGATAGATGAGTTCATAACACA 5 0.125 No Hit ACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.21250000000000002 0.0 0.0 0.0 0.0 78-79 0.32499999999999996 0.0 0.0 0.0 0.0 80-81 0.425 0.0 0.0 0.0 0.0 82-83 0.5 0.0 0.0 0.0 0.0 84-85 0.6625 0.0 0.0 0.0 0.0 86-87 0.8 0.0 0.0 0.0 0.0 88-89 1.0 0.0 0.0 0.0 0.0 90-91 1.225 0.0 0.0 0.0 0.0 92-93 1.6125 0.0 0.0 0.0 0.0 94-95 1.9249999999999998 0.0 0.0 0.0 0.0 96-97 2.3375 0.0 0.0 0.0 0.0 98-99 2.8125 0.0 0.0 0.0 0.0 100-101 3.3 0.0 0.0 0.0 0.0 102-103 3.6625 0.0 0.0 0.0 0.0 104-105 4.1 0.0 0.0 0.0 0.0 106-107 4.8625 0.0 0.0 0.0 0.0 108-109 5.2875 0.0 0.0 0.0 0.0 110-111 5.575 0.0 0.0 0.0 0.0 112-113 6.387499999999999 0.0 0.0 0.0 0.0 114-115 7.4375 0.0 0.0 0.0 0.0 116-117 8.2875 0.0 0.0 0.0 0.0 118-119 9.024999999999999 0.0 0.0 0.0 0.0 120-121 9.825 0.0 0.0 0.0 0.0 122-123 10.600000000000001 0.0 0.0 0.0 0.0 124-125 11.425 0.0 0.0 0.0 0.0 126-127 12.1375 0.0 0.0 0.0 0.0 128-129 12.912500000000001 0.0 0.0 0.0 0.0 130-131 13.5125 0.0 0.0 0.0 0.0 132-133 14.5125 0.0 0.0 0.0 0.0 134-135 15.125 0.0 0.0 0.0 0.0 136-137 16.075 0.0 0.0 0.0 0.0 138-139 17.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1640024 spots for SRR28623290.sra Written 1640024 spots for SRR28623290.sra Read 1640024 spots for SRR28623290.sra Written 1640024 spots for SRR28623290.sra Read 1640024 spots for SRR28623290.sra Written 1640024 spots for SRR28623290.sra Read 1640024 spots for SRR28623290.sra Written 1640024 spots for SRR28623290.sra Read 1640024 spots for SRR28623290.sra Written 1640024 spots for SRR28623290.sra Read 1640024 spots for SRR28623290.sra Written 1640024 spots for SRR28623290.sra Read 1640024 spots for SRR28623290.sra Written 1640024 spots for SRR28623290.sra Read 1640024 spots for SRR28623290.sra Written 1640024 spots for SRR28623290.sra Read 1640024 spots for SRR28623290.sra Written 1640024 spots for SRR28623290.sra Read 1640024 spots for SRR28623290.sra Written 1640024 spots for SRR28623290.sra Read 1640024 spots for SRR28623290.sra Written 1640024 spots for SRR28623290.sra Read 1640024 spots for SRR28623290.sra Written 1640024 spots for SRR28623290.sra Read 1640028 spots for SRR28623290.sra Written 1640028 spots for SRR28623290.sra Read 1640024 spots for SRR28623290.sra Written 1640024 spots for SRR28623290.sra Read 1640024 spots for SRR28623290.sra Written 1640024 spots for SRR28623290.sra Read 1640024 spots for SRR28623290.sra Written 1640024 spots for SRR28623290.sra Read 1640024 spots for SRR28623290.sra Written 1640024 spots for SRR28623290.sra Read 1640024 spots for SRR28623290.sra Written 1640024 spots for SRR28623290.sra Read 1640024 spots for SRR28623290.sra Written 1640024 spots for SRR28623290.sra Read 1640024 spots for SRR28623290.sra Written 1640024 spots for SRR28623290.sra SRR ids: ['SRR28623290.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6e2epazy SRR28623290.sra spots: 32800484 blocks: [[1, 1640024], [1640025, 3280048], [3280049, 4920072], [4920073, 6560096], [6560097, 8200120], [8200121, 9840144], [9840145, 11480168], [11480169, 13120192], [13120193, 14760216], [14760217, 16400240], [16400241, 18040264], [18040265, 19680288], [19680289, 21320312], [21320313, 22960336], [22960337, 24600360], [24600361, 26240384], [26240385, 27880408], [27880409, 29520432], [29520433, 31160456], [31160457, 32800484]] SRR28623290 file size 12112049 SRR28623290 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR28623290 SRR28623290_1.fastq SRR28623290_2.fastq Input file: SRR28623290_1.fastq Paired file: SRR28623290_2.fastq trimmed: SRR28623290-trimmed-pair1.fastq, SRR28623290-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 14:22:29 2025 >> started Tue Feb 11 14:23:08 2025 >> done (39.189s) 32800484 read pairs processed; of these: 17 ( 0.00%) short read pairs filtered out after trimming by size control 71038 ( 0.22%) empty read pairs filtered out after trimming by size control 32729429 (99.78%) read pairs available; of these: 7673149 (23.44%) trimmed read pairs available after processing 25056280 (76.56%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 6 0.00% 20 4 0.00% 21 1 0.00% 22 3 0.00% 23 5 0.00% 24 7 0.00% 25 5 0.00% 26 7 0.00% 27 12 0.00% 28 14 0.00% 29 7 0.00% 30 13 0.00% 31 25 0.00% 32 10 0.00% 33 21 0.00% 34 33 0.00% 35 36 0.00% 36 47 0.00% 37 57 0.00% 38 51 0.00% 39 82 0.00% 40 75 0.00% 41 117 0.00% 42 110 0.00% 43 153 0.00% 44 139 0.00% 45 173 0.00% 46 217 0.00% 47 213 0.00% 48 270 0.00% 49 292 0.00% 50 372 0.00% 51 424 0.00% 52 482 0.00% 53 526 0.00% 54 597 0.00% 55 702 0.00% 56 769 0.00% 57 845 0.00% 58 1045 0.00% 59 1225 0.00% 60 1373 0.00% 61 1604 0.00% 62 1894 0.01% 63 2135 0.01% 64 2430 0.01% 65 2749 0.01% 66 3094 0.01% 67 3429 0.01% 68 3877 0.01% 69 4439 0.01% 70 5079 0.02% 71 5983 0.02% 72 6988 0.02% 73 7870 0.02% 74 8921 0.03% 75 10022 0.03% 76 11479 0.04% 77 12495 0.04% 78 13863 0.04% 79 15637 0.05% 80 17107 0.05% 81 19093 0.06% 82 21110 0.06% 83 23735 0.07% 84 25962 0.08% 85 29268 0.09% 86 31253 0.10% 87 34177 0.10% 88 36657 0.11% 89 39074 0.12% 90 41806 0.13% 91 44793 0.14% 92 47849 0.15% 93 51631 0.16% 94 54845 0.17% 95 58402 0.18% 96 62347 0.19% 97 65957 0.20% 98 67981 0.21% 99 70576 0.22% 100 73382 0.22% 101 75783 0.23% 102 79194 0.24% 103 82400 0.25% 104 85507 0.26% 105 88470 0.27% 106 92507 0.28% 107 96059 0.29% 108 97900 0.30% 109 101721 0.31% 110 102821 0.31% 111 104742 0.32% 112 107300 0.33% 113 109267 0.33% 114 112081 0.34% 115 116736 0.36% 116 119312 0.36% 117 122212 0.37% 118 124548 0.38% 119 126389 0.39% 120 128998 0.39% 121 129567 0.40% 122 130015 0.40% 123 132147 0.40% 124 135254 0.41% 125 136089 0.42% 126 139337 0.43% 127 142093 0.43% 128 143837 0.44% 129 146228 0.45% 130 147279 0.45% 131 146552 0.45% 132 149063 0.46% 133 151042 0.46% 134 151794 0.46% 135 152258 0.47% 136 154099 0.47% 137 155635 0.48% 138 157479 0.48% 139 160232 0.49% 140 159855 0.49% 141 159653 0.49% 142 159654 0.49% 143 160626 0.49% 144 161392 0.49% 145 162108 0.50% 146 162304 0.50% 147 162907 0.50% 148 166210 0.51% 149 165782 0.51% 150 167150 0.51% 151 25056280 76.56% 32729429 reads passed initial QC criterion=sequence-density sequence-density=0.95 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=27 prefix-density=0.95 prefix-fanout=1.9 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.32 sequence-density-rank=20 fanout-score=6.24 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=4.1 sequence=ACATTACAAGCCAA criterion=sequence-density sequence-density=0.84 sequence-density-rank=1 fanout-score=1.93 fanout-score-rank=25 prefix-density=0.84 prefix-fanout=1.9 sequence=CTACCCATGTTTGGATGCACTGAGGCATCTCA criterion=fanout-score sequence-density=0.50 sequence-density-rank=13 fanout-score=5.51 fanout-score-rank=1 prefix-density=0.65 prefix-fanout=4.2 sequence=AACAACAACGCCTGGGCATATGCCACAAACTTCGTTCCCGGAAAGTG SRR28623290 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 14:23:50 Started mapping on | Feb 11 14:23:50 Finished on | Feb 11 14:26:31 Mapping speed, Million of reads per hour | 731.84 Number of input reads | 32729429 Average input read length | 288 UNIQUE READS: Uniquely mapped reads number | 31076431 Uniquely mapped reads % | 94.95% Average mapped length | 287.60 Number of splices: Total | 25297778 Number of splices: Annotated (sjdb) | 24790275 Number of splices: GT/AG | 24703304 Number of splices: GC/AG | 497709 Number of splices: AT/AC | 22742 Number of splices: Non-canonical | 74023 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.67 Insertion rate per base | 0.03% Insertion average length | 2.23 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 806746 % of reads mapped to multiple loci | 2.46% Number of reads mapped to too many loci | 211909 % of reads mapped to too many loci | 0.65% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.76% % of reads unmapped: other | 0.18% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 846252 846252 846252 N_multimapping 806746 806746 806746 N_noFeature 1067934 30618314 1230701 N_ambiguous 527257 1887 230778 UnstrandedReadsAssigned:29481240 PositiveStrandReadsAssigned:456230 NegativeStrandReadsAssigned:29614952 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=143 echo kmer=139 SRR28623290 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR28623290-trimmed-pair1.fastq SRR28623290-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 32,729,429 reads, 30,139,598 reads pseudoaligned [quant] estimated average fragment length: 201.877 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,313 rounds 52401 SRR28623290.ke.tsv 34699 SRR28623290.se.tsv 87100 total ==> SRR28623290.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1817.12 1932 34.5305 Potri.005G024800.1.v4.1 1035 834.123 228 8.87737 Potri.004G059700.1.v4.1 961 760.123 96 4.10173 Potri.007G009000.2.v4.1 1416 1215.12 2 0.0534551 Potri.003G141000.2.v4.1 2943 2742.12 469.458 5.56019 Potri.016G087400.1.v4.1 270 101.663 1077.71 344.285 Potri.015G069301.1.v4.1 564 365.387 0 0 Potri.010G195200.1.v4.1 1773 1572.12 0 0 Potri.012G127500.1.v4.1 977 776.123 3771 157.8 ==> SRR28623290.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 30 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 684 Potri.001G212900.v4.1 8 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 4 Potri.001G452600.v4.1 1 SRR28623290 completed mapping pipeline successfully