Starting /dee2/code/volunteer_pipeline.sh SRR28623292 current disk space = 3048749371392 free memory = 1579022148 SRR28623292 SRAfilesize 5ccb7424315bf9aab5cd6075e7752c18 SRR28623292.sra SRR28623292.sra file validated SRR28623292 is paired end SRR28623292 is conventional basespace SRR28623292 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623292_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.361 37.0 37.0 37.0 37.0 37.0 2 36.316 37.0 37.0 37.0 37.0 37.0 3 36.5745 37.0 37.0 37.0 37.0 37.0 4 36.621 37.0 37.0 37.0 37.0 37.0 5 36.6385 37.0 37.0 37.0 37.0 37.0 6 36.648 37.0 37.0 37.0 37.0 37.0 7 36.5465 37.0 37.0 37.0 37.0 37.0 8 36.399 37.0 37.0 37.0 37.0 37.0 9 36.5985 37.0 37.0 37.0 37.0 37.0 10-14 36.5586 37.0 37.0 37.0 37.0 37.0 15-19 36.5598 37.0 37.0 37.0 37.0 37.0 20-24 36.5252 37.0 37.0 37.0 37.0 37.0 25-29 36.5021 37.0 37.0 37.0 37.0 37.0 30-34 36.464299999999994 37.0 37.0 37.0 37.0 37.0 35-39 36.4376 37.0 37.0 37.0 37.0 37.0 40-44 36.405499999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.339000000000006 37.0 37.0 37.0 37.0 37.0 50-54 36.275999999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.2628 37.0 37.0 37.0 37.0 37.0 60-64 36.2882 37.0 37.0 37.0 37.0 37.0 65-69 36.2606 37.0 37.0 37.0 37.0 37.0 70-74 36.14880000000001 37.0 37.0 37.0 37.0 37.0 75-79 36.11120000000001 37.0 37.0 37.0 37.0 37.0 80-84 36.0249 37.0 37.0 37.0 37.0 37.0 85-89 36.112899999999996 37.0 37.0 37.0 37.0 37.0 90-94 36.040200000000006 37.0 37.0 37.0 37.0 37.0 95-99 35.896300000000004 37.0 37.0 37.0 37.0 37.0 100-104 35.957300000000004 37.0 37.0 37.0 37.0 37.0 105-109 35.9159 37.0 37.0 37.0 37.0 37.0 110-114 35.8623 37.0 37.0 37.0 37.0 37.0 115-119 35.9179 37.0 37.0 37.0 37.0 37.0 120-124 35.7205 37.0 37.0 37.0 37.0 37.0 125-129 35.6512 37.0 37.0 37.0 37.0 37.0 130-134 35.751000000000005 37.0 37.0 37.0 37.0 37.0 135-139 35.6311 37.0 37.0 37.0 37.0 37.0 140-144 35.3722 37.0 37.0 37.0 34.6 37.0 145-149 35.3488 37.0 37.0 37.0 34.6 37.0 150-151 35.079499999999996 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 1.0 21 0.0 22 2.0 23 4.0 24 4.0 25 2.0 26 4.0 27 10.0 28 11.0 29 19.0 30 34.0 31 35.0 32 51.0 33 88.0 34 156.0 35 451.0 36 2899.0 37 228.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.45258404415454 13.848469643753136 8.855995985950829 40.8429503261415 2 18.95 13.900000000000002 37.5 29.65 3 17.4 18.5 29.45 34.65 4 22.400000000000002 25.95 24.9 26.75 5 24.0 33.175 24.85 17.974999999999998 6 21.125 35.699999999999996 22.075 21.099999999999998 7 15.325 28.775000000000002 40.35 15.55 8 18.5 26.1 32.15 23.25 9 18.95 24.425 33.275 23.35 10-14 19.015 30.330000000000002 27.455000000000002 23.200000000000003 15-19 19.12 29.354999999999997 28.075 23.45 20-24 19.245 29.160000000000004 27.97 23.625 25-29 19.49 28.845 28.244999999999997 23.419999999999998 30-34 19.095000000000002 29.134999999999998 27.465 24.305 35-39 19.935 28.875 27.97 23.22 40-44 18.89 29.185 28.27 23.655 45-49 19.405 29.154999999999998 27.66 23.78 50-54 19.48 29.195 27.825 23.5 55-59 19.785 29.665000000000003 26.91 23.64 60-64 20.105 28.975 27.779999999999998 23.14 65-69 19.17 28.849999999999998 28.13 23.849999999999998 70-74 19.975 28.410000000000004 28.16 23.455000000000002 75-79 19.830000000000002 29.5 27.284999999999997 23.385 80-84 19.835 28.525 28.09 23.549999999999997 85-89 19.675 29.04 27.544999999999998 23.74 90-94 20.29 29.049999999999997 27.694999999999997 22.965 95-99 20.74 28.915000000000003 27.405 22.939999999999998 100-104 20.68 28.845 27.26 23.215 105-109 20.435 28.88 27.045 23.64 110-114 20.3 28.76 27.705000000000002 23.235 115-119 20.62 28.845 27.255000000000003 23.28 120-124 20.349999999999998 28.9 27.22 23.53 125-129 19.885 29.005 27.089999999999996 24.02 130-134 20.28 29.115000000000002 27.405 23.200000000000003 135-139 20.885 28.82 27.089999999999996 23.205000000000002 140-144 21.105 28.775000000000002 26.36 23.76 145-149 20.7 29.025000000000002 26.72 23.555 150-151 21.1625 28.1 26.700000000000003 24.0375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 1.5 23 1.0 24 2.0 25 4.0 26 3.5 27 6.0 28 11.5 29 16.5 30 22.5 31 33.0 32 39.5 33 57.0 34 77.0 35 81.5 36 108.0 37 145.0 38 147.5 39 169.0 40 198.0 41 226.5 42 252.5 43 242.0 44 260.5 45 270.0 46 251.0 47 234.0 48 211.0 49 191.0 50 159.0 51 129.5 52 118.0 53 95.5 54 65.0 55 46.0 56 31.0 57 20.0 58 14.5 59 9.0 60 6.5 61 8.0 62 9.0 63 5.0 64 3.0 65 2.5 66 1.5 67 4.0 68 4.5 69 1.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.35000000000000003 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.225 #Duplication Level Percentage of deduplicated Percentage of total 1 85.39161044294514 72.775 2 12.408330888823702 21.15 3 1.818715165737753 4.65 4 0.26400704018773835 0.8999999999999999 5 0.0880023467292461 0.375 6 0.02933411557641537 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATCAGCTGGTGCTTCTGCTTCCCAGAAGGTAGTCTTCTTCCCTGTCTTAG 6 0.15 No Hit GGCTGAATAAAAATATGCAATCCTTTTTGAAGAAATATAGTTATATTCAT 5 0.125 No Hit GGCCTGGAACAGATGAGAATATTTGCTGTCTGAAGACCGACAAAGGATGG 5 0.125 No Hit CAGTAACTGAAAGACCGTAAATGTGATTGTATGTATGGGTAATTTCCTCA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.23750000000000002 0.0 0.0 0.0 0.0 86-87 0.4375 0.0 0.0 0.0 0.0 88-89 0.6 0.0 0.0 0.0 0.0 90-91 0.7375 0.0 0.0 0.0 0.0 92-93 0.8125 0.0 0.0 0.0 0.0 94-95 0.9375 0.0 0.0 0.0 0.0 96-97 1.1375 0.0 0.0 0.0 0.0 98-99 1.375 0.0 0.0 0.0 0.0 100-101 1.65 0.0 0.0 0.0 0.0 102-103 1.9125 0.0 0.0 0.0 0.0 104-105 2.2 0.0 0.0 0.0 0.0 106-107 2.5 0.0 0.0 0.0 0.0 108-109 2.8625 0.0 0.0 0.0 0.0 110-111 3.175 0.0 0.0 0.0 0.0 112-113 3.575 0.0 0.0 0.0 0.0 114-115 3.8125 0.0 0.0 0.0 0.0 116-117 4.3 0.0 0.0 0.0 0.0 118-119 4.8625 0.0 0.0 0.0 0.0 120-121 5.550000000000001 0.0 0.0 0.0 0.0 122-123 6.0 0.0 0.0 0.0 0.0 124-125 6.4125 0.0 0.0 0.0 0.0 126-127 6.85 0.0 0.0 0.0 0.0 128-129 7.2625 0.0 0.0 0.0 0.0 130-131 8.05 0.0 0.0 0.0 0.0 132-133 8.7875 0.0 0.0 0.0 0.0 134-135 9.4875 0.0 0.0 0.0 0.0 136-137 10.0375 0.0 0.0 0.0 0.0 138-139 10.775 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTGATT 10 0.006830828 145.0 1 GATTTAT 10 0.006830828 145.0 4 TTTATTA 10 0.006830828 145.0 6 CAAATAA 10 0.006830828 145.0 3 >>END_MODULE SRR28623292 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623292_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.836 37.0 37.0 37.0 37.0 37.0 2 36.194 37.0 37.0 37.0 37.0 37.0 3 36.094 37.0 37.0 37.0 37.0 37.0 4 36.1365 37.0 37.0 37.0 37.0 37.0 5 36.146 37.0 37.0 37.0 37.0 37.0 6 36.169 37.0 37.0 37.0 37.0 37.0 7 36.2995 37.0 37.0 37.0 37.0 37.0 8 36.1385 37.0 37.0 37.0 37.0 37.0 9 36.1005 37.0 37.0 37.0 37.0 37.0 10-14 36.071600000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.0633 37.0 37.0 37.0 37.0 37.0 20-24 36.10549999999999 37.0 37.0 37.0 37.0 37.0 25-29 36.0202 37.0 37.0 37.0 37.0 37.0 30-34 35.8862 37.0 37.0 37.0 37.0 37.0 35-39 35.8908 37.0 37.0 37.0 37.0 37.0 40-44 35.869600000000005 37.0 37.0 37.0 37.0 37.0 45-49 35.874199999999995 37.0 37.0 37.0 37.0 37.0 50-54 35.85699999999999 37.0 37.0 37.0 37.0 37.0 55-59 35.68149999999999 37.0 37.0 37.0 37.0 37.0 60-64 35.6838 37.0 37.0 37.0 37.0 37.0 65-69 35.7405 37.0 37.0 37.0 37.0 37.0 70-74 35.732299999999995 37.0 37.0 37.0 37.0 37.0 75-79 35.6937 37.0 37.0 37.0 37.0 37.0 80-84 35.5475 37.0 37.0 37.0 37.0 37.0 85-89 35.5909 37.0 37.0 37.0 37.0 37.0 90-94 35.4867 37.0 37.0 37.0 37.0 37.0 95-99 35.5632 37.0 37.0 37.0 37.0 37.0 100-104 35.442899999999995 37.0 37.0 37.0 34.6 37.0 105-109 35.4297 37.0 37.0 37.0 37.0 37.0 110-114 35.376400000000004 37.0 37.0 37.0 37.0 37.0 115-119 35.3426 37.0 37.0 37.0 34.6 37.0 120-124 35.36560000000001 37.0 37.0 37.0 37.0 37.0 125-129 34.876400000000004 37.0 37.0 37.0 27.4 37.0 130-134 35.2909 37.0 37.0 37.0 34.6 37.0 135-139 35.0461 37.0 37.0 37.0 25.0 37.0 140-144 35.0714 37.0 37.0 37.0 25.0 37.0 145-149 34.958800000000004 37.0 37.0 37.0 25.0 37.0 150-151 34.62575 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 5.0 14 7.0 15 2.0 16 3.0 17 6.0 18 0.0 19 1.0 20 5.0 21 5.0 22 11.0 23 6.0 24 9.0 25 9.0 26 14.0 27 13.0 28 13.0 29 21.0 30 26.0 31 46.0 32 78.0 33 121.0 34 255.0 35 675.0 36 2425.0 37 242.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.125 21.0 11.575000000000001 26.3 2 27.675 24.349999999999998 31.374999999999996 16.6 3 22.1 26.924999999999997 31.85 19.125 4 25.650000000000002 33.5 22.475 18.375 5 26.3 34.475 23.7 15.525 6 20.375 37.9 24.275 17.45 7 21.95 21.475 37.425000000000004 19.15 8 20.349999999999998 26.450000000000003 28.725 24.474999999999998 9 23.125 24.375 29.725 22.775000000000002 10-14 23.544999999999998 29.99 26.384999999999998 20.080000000000002 15-19 23.535 28.24 27.875 20.349999999999998 20-24 23.825 28.544999999999998 28.165000000000003 19.465 25-29 23.82 28.470000000000002 27.62 20.09 30-34 23.26 28.565 27.694999999999997 20.48 35-39 23.474999999999998 28.155 27.839999999999996 20.53 40-44 23.26 27.735 29.505 19.5 45-49 23.150000000000002 28.205000000000002 28.51 20.135 50-54 23.585 28.33 28.51 19.575 55-59 23.095 28.244999999999997 28.77 19.89 60-64 23.31 28.435 28.425 19.830000000000002 65-69 23.585 28.235 28.065 20.115 70-74 23.27 28.560000000000002 28.000000000000004 20.169999999999998 75-79 23.630000000000003 27.825 28.505000000000003 20.04 80-84 23.195 27.894999999999996 28.715000000000003 20.195 85-89 23.169999999999998 27.779999999999998 28.7 20.349999999999998 90-94 23.549999999999997 28.23 28.225 19.994999999999997 95-99 23.96 27.525 28.365000000000002 20.150000000000002 100-104 23.41 28.199999999999996 28.515 19.875 105-109 23.69 28.189999999999998 28.34 19.78 110-114 24.29 28.42 27.97 19.32 115-119 24.895 28.744999999999997 27.189999999999998 19.17 120-124 24.67 28.360000000000003 27.415 19.555 125-129 25.124999999999996 28.395 27.97 18.509999999999998 130-134 25.11 28.255000000000003 28.02 18.615000000000002 135-139 24.975 28.194999999999997 27.82 19.009999999999998 140-144 25.69 28.685 26.71 18.915000000000003 145-149 25.874999999999996 28.235 27.255000000000003 18.634999999999998 150-151 25.724999999999998 28.1375 27.1125 19.025 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 1.0 5 1.5 6 0.5 7 0.0 8 0.0 9 0.5 10 1.5 11 1.5 12 0.5 13 0.5 14 1.0 15 0.5 16 1.0 17 1.5 18 1.0 19 1.0 20 1.5 21 1.5 22 3.5 23 3.5 24 3.5 25 5.5 26 5.0 27 4.0 28 8.0 29 17.5 30 23.5 31 33.5 32 37.5 33 40.5 34 53.0 35 62.0 36 85.5 37 116.5 38 144.0 39 187.0 40 212.0 41 240.5 42 270.0 43 257.0 44 265.5 45 267.5 46 259.0 47 246.5 48 215.0 49 195.0 50 158.0 51 119.5 52 104.5 53 90.5 54 66.5 55 43.5 56 29.5 57 22.5 58 18.0 59 15.5 60 9.5 61 5.5 62 4.0 63 2.5 64 2.0 65 1.0 66 1.5 67 1.5 68 1.0 69 1.0 70 1.0 71 1.0 72 1.0 73 0.5 74 0.5 75 1.0 76 1.0 77 1.0 78 1.0 79 0.5 80 0.0 81 0.0 82 0.5 83 1.5 84 1.0 85 0.5 86 0.5 87 0.5 88 1.5 89 1.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.5 95 1.0 96 1.5 97 1.0 98 0.0 99 0.0 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.575 #Duplication Level Percentage of deduplicated Percentage of total 1 85.71428571428571 73.35000000000001 2 12.299152789950336 21.05 3 1.5483494011101373 3.975 4 0.32135553607946243 1.0999999999999999 5 0.0876424189307625 0.375 6 0.029214139643587496 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGTTTTGGGAAAAATGGAAGGTGTGGAATCATATGACATTGATTTGAAG 6 0.15 No Hit GGAGAATCCACACTCTTATGTCCATTCGAATATAGCAGGCTTGGTTACTC 5 0.125 No Hit ATGTTATCTTCTTCAGGCTTGGATGCTGTGGTGTATATGCGAATGATAAC 5 0.125 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.23750000000000002 0.0 0.0 0.0 0.0 86-87 0.4375 0.0 0.0 0.0 0.0 88-89 0.6 0.0 0.0 0.0 0.0 90-91 0.7375 0.0 0.0 0.0 0.0 92-93 0.8625 0.0 0.0 0.0 0.0 94-95 0.9874999999999999 0.0 0.0 0.0 0.0 96-97 1.1875 0.0 0.0 0.0 0.0 98-99 1.425 0.0 0.0 0.0 0.0 100-101 1.7 0.0 0.0 0.0 0.0 102-103 1.975 0.0 0.0 0.0 0.0 104-105 2.275 0.0 0.0 0.0 0.0 106-107 2.5875000000000004 0.0 0.0 0.0 0.0 108-109 2.9625 0.0 0.0 0.0 0.0 110-111 3.25 0.0 0.0 0.0 0.0 112-113 3.675 0.0 0.0 0.0 0.0 114-115 3.9125 0.0 0.0 0.0 0.0 116-117 4.362500000000001 0.0 0.0 0.0 0.0 118-119 4.8875 0.0 0.0 0.0 0.0 120-121 5.574999999999999 0.0 0.0 0.0 0.0 122-123 6.075 0.0 0.0 0.0 0.0 124-125 6.4875 0.0 0.0 0.0 0.0 126-127 6.925 0.0 0.0 0.0 0.0 128-129 7.35 0.0 0.0 0.0 0.0 130-131 8.149999999999999 0.0 0.0 0.0 0.0 132-133 8.899999999999999 0.0 0.0 0.0 0.0 134-135 9.6375 0.0 0.0 0.0 0.0 136-137 10.2 0.0 0.0 0.0 0.0 138-139 10.95 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCCCAGA 10 0.006830828 145.0 9 AGCTCCC 10 0.006830828 145.0 6 ATCCAAG 10 0.006830828 145.0 1 CTCCCAG 10 0.006830828 145.0 8 TACGGTC 10 0.006830828 145.0 3 ATAAATC 10 0.006830828 145.0 145 TCCAAGC 10 0.006830828 145.0 2 GCTCCCA 10 0.006830828 145.0 7 >>END_MODULE Read 1621394 spots for SRR28623292.sra Written 1621394 spots for SRR28623292.sra Read 1621394 spots for SRR28623292.sra Written 1621394 spots for SRR28623292.sra Read 1621394 spots for SRR28623292.sra Written 1621394 spots for SRR28623292.sra Read 1621394 spots for SRR28623292.sra Written 1621394 spots for SRR28623292.sra Read 1621394 spots for SRR28623292.sra Written 1621394 spots for SRR28623292.sra Read 1621394 spots for SRR28623292.sra Written 1621394 spots for SRR28623292.sra Read 1621394 spots for SRR28623292.sra Written 1621394 spots for SRR28623292.sra Read 1621394 spots for SRR28623292.sra Written 1621394 spots for SRR28623292.sra Read 1621394 spots for SRR28623292.sra Written 1621394 spots for SRR28623292.sra Read 1621394 spots for SRR28623292.sra Written 1621394 spots for SRR28623292.sra Read 1621394 spots for SRR28623292.sra Written 1621394 spots for SRR28623292.sra Read 1621394 spots for SRR28623292.sra Written 1621394 spots for SRR28623292.sra Read 1621394 spots for SRR28623292.sra Written 1621394 spots for SRR28623292.sra Read 1621394 spots for SRR28623292.sra Written 1621394 spots for SRR28623292.sra Read 1621394 spots for SRR28623292.sra Written 1621394 spots for SRR28623292.sra Read 1621407 spots for SRR28623292.sra Written 1621407 spots for SRR28623292.sra Read 1621394 spots for SRR28623292.sra Written 1621394 spots for SRR28623292.sra Read 1621394 spots for SRR28623292.sra Written 1621394 spots for SRR28623292.sra Read 1621394 spots for SRR28623292.sra Written 1621394 spots for SRR28623292.sra Read 1621394 spots for SRR28623292.sra Written 1621394 spots for SRR28623292.sra SRR ids: ['SRR28623292.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_k4rfj9d0 SRR28623292.sra spots: 32427893 blocks: [[1, 1621394], [1621395, 3242788], [3242789, 4864182], [4864183, 6485576], [6485577, 8106970], [8106971, 9728364], [9728365, 11349758], [11349759, 12971152], [12971153, 14592546], [14592547, 16213940], [16213941, 17835334], [17835335, 19456728], [19456729, 21078122], [21078123, 22699516], [22699517, 24320910], [24320911, 25942304], [25942305, 27563698], [27563699, 29185092], [29185093, 30806486], [30806487, 32427893]] SRR28623292 file size 11974330 SRR28623292 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR28623292 SRR28623292_1.fastq SRR28623292_2.fastq Input file: SRR28623292_1.fastq Paired file: SRR28623292_2.fastq trimmed: SRR28623292-trimmed-pair1.fastq, SRR28623292-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 16:36:36 2025 >> started Tue Feb 11 16:37:16 2025 >> done (40.008s) 32427893 read pairs processed; of these: 24 ( 0.00%) short read pairs filtered out after trimming by size control 22845 ( 0.07%) empty read pairs filtered out after trimming by size control 32405024 (99.93%) read pairs available; of these: 4855910 (14.99%) trimmed read pairs available after processing 27549114 (85.01%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 1 0.00% 20 6 0.00% 21 3 0.00% 22 10 0.00% 23 4 0.00% 24 6 0.00% 25 9 0.00% 26 7 0.00% 27 11 0.00% 28 10 0.00% 29 9 0.00% 30 15 0.00% 31 17 0.00% 32 24 0.00% 33 22 0.00% 34 21 0.00% 35 20 0.00% 36 28 0.00% 37 39 0.00% 38 30 0.00% 39 52 0.00% 40 46 0.00% 41 61 0.00% 42 58 0.00% 43 68 0.00% 44 86 0.00% 45 86 0.00% 46 99 0.00% 47 116 0.00% 48 150 0.00% 49 160 0.00% 50 196 0.00% 51 194 0.00% 52 238 0.00% 53 285 0.00% 54 280 0.00% 55 331 0.00% 56 391 0.00% 57 444 0.00% 58 483 0.00% 59 554 0.00% 60 682 0.00% 61 792 0.00% 62 906 0.00% 63 969 0.00% 64 1179 0.00% 65 1314 0.00% 66 1544 0.00% 67 1641 0.01% 68 1978 0.01% 69 2209 0.01% 70 2497 0.01% 71 2905 0.01% 72 3289 0.01% 73 3870 0.01% 74 4237 0.01% 75 4971 0.02% 76 5417 0.02% 77 6086 0.02% 78 6774 0.02% 79 7750 0.02% 80 8514 0.03% 81 9419 0.03% 82 10778 0.03% 83 11828 0.04% 84 13247 0.04% 85 14767 0.05% 86 15821 0.05% 87 17051 0.05% 88 18693 0.06% 89 19858 0.06% 90 21393 0.07% 91 23169 0.07% 92 24684 0.08% 93 27491 0.08% 94 28669 0.09% 95 30763 0.09% 96 32542 0.10% 97 34842 0.11% 98 36184 0.11% 99 37630 0.12% 100 39756 0.12% 101 41186 0.13% 102 43523 0.13% 103 45580 0.14% 104 47437 0.15% 105 50188 0.15% 106 52783 0.16% 107 54284 0.17% 108 56019 0.17% 109 57982 0.18% 110 59202 0.18% 111 60545 0.19% 112 63591 0.20% 113 64277 0.20% 114 67149 0.21% 115 70215 0.22% 116 71796 0.22% 117 73450 0.23% 118 76460 0.24% 119 77453 0.24% 120 79059 0.24% 121 80866 0.25% 122 81888 0.25% 123 82969 0.26% 124 85993 0.27% 125 87300 0.27% 126 89067 0.27% 127 91516 0.28% 128 93636 0.29% 129 95522 0.29% 130 96908 0.30% 131 97496 0.30% 132 98993 0.31% 133 100650 0.31% 134 102024 0.31% 135 103639 0.32% 136 104996 0.32% 137 106779 0.33% 138 109117 0.34% 139 110050 0.34% 140 110771 0.34% 141 112910 0.35% 142 113927 0.35% 143 113921 0.35% 144 115438 0.36% 145 116554 0.36% 146 116850 0.36% 147 117831 0.36% 148 120027 0.37% 149 120691 0.37% 150 122620 0.38% 151 27549114 85.01% 32405024 reads passed initial QC criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=8.58 fanout-score-rank=22 prefix-density=0.31 prefix-fanout=2.9 sequence=TCCTTCTGGATGTTGTA criterion=fanout-score sequence-density=0.06 sequence-density-rank=21 fanout-score=570.32 fanout-score-rank=1 prefix-density=0.96 prefix-fanout=36.0 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=2.38 fanout-score-rank=33 prefix-density=0.13 prefix-fanout=2.2 sequence=CCAGACCAGCAGAGGTTGAT criterion=fanout-score sequence-density=0.09 sequence-density-rank=8 fanout-score=359.16 fanout-score-rank=1 prefix-density=0.99 prefix-fanout=34.1 sequence=AAGAAGAAGAAA SRR28623292 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 16:38:00 Started mapping on | Feb 11 16:38:00 Finished on | Feb 11 16:41:41 Mapping speed, Million of reads per hour | 527.86 Number of input reads | 32405024 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 30210795 Uniquely mapped reads % | 93.23% Average mapped length | 292.56 Number of splices: Total | 26530294 Number of splices: Annotated (sjdb) | 25855288 Number of splices: GT/AG | 26057135 Number of splices: GC/AG | 361343 Number of splices: AT/AC | 26239 Number of splices: Non-canonical | 85577 Mismatch rate per base, % | 0.44% Deletion rate per base | 0.03% Deletion average length | 2.98 Insertion rate per base | 0.03% Insertion average length | 2.39 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 872461 % of reads mapped to multiple loci | 2.69% Number of reads mapped to too many loci | 139331 % of reads mapped to too many loci | 0.43% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.45% % of reads unmapped: other | 0.20% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1321768 1321768 1321768 N_multimapping 872461 872461 872461 N_noFeature 1302269 29838740 1483178 N_ambiguous 388252 3028 195015 UnstrandedReadsAssigned:28520274 PositiveStrandReadsAssigned:369027 NegativeStrandReadsAssigned:28532602 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR28623292 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR28623292-trimmed-pair1.fastq SRR28623292-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 32,405,024 reads, 28,905,931 reads pseudoaligned [quant] estimated average fragment length: 230.179 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,172 rounds 52401 SRR28623292.ke.tsv 34699 SRR28623292.se.tsv 87100 total ==> SRR28623292.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1788.82 4266 85.6835 Potri.005G024800.1.v4.1 1035 805.821 5680 253.252 Potri.004G059700.1.v4.1 961 731.828 127 6.23502 Potri.007G009000.2.v4.1 1416 1186.82 0 0 Potri.003G141000.2.v4.1 2943 2713.82 1182.48 15.6551 Potri.016G087400.1.v4.1 270 92.2695 2605.14 1014.42 Potri.015G069301.1.v4.1 564 340.021 0 0 Potri.010G195200.1.v4.1 1773 1543.82 208 4.84072 Potri.012G127500.1.v4.1 977 747.821 4535 217.883 ==> SRR28623292.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1519 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 503 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 5 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 63 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR28623292 completed mapping pipeline successfully