Starting /dee2/code/volunteer_pipeline.sh SRR28623291 current disk space = 3049883185152 free memory = 1289275244 SRR28623291 SRAfilesize a660d25ed23e8f0621b8451ebb1a33d4 SRR28623291.sra SRR28623291.sra file validated SRR28623291 is paired end SRR28623291 is conventional basespace SRR28623291 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623291_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.8395 37.0 37.0 37.0 37.0 37.0 2 36.3925 37.0 37.0 37.0 37.0 37.0 3 36.4865 37.0 37.0 37.0 37.0 37.0 4 36.5685 37.0 37.0 37.0 37.0 37.0 5 36.6625 37.0 37.0 37.0 37.0 37.0 6 36.713 37.0 37.0 37.0 37.0 37.0 7 36.5815 37.0 37.0 37.0 37.0 37.0 8 36.6935 37.0 37.0 37.0 37.0 37.0 9 36.7315 37.0 37.0 37.0 37.0 37.0 10-14 36.5989 37.0 37.0 37.0 37.0 37.0 15-19 36.567499999999995 37.0 37.0 37.0 37.0 37.0 20-24 36.558800000000005 37.0 37.0 37.0 37.0 37.0 25-29 36.5109 37.0 37.0 37.0 37.0 37.0 30-34 36.4594 37.0 37.0 37.0 37.0 37.0 35-39 36.4071 37.0 37.0 37.0 37.0 37.0 40-44 36.3754 37.0 37.0 37.0 37.0 37.0 45-49 36.293600000000005 37.0 37.0 37.0 37.0 37.0 50-54 36.2295 37.0 37.0 37.0 37.0 37.0 55-59 36.2387 37.0 37.0 37.0 37.0 37.0 60-64 36.225100000000005 37.0 37.0 37.0 37.0 37.0 65-69 36.1059 37.0 37.0 37.0 37.0 37.0 70-74 36.1083 37.0 37.0 37.0 37.0 37.0 75-79 36.0862 37.0 37.0 37.0 37.0 37.0 80-84 36.0187 37.0 37.0 37.0 37.0 37.0 85-89 35.98010000000001 37.0 37.0 37.0 37.0 37.0 90-94 36.020900000000005 37.0 37.0 37.0 37.0 37.0 95-99 35.926300000000005 37.0 37.0 37.0 37.0 37.0 100-104 35.8738 37.0 37.0 37.0 37.0 37.0 105-109 35.829600000000006 37.0 37.0 37.0 37.0 37.0 110-114 35.762699999999995 37.0 37.0 37.0 37.0 37.0 115-119 35.6995 37.0 37.0 37.0 37.0 37.0 120-124 35.575599999999994 37.0 37.0 37.0 37.0 37.0 125-129 35.3728 37.0 37.0 37.0 37.0 37.0 130-134 35.1339 37.0 37.0 37.0 27.4 37.0 135-139 34.958299999999994 37.0 37.0 37.0 27.4 37.0 140-144 34.6167 37.0 37.0 37.0 25.0 37.0 145-149 34.2044 37.0 37.0 37.0 25.0 37.0 150-151 33.426249999999996 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 4.0 24 5.0 25 2.0 26 14.0 27 12.0 28 18.0 29 27.0 30 32.0 31 51.0 32 101.0 33 114.0 34 206.0 35 431.0 36 2824.0 37 159.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.631631631631627 13.98898898898899 11.036036036036036 43.34334334334334 2 16.175 15.625 38.475 29.725 3 17.175 18.425 28.449999999999996 35.949999999999996 4 21.5 25.05 24.75 28.7 5 25.1 32.025 23.674999999999997 19.2 6 19.650000000000002 34.525 24.099999999999998 21.725 7 15.049999999999999 28.449999999999996 40.425 16.075 8 17.025000000000002 28.675 31.8 22.5 9 17.424999999999997 24.325 35.4 22.85 10-14 18.73 30.975 27.88 22.415 15-19 18.825 29.270000000000003 28.13 23.775 20-24 18.834999999999997 29.34 28.689999999999998 23.135 25-29 19.245 29.38 27.92 23.455000000000002 30-34 18.925 29.685 27.85 23.54 35-39 19.255 29.665000000000003 27.825 23.255 40-44 19.35 29.304999999999996 27.67 23.674999999999997 45-49 19.470000000000002 30.014999999999997 26.779999999999998 23.735 50-54 19.74 29.59 27.900000000000002 22.770000000000003 55-59 19.495 29.544999999999998 27.639999999999997 23.32 60-64 19.900000000000002 28.595 27.589999999999996 23.915 65-69 20.145 29.07 28.1 22.685 70-74 19.215 29.62 27.755000000000003 23.41 75-79 19.89 29.555 27.465 23.09 80-84 19.67 29.595 27.43 23.305 85-89 20.14 29.01 27.839999999999996 23.01 90-94 20.125 28.744999999999997 27.400000000000002 23.73 95-99 20.395 29.404999999999998 26.834999999999997 23.365 100-104 19.905 29.42 27.134999999999998 23.54 105-109 20.57 29.18 26.640000000000004 23.61 110-114 20.735 29.13 26.05 24.085 115-119 21.310000000000002 29.9 25.905 22.884999999999998 120-124 21.105 28.71 26.3 23.885 125-129 21.68 28.915000000000003 25.435000000000002 23.97 130-134 21.295 29.565 25.590000000000003 23.549999999999997 135-139 21.695 28.084999999999997 25.755 24.465 140-144 22.61 27.42 25.94 24.03 145-149 23.135 28.155 25.115 23.595 150-151 24.025 26.637499999999996 25.7875 23.549999999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 1.0 18 1.0 19 0.5 20 1.0 21 1.5 22 1.0 23 1.5 24 2.5 25 4.5 26 10.0 27 13.0 28 16.0 29 23.0 30 29.0 31 43.0 32 54.5 33 59.0 34 71.0 35 90.0 36 117.5 37 148.5 38 160.0 39 179.5 40 203.0 41 224.5 42 244.5 43 249.0 44 250.0 45 248.5 46 236.5 47 207.5 48 197.0 49 179.5 50 152.0 51 127.0 52 93.5 53 72.5 54 59.0 55 49.0 56 41.0 57 31.5 58 24.5 59 19.5 60 12.5 61 8.0 62 6.0 63 5.0 64 5.5 65 4.5 66 2.5 67 0.5 68 0.0 69 0.0 70 1.5 71 2.0 72 1.5 73 1.0 74 1.0 75 1.5 76 0.5 77 1.5 78 1.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.5 97 0.5 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.89999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 98.00817160367721 95.95 2 1.8896833503575077 3.6999999999999997 3 0.07660878447395301 0.22499999999999998 4 0.0 0.0 5 0.02553626149131767 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGTCCAGAATCTCGGGG 5 0.125 TruSeq Adapter, Index 4 (97% over 39bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.037500000000000006 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.16249999999999998 0.0 0.0 0.0 0.0 66-67 0.2 0.0 0.0 0.0 0.0 68-69 0.25 0.0 0.0 0.0 0.0 70-71 0.4125 0.0 0.0 0.0 0.0 72-73 0.44999999999999996 0.0 0.0 0.0 0.0 74-75 0.5625 0.0 0.0 0.0 0.0 76-77 0.6875 0.0 0.0 0.0 0.0 78-79 0.8125 0.0 0.0 0.0 0.0 80-81 1.0375 0.0 0.0 0.0 0.0 82-83 1.1625 0.0 0.0 0.0 0.0 84-85 1.3375 0.0 0.0 0.0 0.0 86-87 1.5499999999999998 0.0 0.0 0.0 0.0 88-89 1.8125 0.0 0.0 0.0 0.0 90-91 2.3 0.0 0.0 0.0 0.0 92-93 2.75 0.0 0.0 0.0 0.0 94-95 3.35 0.0 0.0 0.0 0.0 96-97 4.0125 0.0 0.0 0.0 0.0 98-99 4.6625 0.0 0.0 0.0 0.0 100-101 5.324999999999999 0.0 0.0 0.0 0.0 102-103 5.9625 0.0 0.0 0.0 0.0 104-105 6.925000000000001 0.0 0.0 0.0 0.0 106-107 7.8500000000000005 0.0 0.0 0.0 0.0 108-109 8.787500000000001 0.0 0.0 0.0 0.0 110-111 9.675 0.0 0.0 0.0 0.0 112-113 10.2625 0.0 0.0 0.0 0.0 114-115 11.125 0.0 0.0 0.0 0.0 116-117 12.100000000000001 0.0 0.0 0.0 0.0 118-119 13.2625 0.0 0.0 0.0 0.0 120-121 14.25 0.0 0.0 0.0 0.0 122-123 15.5 0.0 0.0 0.0 0.0 124-125 16.675 0.0 0.0 0.0 0.0 126-127 17.575000000000003 0.0 0.0 0.0 0.0 128-129 18.575000000000003 0.0 0.0 0.0 0.0 130-131 19.7875 0.0 0.0 0.0 0.0 132-133 20.987499999999997 0.0 0.0 0.0 0.0 134-135 22.0875 0.0 0.0 0.0 0.0 136-137 23.2125 0.0 0.0 0.0 0.0 138-139 24.4625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAGAAA 10 0.006830828 145.0 2 TCTCGGG 35 0.0035366106 20.714287 140-144 ATCTCGG 45 6.5511256E-4 19.333332 140-144 CCAGAAT 55 0.0025160722 15.818182 135-139 AGAATCT 55 0.0025160722 15.818182 135-139 TGTCCAG 65 0.0076375785 13.384615 130-134 CAGAATC 65 0.0076375785 13.384615 135-139 CTGTCCA 65 0.0076375785 13.384615 130-134 >>END_MODULE SRR28623291 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623291_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.153 37.0 37.0 37.0 37.0 37.0 2 36.4735 37.0 37.0 37.0 37.0 37.0 3 36.42 37.0 37.0 37.0 37.0 37.0 4 36.5475 37.0 37.0 37.0 37.0 37.0 5 36.4275 37.0 37.0 37.0 37.0 37.0 6 36.4765 37.0 37.0 37.0 37.0 37.0 7 36.4045 37.0 37.0 37.0 37.0 37.0 8 36.476 37.0 37.0 37.0 37.0 37.0 9 36.4885 37.0 37.0 37.0 37.0 37.0 10-14 36.4307 37.0 37.0 37.0 37.0 37.0 15-19 36.40390000000001 37.0 37.0 37.0 37.0 37.0 20-24 36.3335 37.0 37.0 37.0 37.0 37.0 25-29 36.256899999999995 37.0 37.0 37.0 37.0 37.0 30-34 36.2222 37.0 37.0 37.0 37.0 37.0 35-39 36.1721 37.0 37.0 37.0 37.0 37.0 40-44 36.1586 37.0 37.0 37.0 37.0 37.0 45-49 36.119299999999996 37.0 37.0 37.0 37.0 37.0 50-54 36.084900000000005 37.0 37.0 37.0 37.0 37.0 55-59 36.0141 37.0 37.0 37.0 37.0 37.0 60-64 36.0237 37.0 37.0 37.0 37.0 37.0 65-69 35.958000000000006 37.0 37.0 37.0 37.0 37.0 70-74 35.8632 37.0 37.0 37.0 37.0 37.0 75-79 35.8609 37.0 37.0 37.0 37.0 37.0 80-84 35.825900000000004 37.0 37.0 37.0 37.0 37.0 85-89 35.721 37.0 37.0 37.0 37.0 37.0 90-94 35.7013 37.0 37.0 37.0 37.0 37.0 95-99 35.6743 37.0 37.0 37.0 37.0 37.0 100-104 35.552800000000005 37.0 37.0 37.0 37.0 37.0 105-109 35.5284 37.0 37.0 37.0 37.0 37.0 110-114 35.4364 37.0 37.0 37.0 37.0 37.0 115-119 35.218900000000005 37.0 37.0 37.0 32.2 37.0 120-124 35.182399999999994 37.0 37.0 37.0 27.4 37.0 125-129 35.124199999999995 37.0 37.0 37.0 25.0 37.0 130-134 35.0851 37.0 37.0 37.0 25.0 37.0 135-139 34.9264 37.0 37.0 37.0 25.0 37.0 140-144 34.9194 37.0 37.0 37.0 25.0 37.0 145-149 34.5552 37.0 37.0 37.0 25.0 37.0 150-151 34.1365 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 3.0 14 1.0 15 2.0 16 5.0 17 0.0 18 0.0 19 2.0 20 1.0 21 1.0 22 5.0 23 5.0 24 10.0 25 12.0 26 13.0 27 16.0 28 16.0 29 23.0 30 29.0 31 47.0 32 63.0 33 104.0 34 220.0 35 659.0 36 2584.0 37 179.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.625 20.375 14.075 26.924999999999997 2 26.55 26.125 30.7 16.625 3 22.175 28.225 32.65 16.950000000000003 4 26.125 32.324999999999996 24.575 16.975 5 25.8 35.199999999999996 23.625 15.375 6 21.224999999999998 38.800000000000004 23.025000000000002 16.950000000000003 7 21.825 19.8 39.75 18.625 8 23.425 25.8 28.025 22.75 9 22.775000000000002 25.674999999999997 31.825 19.725 10-14 24.05 29.154999999999998 26.83 19.965 15-19 23.674999999999997 27.900000000000002 28.59 19.835 20-24 23.79 27.615000000000002 28.615000000000002 19.98 25-29 23.41 28.02 28.244999999999997 20.325 30-34 23.355 27.855 28.71 20.080000000000002 35-39 23.705000000000002 28.26 28.139999999999997 19.895 40-44 23.805 27.655 28.665000000000003 19.875 45-49 23.605 27.195000000000004 28.999999999999996 20.200000000000003 50-54 23.465 27.894999999999996 28.76 19.88 55-59 23.544999999999998 27.505000000000003 29.285 19.665 60-64 24.025 27.12 28.84 20.015 65-69 23.645 27.71 28.875 19.77 70-74 23.885 27.994999999999997 28.735 19.384999999999998 75-79 24.075 27.76 28.77 19.395 80-84 24.645 27.665 28.389999999999997 19.3 85-89 23.66 28.194999999999997 28.265 19.88 90-94 23.715 28.28 28.335 19.67 95-99 24.59 27.97 28.335 19.105 100-104 24.610000000000003 28.37 28.07 18.95 105-109 25.22 27.955000000000002 28.060000000000002 18.765 110-114 25.755 28.125 27.73 18.39 115-119 26.240000000000002 28.33 26.640000000000004 18.790000000000003 120-124 26.795 28.13 26.905 18.17 125-129 26.775 27.994999999999997 27.075 18.154999999999998 130-134 27.62 27.935 27.13 17.315 135-139 28.015 27.785 26.884999999999998 17.315 140-144 28.285 27.560000000000002 26.75 17.405 145-149 29.060000000000002 28.03 26.009999999999998 16.900000000000002 150-151 29.0875 27.35 25.7625 17.8 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.5 10 0.5 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 1.5 21 1.5 22 1.5 23 2.5 24 2.0 25 5.0 26 6.0 27 5.5 28 9.5 29 15.5 30 21.0 31 29.0 32 37.5 33 41.5 34 60.0 35 88.0 36 105.5 37 117.5 38 143.0 39 181.0 40 206.0 41 225.0 42 271.5 43 312.0 44 287.5 45 267.5 46 256.5 47 215.0 48 189.0 49 168.0 50 141.5 51 114.5 52 98.5 53 81.5 54 64.5 55 54.0 56 36.0 57 25.0 58 20.0 59 18.5 60 14.5 61 7.5 62 6.0 63 4.5 64 3.5 65 4.5 66 3.5 67 2.0 68 1.0 69 0.5 70 0.5 71 1.5 72 2.5 73 1.5 74 0.5 75 1.0 76 1.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.5 86 1.5 87 1.0 88 0.0 89 1.0 90 1.0 91 0.5 92 1.0 93 1.5 94 1.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.7 #Duplication Level Percentage of deduplicated Percentage of total 1 97.90174002047083 95.65 2 1.9447287615148412 3.8 3 0.127942681678608 0.375 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0255885363357216 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.037500000000000006 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.16249999999999998 0.0 0.0 0.0 0.0 66-67 0.2 0.0 0.0 0.0 0.0 68-69 0.25 0.0 0.0 0.0 0.0 70-71 0.42500000000000004 0.0 0.0 0.0 0.0 72-73 0.475 0.0 0.0 0.0 0.0 74-75 0.5874999999999999 0.0 0.0 0.0 0.0 76-77 0.7125 0.0 0.0 0.0 0.0 78-79 0.8500000000000001 0.0 0.0 0.0 0.0 80-81 1.0875 0.0 0.0 0.0 0.0 82-83 1.2125 0.0 0.0 0.0 0.0 84-85 1.3875 0.0 0.0 0.0 0.0 86-87 1.6 0.0 0.0 0.0 0.0 88-89 1.875 0.0 0.0 0.0 0.0 90-91 2.4 0.0 0.0 0.0 0.0 92-93 2.8499999999999996 0.0 0.0 0.0 0.0 94-95 3.475 0.0 0.0 0.0 0.0 96-97 4.15 0.0 0.0 0.0 0.0 98-99 4.8125 0.0 0.0 0.0 0.0 100-101 5.487500000000001 0.0 0.0 0.0 0.0 102-103 6.1625 0.0 0.0 0.0 0.0 104-105 7.112500000000001 0.0 0.0 0.0 0.0 106-107 8.0375 0.0 0.0 0.0 0.0 108-109 9.025 0.0 0.0 0.0 0.0 110-111 9.95 0.0 0.0 0.0 0.0 112-113 10.5625 0.0 0.0 0.0 0.0 114-115 11.4625 0.0 0.0 0.0 0.0 116-117 12.5 0.0 0.0 0.0 0.0 118-119 13.6375 0.0 0.0 0.0 0.0 120-121 14.649999999999999 0.0 0.0 0.0 0.0 122-123 15.975000000000001 0.0 0.0 0.0 0.0 124-125 17.1625 0.0 0.0 0.0 0.0 126-127 18.15 0.0 0.0 0.0 0.0 128-129 19.15 0.0 0.0 0.0 0.0 130-131 20.4 0.0 0.0 0.0 0.0 132-133 21.675 0.0 0.0 0.0 0.0 134-135 22.8375 0.0 0.0 0.0 0.0 136-137 23.9625 0.0 0.0 0.0 0.0 138-139 25.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAGATCT 40 2.9585467E-4 21.75 140-144 GTAGATC 45 6.5511256E-4 19.333332 140-144 GAGTGTA 50 0.0013298223 17.4 135-139 TGTAGAT 55 0.0025160722 15.818182 140-144 TGTCCAG 65 0.0076375785 13.384615 130-134 CAGAGTG 65 0.0076375785 13.384615 135-139 GTCCAGA 65 0.0076375785 13.384615 130-134 AGAGTGT 130 0.0070306947 8.923077 135-139 >>END_MODULE Read 663814 spots for SRR28623291.sra Written 663814 spots for SRR28623291.sra Read 663814 spots for SRR28623291.sra Written 663814 spots for SRR28623291.sra Read 663814 spots for SRR28623291.sra Written 663814 spots for SRR28623291.sra Read 663814 spots for SRR28623291.sra Written 663814 spots for SRR28623291.sra Read 663814 spots for SRR28623291.sra Written 663814 spots for SRR28623291.sra Read 663814 spots for SRR28623291.sra Written 663814 spots for SRR28623291.sra Read 663814 spots for SRR28623291.sra Written 663814 spots for SRR28623291.sra Read 663814 spots for SRR28623291.sra Written 663814 spots for SRR28623291.sra Read 663814 spots for SRR28623291.sra Written 663814 spots for SRR28623291.sra Read 663821 spots for SRR28623291.sra Written 663821 spots for SRR28623291.sra Read 663814 spots for SRR28623291.sra Written 663814 spots for SRR28623291.sra Read 663814 spots for SRR28623291.sra Written 663814 spots for SRR28623291.sra Read 663814 spots for SRR28623291.sra Written 663814 spots for SRR28623291.sra Read 663814 spots for SRR28623291.sra Written 663814 spots for SRR28623291.sra Read 663814 spots for SRR28623291.sra Written 663814 spots for SRR28623291.sra Read 663814 spots for SRR28623291.sra Written 663814 spots for SRR28623291.sra Read 663814 spots for SRR28623291.sra Written 663814 spots for SRR28623291.sra Read 663814 spots for SRR28623291.sra Written 663814 spots for SRR28623291.sra Read 663814 spots for SRR28623291.sra Written 663814 spots for SRR28623291.sra Read 663814 spots for SRR28623291.sra Written 663814 spots for SRR28623291.sra SRR ids: ['SRR28623291.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_aond5s6b SRR28623291.sra spots: 13276287 blocks: [[1, 663814], [663815, 1327628], [1327629, 1991442], [1991443, 2655256], [2655257, 3319070], [3319071, 3982884], [3982885, 4646698], [4646699, 5310512], [5310513, 5974326], [5974327, 6638140], [6638141, 7301954], [7301955, 7965768], [7965769, 8629582], [8629583, 9293396], [9293397, 9957210], [9957211, 10621024], [10621025, 11284838], [11284839, 11948652], [11948653, 12612466], [12612467, 13276287]] SRR28623291 file size 4895971 SRR28623291 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR28623291 SRR28623291_1.fastq SRR28623291_2.fastq Input file: SRR28623291_1.fastq Paired file: SRR28623291_2.fastq trimmed: SRR28623291-trimmed-pair1.fastq, SRR28623291-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 14:45:44 2025 >> started Tue Feb 11 14:46:01 2025 >> done (16.359s) 13276287 read pairs processed; of these: 9 ( 0.00%) short read pairs filtered out after trimming by size control 23328 ( 0.18%) empty read pairs filtered out after trimming by size control 13252950 (99.82%) read pairs available; of these: 4223740 (31.87%) trimmed read pairs available after processing 9029210 (68.13%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 0 0.00% 20 0 0.00% 21 0 0.00% 22 0 0.00% 23 4 0.00% 24 3 0.00% 25 2 0.00% 26 1 0.00% 27 2 0.00% 28 2 0.00% 29 4 0.00% 30 3 0.00% 31 11 0.00% 32 4 0.00% 33 16 0.00% 34 19 0.00% 35 18 0.00% 36 15 0.00% 37 25 0.00% 38 38 0.00% 39 31 0.00% 40 44 0.00% 41 67 0.00% 42 61 0.00% 43 81 0.00% 44 97 0.00% 45 80 0.00% 46 127 0.00% 47 129 0.00% 48 173 0.00% 49 182 0.00% 50 288 0.00% 51 299 0.00% 52 365 0.00% 53 415 0.00% 54 445 0.00% 55 516 0.00% 56 615 0.00% 57 683 0.01% 58 853 0.01% 59 965 0.01% 60 1162 0.01% 61 1325 0.01% 62 1630 0.01% 63 1796 0.01% 64 2060 0.02% 65 2327 0.02% 66 2484 0.02% 67 2994 0.02% 68 3348 0.03% 69 3778 0.03% 70 4422 0.03% 71 4914 0.04% 72 5736 0.04% 73 6855 0.05% 74 7467 0.06% 75 8476 0.06% 76 9418 0.07% 77 10125 0.08% 78 11365 0.09% 79 12484 0.09% 80 13740 0.10% 81 15159 0.11% 82 16841 0.13% 83 18302 0.14% 84 20808 0.16% 85 22946 0.17% 86 24385 0.18% 87 25841 0.19% 88 27857 0.21% 89 29142 0.22% 90 31170 0.24% 91 33161 0.25% 92 34760 0.26% 93 37352 0.28% 94 39431 0.30% 95 41732 0.31% 96 43956 0.33% 97 45571 0.34% 98 46643 0.35% 99 47887 0.36% 100 49863 0.38% 101 50598 0.38% 102 51701 0.39% 103 53684 0.41% 104 55514 0.42% 105 57245 0.43% 106 59019 0.45% 107 60732 0.46% 108 60651 0.46% 109 61944 0.47% 110 62297 0.47% 111 63273 0.48% 112 65403 0.49% 113 64641 0.49% 114 66407 0.50% 115 67889 0.51% 116 68547 0.52% 117 69890 0.53% 118 70768 0.53% 119 70946 0.54% 120 70523 0.53% 121 71227 0.54% 122 70637 0.53% 123 71597 0.54% 124 71904 0.54% 125 71078 0.54% 126 73049 0.55% 127 73100 0.55% 128 74122 0.56% 129 74174 0.56% 130 74158 0.56% 131 73466 0.55% 132 73197 0.55% 133 73440 0.55% 134 72915 0.55% 135 73191 0.55% 136 73598 0.56% 137 72774 0.55% 138 73888 0.56% 139 75098 0.57% 140 75032 0.57% 141 74061 0.56% 142 74379 0.56% 143 73536 0.55% 144 72697 0.55% 145 72992 0.55% 146 73216 0.55% 147 72686 0.55% 148 73550 0.55% 149 72665 0.55% 150 73244 0.55% 151 9029210 68.13% 13252950 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=2.07 fanout-score-rank=33 prefix-density=0.21 prefix-fanout=2.0 sequence=TACGTGCTTAAT criterion=fanout-score sequence-density=0.10 sequence-density-rank=13 fanout-score=31.33 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=11.2 sequence=CCATCTTCTTCATCTATAGATTTCAATCACAACAG criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=10.39 fanout-score-rank=11 prefix-density=0.32 prefix-fanout=5.5 sequence=AAGATTTGATGAG criterion=fanout-score sequence-density=0.11 sequence-density-rank=13 fanout-score=32.25 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=13.3 sequence=AGAAGCAAGCAAAGTTGAGTGCTTAAAAGT SRR28623291 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 14:47:09 Started mapping on | Feb 11 14:47:10 Finished on | Feb 11 14:48:33 Mapping speed, Million of reads per hour | 574.83 Number of input reads | 13252950 Average input read length | 282 UNIQUE READS: Uniquely mapped reads number | 12451615 Uniquely mapped reads % | 93.95% Average mapped length | 280.44 Number of splices: Total | 9721103 Number of splices: Annotated (sjdb) | 9437470 Number of splices: GT/AG | 9523628 Number of splices: GC/AG | 140511 Number of splices: AT/AC | 8633 Number of splices: Non-canonical | 48331 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.04% Deletion average length | 2.69 Insertion rate per base | 0.03% Insertion average length | 2.32 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 394709 % of reads mapped to multiple loci | 2.98% Number of reads mapped to too many loci | 72473 % of reads mapped to too many loci | 0.55% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.31% % of reads unmapped: other | 0.21% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 406626 406626 406626 N_multimapping 394709 394709 394709 N_noFeature 562059 12216361 664954 N_ambiguous 211830 1018 78896 UnstrandedReadsAssigned:11677726 PositiveStrandReadsAssigned:234236 NegativeStrandReadsAssigned:11707765 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=128 echo kmer=123 SRR28623291 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR28623291-trimmed-pair1.fastq SRR28623291-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,252,950 reads, 11,867,478 reads pseudoaligned [quant] estimated average fragment length: 188.852 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,083 rounds 52401 SRR28623291.ke.tsv 34699 SRR28623291.se.tsv 87100 total ==> SRR28623291.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1830.15 2135 90.8065 Potri.005G024800.1.v4.1 1035 847.148 703 64.5953 Potri.004G059700.1.v4.1 961 773.168 92 9.26231 Potri.007G009000.2.v4.1 1416 1228.15 0 0 Potri.003G141000.2.v4.1 2943 2755.15 802 22.6587 Potri.016G087400.1.v4.1 270 111.46 1036.65 723.967 Potri.015G069301.1.v4.1 564 378.864 0 0 Potri.010G195200.1.v4.1 1773 1585.15 508 24.9459 Potri.012G127500.1.v4.1 977 789.158 62 6.11551 ==> SRR28623291.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 47 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 222 Potri.001G212900.v4.1 77 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 162 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 8 SRR28623291 completed mapping pipeline successfully