Starting /dee2/code/volunteer_pipeline.sh SRR28623293 current disk space = 3049807892480 free memory = 1473584208 SRR28623293 SRAfilesize a9cc44b39081e60a652a03f91a257591 SRR28623293.sra SRR28623293.sra file validated SRR28623293 is paired end SRR28623293 is conventional basespace SRR28623293 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623293_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.445 37.0 37.0 37.0 37.0 37.0 2 36.443 37.0 37.0 37.0 37.0 37.0 3 36.594 37.0 37.0 37.0 37.0 37.0 4 36.6345 37.0 37.0 37.0 37.0 37.0 5 36.6145 37.0 37.0 37.0 37.0 37.0 6 36.649 37.0 37.0 37.0 37.0 37.0 7 36.607 37.0 37.0 37.0 37.0 37.0 8 36.557 37.0 37.0 37.0 37.0 37.0 9 36.6165 37.0 37.0 37.0 37.0 37.0 10-14 36.5481 37.0 37.0 37.0 37.0 37.0 15-19 36.5609 37.0 37.0 37.0 37.0 37.0 20-24 36.5444 37.0 37.0 37.0 37.0 37.0 25-29 36.4285 37.0 37.0 37.0 37.0 37.0 30-34 36.442600000000006 37.0 37.0 37.0 37.0 37.0 35-39 36.3664 37.0 37.0 37.0 37.0 37.0 40-44 36.3593 37.0 37.0 37.0 37.0 37.0 45-49 36.2862 37.0 37.0 37.0 37.0 37.0 50-54 36.2347 37.0 37.0 37.0 37.0 37.0 55-59 36.22430000000001 37.0 37.0 37.0 37.0 37.0 60-64 36.224599999999995 37.0 37.0 37.0 37.0 37.0 65-69 36.1669 37.0 37.0 37.0 37.0 37.0 70-74 36.1029 37.0 37.0 37.0 37.0 37.0 75-79 36.1237 37.0 37.0 37.0 37.0 37.0 80-84 36.0447 37.0 37.0 37.0 37.0 37.0 85-89 36.057500000000005 37.0 37.0 37.0 37.0 37.0 90-94 35.9981 37.0 37.0 37.0 37.0 37.0 95-99 35.8687 37.0 37.0 37.0 37.0 37.0 100-104 35.954499999999996 37.0 37.0 37.0 37.0 37.0 105-109 35.8842 37.0 37.0 37.0 37.0 37.0 110-114 35.7815 37.0 37.0 37.0 37.0 37.0 115-119 35.7802 37.0 37.0 37.0 37.0 37.0 120-124 35.7136 37.0 37.0 37.0 37.0 37.0 125-129 35.5524 37.0 37.0 37.0 37.0 37.0 130-134 35.6846 37.0 37.0 37.0 37.0 37.0 135-139 35.4759 37.0 37.0 37.0 37.0 37.0 140-144 35.244299999999996 37.0 37.0 37.0 32.2 37.0 145-149 35.1444 37.0 37.0 37.0 29.8 37.0 150-151 34.92875 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 2.0 21 2.0 22 1.0 23 4.0 24 4.0 25 4.0 26 4.0 27 17.0 28 17.0 29 23.0 30 29.0 31 46.0 32 59.0 33 89.0 34 176.0 35 414.0 36 2839.0 37 269.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.53761283851554 14.493480441323973 10.180541624874625 37.78836509528586 2 19.175 15.825 34.575 30.425 3 16.025 20.7 28.925 34.35 4 21.375 28.15 24.025 26.450000000000003 5 23.0 32.800000000000004 25.025 19.175 6 20.974999999999998 35.3 24.099999999999998 19.625 7 14.725 30.825000000000003 37.925 16.525000000000002 8 16.225 31.175000000000004 30.5 22.1 9 16.325 24.975 36.775000000000006 21.925 10-14 18.495 32.925 27.474999999999998 21.105 15-19 18.925 30.735 27.36 22.98 20-24 18.995 30.42 26.93 23.655 25-29 19.105 30.45 27.29 23.155 30-34 19.064999999999998 31.04 26.515 23.380000000000003 35-39 19.31 30.48 27.405 22.805 40-44 19.13 30.404999999999998 27.015 23.45 45-49 19.255 30.285 27.450000000000003 23.01 50-54 19.37 29.37 27.1 24.16 55-59 19.46 29.93 27.450000000000003 23.16 60-64 19.48 30.12 27.334999999999997 23.064999999999998 65-69 19.580000000000002 30.34 26.715 23.365 70-74 19.869999999999997 29.625 26.965 23.54 75-79 19.85 29.849999999999998 27.07 23.23 80-84 19.685 29.04 27.744999999999997 23.53 85-89 20.49 29.520000000000003 26.88 23.11 90-94 19.96 29.785 26.979999999999997 23.275000000000002 95-99 20.02 30.305 26.115 23.56 100-104 19.994999999999997 30.56 26.13 23.315 105-109 20.28 30.42 25.740000000000002 23.56 110-114 20.080000000000002 30.115 26.665 23.14 115-119 20.455000000000002 29.595 26.55 23.400000000000002 120-124 20.34 30.049999999999997 26.02 23.59 125-129 20.849999999999998 29.13 26.215 23.805 130-134 21.675 28.925 25.814999999999998 23.585 135-139 21.955 28.935 25.629999999999995 23.48 140-144 21.01 28.395 26.055 24.54 145-149 21.64 27.775 26.57 24.015 150-151 22.8375 28.1375 26.1625 22.8625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.5 14 0.5 15 0.5 16 0.5 17 1.0 18 1.0 19 2.0 20 3.5 21 3.0 22 3.5 23 5.0 24 8.5 25 10.0 26 15.0 27 19.0 28 18.5 29 20.5 30 28.0 31 50.0 32 66.5 33 76.0 34 86.5 35 91.5 36 116.0 37 141.5 38 154.0 39 179.0 40 188.5 41 204.5 42 229.0 43 243.0 44 243.5 45 227.0 46 230.5 47 224.0 48 208.0 49 177.5 50 130.0 51 109.5 52 93.5 53 87.0 54 74.0 55 55.5 56 43.0 57 30.0 58 24.0 59 14.0 60 8.0 61 7.0 62 7.0 63 3.5 64 3.0 65 4.5 66 7.0 67 6.0 68 4.0 69 5.0 70 3.5 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.3 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.575 #Duplication Level Percentage of deduplicated Percentage of total 1 85.01330180313332 71.89999999999999 2 12.44457582027786 21.05 3 2.0987289388117056 5.325 4 0.3842743127401715 1.3 5 0.02955956251847473 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02955956251847473 0.3 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGGCATGTATCTCGTAT 12 0.3 TruSeq Adapter, Index 4 (97% over 37bp) CCTTCTTCTACCATGTAACTTACCCTTCTGGTCATGGAGGTCTCAATGGT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0125 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.0875 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.2 0.0 0.0 0.0 0.0 72-73 0.2625 0.0 0.0 0.0 0.0 74-75 0.3375 0.0 0.0 0.0 0.0 76-77 0.4125 0.0 0.0 0.0 0.0 78-79 0.525 0.0 0.0 0.0 0.0 80-81 0.6625 0.0 0.0 0.0 0.0 82-83 0.875 0.0 0.0 0.0 0.0 84-85 1.0875 0.0 0.0 0.0 0.0 86-87 1.25 0.0 0.0 0.0 0.0 88-89 1.4375 0.0 0.0 0.0 0.0 90-91 1.7625000000000002 0.0 0.0 0.0 0.0 92-93 2.15 0.0 0.0 0.0 0.0 94-95 2.5875 0.0 0.0 0.0 0.0 96-97 2.975 0.0 0.0 0.0 0.0 98-99 3.4 0.0 0.0 0.0 0.0 100-101 3.7625 0.0 0.0 0.0 0.0 102-103 4.45 0.0 0.0 0.0 0.0 104-105 5.0 0.0 0.0 0.0 0.0 106-107 5.574999999999999 0.0 0.0 0.0 0.0 108-109 6.0375 0.0 0.0 0.0 0.0 110-111 6.475 0.0 0.0 0.0 0.0 112-113 7.2 0.0 0.0 0.0 0.0 114-115 8.0625 0.0 0.0 0.0 0.0 116-117 8.8875 0.0 0.0 0.0 0.0 118-119 9.475 0.0 0.0 0.0 0.0 120-121 10.1625 0.0 0.0 0.0 0.0 122-123 11.125 0.0 0.0 0.0 0.0 124-125 11.95 0.0 0.0 0.0 0.0 126-127 12.8125 0.0 0.0 0.0 0.0 128-129 13.537500000000001 0.0 0.0 0.0 0.0 130-131 14.7 0.0 0.0 0.0 0.0 132-133 15.8375 0.0 0.0 0.0 0.0 134-135 16.675 0.0 0.0 0.0 0.0 136-137 17.4375 0.0 0.0 0.0 0.0 138-139 18.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAATACA 10 0.006830828 145.0 6 >>END_MODULE SRR28623293 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623293_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.785 37.0 37.0 37.0 37.0 37.0 2 36.273 37.0 37.0 37.0 37.0 37.0 3 36.212 37.0 37.0 37.0 37.0 37.0 4 36.3315 37.0 37.0 37.0 37.0 37.0 5 36.4865 37.0 37.0 37.0 37.0 37.0 6 36.2555 37.0 37.0 37.0 37.0 37.0 7 36.3865 37.0 37.0 37.0 37.0 37.0 8 36.145 37.0 37.0 37.0 37.0 37.0 9 36.293 37.0 37.0 37.0 37.0 37.0 10-14 36.126400000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.121 37.0 37.0 37.0 37.0 37.0 20-24 36.1316 37.0 37.0 37.0 37.0 37.0 25-29 36.0201 37.0 37.0 37.0 37.0 37.0 30-34 35.939 37.0 37.0 37.0 37.0 37.0 35-39 35.94359999999999 37.0 37.0 37.0 37.0 37.0 40-44 35.90560000000001 37.0 37.0 37.0 37.0 37.0 45-49 35.819900000000004 37.0 37.0 37.0 37.0 37.0 50-54 35.9097 37.0 37.0 37.0 37.0 37.0 55-59 35.721199999999996 37.0 37.0 37.0 37.0 37.0 60-64 35.7199 37.0 37.0 37.0 37.0 37.0 65-69 35.743399999999994 37.0 37.0 37.0 37.0 37.0 70-74 35.71079999999999 37.0 37.0 37.0 37.0 37.0 75-79 35.756299999999996 37.0 37.0 37.0 37.0 37.0 80-84 35.58970000000001 37.0 37.0 37.0 37.0 37.0 85-89 35.608399999999996 37.0 37.0 37.0 37.0 37.0 90-94 35.553700000000006 37.0 37.0 37.0 37.0 37.0 95-99 35.6042 37.0 37.0 37.0 37.0 37.0 100-104 35.4836 37.0 37.0 37.0 37.0 37.0 105-109 35.4097 37.0 37.0 37.0 34.6 37.0 110-114 35.48800000000001 37.0 37.0 37.0 37.0 37.0 115-119 35.4216 37.0 37.0 37.0 37.0 37.0 120-124 35.4308 37.0 37.0 37.0 34.6 37.0 125-129 34.965199999999996 37.0 37.0 37.0 29.8 37.0 130-134 35.2414 37.0 37.0 37.0 32.2 37.0 135-139 35.1087 37.0 37.0 37.0 27.4 37.0 140-144 35.040000000000006 37.0 37.0 37.0 25.0 37.0 145-149 34.8641 37.0 37.0 37.0 25.0 37.0 150-151 34.6325 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 4.0 14 10.0 15 9.0 16 5.0 17 5.0 18 2.0 19 1.0 20 1.0 21 5.0 22 6.0 23 6.0 24 11.0 25 12.0 26 6.0 27 13.0 28 13.0 29 17.0 30 22.0 31 43.0 32 70.0 33 124.0 34 223.0 35 680.0 36 2447.0 37 265.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.625 21.525 12.2 23.65 2 28.475 25.4 28.9 17.224999999999998 3 22.400000000000002 26.424999999999997 33.074999999999996 18.099999999999998 4 26.224999999999998 31.05 25.074999999999996 17.65 5 27.6 34.875 22.25 15.275 6 22.725 36.475 23.400000000000002 17.4 7 21.525 21.75 38.775 17.95 8 23.849999999999998 24.325 27.900000000000002 23.925 9 23.549999999999997 24.575 29.099999999999998 22.775000000000002 10-14 24.485 28.48 26.945000000000004 20.09 15-19 24.92 26.955000000000002 28.07 20.055 20-24 24.435000000000002 27.87 27.71 19.985 25-29 24.57 27.93 27.615000000000002 19.885 30-34 23.895 27.625 28.325 20.155 35-39 24.305 27.439999999999998 27.805000000000003 20.45 40-44 24.575 27.175 28.634999999999998 19.615 45-49 23.875 27.175 28.194999999999997 20.755000000000003 50-54 24.055 27.779999999999998 28.194999999999997 19.97 55-59 24.085 27.37 28.325 20.22 60-64 24.52 26.815 29.425 19.24 65-69 23.825 27.450000000000003 28.849999999999998 19.875 70-74 23.44 27.265 29.435 19.86 75-79 22.939999999999998 27.250000000000004 29.785 20.025000000000002 80-84 23.810000000000002 27.97 28.449999999999996 19.77 85-89 24.315 27.61 28.794999999999998 19.28 90-94 23.72 28.060000000000002 28.325 19.895 95-99 24.005000000000003 27.98 28.93 19.085 100-104 24.695 27.900000000000002 28.38 19.025 105-109 25.115 28.38 28.249999999999996 18.255 110-114 25.765 28.425 27.37 18.44 115-119 26.029999999999998 27.47 27.894999999999996 18.605 120-124 26.435 27.560000000000002 28.134999999999998 17.87 125-129 26.419999999999998 28.04 27.565 17.974999999999998 130-134 26.685 27.73 27.735 17.849999999999998 135-139 26.965 27.339999999999996 27.700000000000003 17.995 140-144 27.21 26.634999999999998 28.27 17.885 145-149 28.105000000000004 26.82 27.655 17.419999999999998 150-151 27.3 27.3375 28.199999999999996 17.1625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 1.5 9 0.5 10 0.5 11 1.0 12 0.5 13 0.5 14 0.5 15 0.0 16 1.0 17 1.0 18 0.5 19 1.0 20 0.5 21 0.5 22 1.5 23 2.0 24 2.5 25 2.5 26 3.5 27 8.5 28 11.0 29 15.0 30 21.5 31 24.5 32 31.5 33 39.5 34 51.5 35 82.0 36 105.5 37 135.5 38 154.5 39 164.5 40 193.0 41 211.0 42 233.0 43 252.0 44 257.0 45 260.5 46 260.5 47 251.5 48 213.5 49 184.0 50 169.0 51 140.0 52 116.0 53 85.5 54 62.0 55 46.0 56 30.0 57 19.5 58 22.5 59 18.5 60 13.5 61 16.0 62 10.5 63 10.0 64 8.0 65 4.0 66 3.0 67 4.5 68 4.0 69 3.5 70 3.0 71 0.5 72 0.0 73 0.5 74 1.0 75 0.5 76 1.0 77 1.5 78 1.5 79 1.5 80 0.5 81 1.0 82 1.5 83 0.5 84 0.0 85 1.0 86 1.5 87 1.0 88 0.5 89 0.5 90 0.5 91 0.0 92 0.5 93 0.5 94 0.5 95 1.0 96 1.0 97 0.5 98 0.5 99 1.0 100 3.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.3 #Duplication Level Percentage of deduplicated Percentage of total 1 85.63892145369284 73.05 2 12.01641266119578 20.5 3 1.992966002344666 5.1 4 0.29308323563892147 1.0 5 0.029308323563892142 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.029308323563892142 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 9 0.22499999999999998 No Hit CCATGACATTGAGCCTGATGAAGAGCAAGAGGTAGTCAAAAGCAGTGAAT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0125 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.0875 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.2 0.0 0.0 0.0 0.0 72-73 0.2625 0.0 0.0 0.0 0.0 74-75 0.3375 0.0 0.0 0.0 0.0 76-77 0.4125 0.0 0.0 0.0 0.0 78-79 0.525 0.0 0.0 0.0 0.0 80-81 0.6625 0.0 0.0 0.0 0.0 82-83 0.8875 0.0 0.0 0.0 0.0 84-85 1.1125 0.0 0.0 0.0 0.0 86-87 1.275 0.0 0.0 0.0 0.0 88-89 1.4625 0.0 0.0 0.0 0.0 90-91 1.7999999999999998 0.0 0.0 0.0 0.0 92-93 2.2 0.0 0.0 0.0 0.0 94-95 2.6375 0.0 0.0 0.0 0.0 96-97 3.05 0.0 0.0 0.0 0.0 98-99 3.475 0.0 0.0 0.0 0.0 100-101 3.8375000000000004 0.0 0.0 0.0 0.0 102-103 4.5125 0.0 0.0 0.0 0.0 104-105 5.05 0.0 0.0 0.0 0.0 106-107 5.6625 0.0 0.0 0.0 0.0 108-109 6.137499999999999 0.0 0.0 0.0 0.0 110-111 6.575 0.0 0.0 0.0 0.0 112-113 7.362500000000001 0.0 0.0 0.0 0.0 114-115 8.25 0.0 0.0 0.0 0.0 116-117 9.087499999999999 0.0 0.0 0.0 0.0 118-119 9.675 0.0 0.0 0.0 0.0 120-121 10.325 0.0 0.0 0.0 0.0 122-123 11.225 0.0 0.0 0.0 0.0 124-125 12.05 0.0 0.0 0.0 0.0 126-127 12.95 0.0 0.0 0.0 0.0 128-129 13.725 0.0 0.0 0.0 0.0 130-131 14.825 0.0 0.0 0.0 0.0 132-133 15.9625 0.0 0.0 0.0 0.0 134-135 16.8 0.0 0.0 0.0 0.0 136-137 17.5625 0.0 0.0 0.0 0.0 138-139 18.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGAGAAA 10 0.006830828 145.0 3 >>END_MODULE Read 1421410 spots for SRR28623293.sra Written 1421410 spots for SRR28623293.sra Read 1421410 spots for SRR28623293.sra Written 1421410 spots for SRR28623293.sra Read 1421410 spots for SRR28623293.sra Written 1421410 spots for SRR28623293.sra Read 1421410 spots for SRR28623293.sra Written 1421410 spots for SRR28623293.sra Read 1421410 spots for SRR28623293.sra Written 1421410 spots for SRR28623293.sra Read 1421410 spots for SRR28623293.sra Written 1421410 spots for SRR28623293.sra Read 1421410 spots for SRR28623293.sra Written 1421410 spots for SRR28623293.sra Read 1421410 spots for SRR28623293.sra Written 1421410 spots for SRR28623293.sra Read 1421410 spots for SRR28623293.sra Written 1421410 spots for SRR28623293.sra Read 1421410 spots for SRR28623293.sra Written 1421410 spots for SRR28623293.sra Read 1421410 spots for SRR28623293.sra Written 1421410 spots for SRR28623293.sra Read 1421410 spots for SRR28623293.sra Written 1421410 spots for SRR28623293.sra Read 1421410 spots for SRR28623293.sra Written 1421410 spots for SRR28623293.sra Read 1421416 spots for SRR28623293.sra Written 1421416 spots for SRR28623293.sra Read 1421410 spots for SRR28623293.sra Written 1421410 spots for SRR28623293.sra Read 1421410 spots for SRR28623293.sra Written 1421410 spots for SRR28623293.sra Read 1421410 spots for SRR28623293.sra Written 1421410 spots for SRR28623293.sra Read 1421410 spots for SRR28623293.sra Written 1421410 spots for SRR28623293.sra Read 1421410 spots for SRR28623293.sra Written 1421410 spots for SRR28623293.sra Read 1421410 spots for SRR28623293.sra Written 1421410 spots for SRR28623293.sra SRR ids: ['SRR28623293.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_z89pa36o SRR28623293.sra spots: 28428206 blocks: [[1, 1421410], [1421411, 2842820], [2842821, 4264230], [4264231, 5685640], [5685641, 7107050], [7107051, 8528460], [8528461, 9949870], [9949871, 11371280], [11371281, 12792690], [12792691, 14214100], [14214101, 15635510], [15635511, 17056920], [17056921, 18478330], [18478331, 19899740], [19899741, 21321150], [21321151, 22742560], [22742561, 24163970], [24163971, 25585380], [25585381, 27006790], [27006791, 28428206]] SRR28623293 file size 10496066 SRR28623293 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR28623293 SRR28623293_1.fastq SRR28623293_2.fastq Input file: SRR28623293_1.fastq Paired file: SRR28623293_2.fastq trimmed: SRR28623293-trimmed-pair1.fastq, SRR28623293-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 15:18:04 2025 >> started Tue Feb 11 15:18:41 2025 >> done (37.166s) 28428206 read pairs processed; of these: 23 ( 0.00%) short read pairs filtered out after trimming by size control 108992 ( 0.38%) empty read pairs filtered out after trimming by size control 28319191 (99.62%) read pairs available; of these: 6684127 (23.60%) trimmed read pairs available after processing 21635064 (76.40%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 5 0.00% 20 3 0.00% 21 2 0.00% 22 3 0.00% 23 10 0.00% 24 2 0.00% 25 4 0.00% 26 8 0.00% 27 9 0.00% 28 9 0.00% 29 11 0.00% 30 5 0.00% 31 16 0.00% 32 16 0.00% 33 12 0.00% 34 15 0.00% 35 24 0.00% 36 28 0.00% 37 31 0.00% 38 49 0.00% 39 52 0.00% 40 54 0.00% 41 63 0.00% 42 81 0.00% 43 102 0.00% 44 112 0.00% 45 110 0.00% 46 128 0.00% 47 167 0.00% 48 214 0.00% 49 261 0.00% 50 297 0.00% 51 407 0.00% 52 428 0.00% 53 472 0.00% 54 490 0.00% 55 595 0.00% 56 675 0.00% 57 838 0.00% 58 954 0.00% 59 1133 0.00% 60 1409 0.00% 61 1492 0.01% 62 1810 0.01% 63 1999 0.01% 64 2399 0.01% 65 2552 0.01% 66 2843 0.01% 67 3284 0.01% 68 3877 0.01% 69 4212 0.01% 70 5008 0.02% 71 5681 0.02% 72 6824 0.02% 73 7461 0.03% 74 8846 0.03% 75 9686 0.03% 76 10898 0.04% 77 11910 0.04% 78 13145 0.05% 79 14964 0.05% 80 16346 0.06% 81 18579 0.07% 82 20712 0.07% 83 22917 0.08% 84 25751 0.09% 85 28382 0.10% 86 30640 0.11% 87 32688 0.12% 88 34635 0.12% 89 36926 0.13% 90 39509 0.14% 91 42227 0.15% 92 45666 0.16% 93 48642 0.17% 94 52495 0.19% 95 56386 0.20% 96 59392 0.21% 97 61241 0.22% 98 63876 0.23% 99 66183 0.23% 100 68307 0.24% 101 70178 0.25% 102 73640 0.26% 103 76628 0.27% 104 79935 0.28% 105 83128 0.29% 106 86603 0.31% 107 88366 0.31% 108 90705 0.32% 109 91833 0.32% 110 92367 0.33% 111 94125 0.33% 112 97876 0.35% 113 98761 0.35% 114 101712 0.36% 115 105488 0.37% 116 106018 0.37% 117 109171 0.39% 118 111079 0.39% 119 111290 0.39% 120 111461 0.39% 121 112967 0.40% 122 113763 0.40% 123 115059 0.41% 124 116630 0.41% 125 118301 0.42% 126 120776 0.43% 127 122721 0.43% 128 124216 0.44% 129 124800 0.44% 130 126482 0.45% 131 124413 0.44% 132 125297 0.44% 133 126082 0.45% 134 125791 0.44% 135 126728 0.45% 136 128158 0.45% 137 129821 0.46% 138 131090 0.46% 139 132169 0.47% 140 131497 0.46% 141 131828 0.47% 142 131986 0.47% 143 131026 0.46% 144 132993 0.47% 145 132660 0.47% 146 131900 0.47% 147 132913 0.47% 148 133488 0.47% 149 134190 0.47% 150 134319 0.47% 151 21635064 76.40% 28319191 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=15.18 fanout-score-rank=5 prefix-density=0.15 prefix-fanout=15.2 sequence=GGATCGGAAGAGCACACGTCTGAACTCCAGTCACTGGCATGTATCTCGTATGCCGTCTTCTGCTTGAAAA criterion=fanout-score sequence-density=0.02 sequence-density-rank=35 fanout-score=195.28 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=14.8 sequence=GAGAAGAAATCATAGATTGCAACCAATAGATAAGGGTTGATTGTACTCCAACATCTCCTGATCGGTTCACTTGGCACTGGCAAGTTGGGTGCGGAGGAGCTTGGCAGCATCAACCATGTTCTTGAGAGCTGGCTTCACCTCAGAGTACTTGCGAGTTTTGAGTCCACAGTCAGGGTTAACCCACAATATGTTTGTCTCAAGCACTGCAAGCATCTTGTTGATTCTATCAGCAATCTC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=36 prefix-density=0.18 prefix-fanout=2.0 sequence=GCATACGGACATTTTGGAAGGGATGACCCAGACTTCACCTGGGA criterion=fanout-score sequence-density=0.08 sequence-density-rank=25 fanout-score=22.45 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=7.7 sequence=AGTTGCTGCTGCAATGTTTGCTCTGTAATGT SRR28623293 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 15:19:27 Started mapping on | Feb 11 15:19:27 Finished on | Feb 11 15:22:21 Mapping speed, Million of reads per hour | 585.91 Number of input reads | 28319191 Average input read length | 288 UNIQUE READS: Uniquely mapped reads number | 26304366 Uniquely mapped reads % | 92.89% Average mapped length | 286.51 Number of splices: Total | 17841900 Number of splices: Annotated (sjdb) | 17370871 Number of splices: GT/AG | 17529342 Number of splices: GC/AG | 227725 Number of splices: AT/AC | 17912 Number of splices: Non-canonical | 66921 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.04% Deletion average length | 2.79 Insertion rate per base | 0.03% Insertion average length | 2.19 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 590166 % of reads mapped to multiple loci | 2.08% Number of reads mapped to too many loci | 480884 % of reads mapped to too many loci | 1.70% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.90% % of reads unmapped: other | 0.43% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1424659 1424659 1424659 N_multimapping 590166 590166 590166 N_noFeature 1092652 25835153 1292975 N_ambiguous 383227 3082 112067 UnstrandedReadsAssigned:24828487 PositiveStrandReadsAssigned:466131 NegativeStrandReadsAssigned:24899324 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=142 echo kmer=137 SRR28623293 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR28623293-trimmed-pair1.fastq SRR28623293-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 28,319,191 reads, 25,617,923 reads pseudoaligned [quant] estimated average fragment length: 203.278 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,154 rounds 52401 SRR28623293.ke.tsv 34699 SRR28623293.se.tsv 87100 total ==> SRR28623293.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1815.72 720 16.4753 Potri.005G024800.1.v4.1 1035 832.722 156 7.78352 Potri.004G059700.1.v4.1 961 758.726 128 7.00932 Potri.007G009000.2.v4.1 1416 1213.72 0 0 Potri.003G141000.2.v4.1 2943 2740.72 303.229 4.59682 Potri.016G087400.1.v4.1 270 103.458 2452.59 984.947 Potri.015G069301.1.v4.1 564 364.565 0 0 Potri.010G195200.1.v4.1 1773 1570.72 61 1.61355 Potri.012G127500.1.v4.1 977 774.722 4024 215.806 ==> SRR28623293.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 4604 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 585 Potri.001G212900.v4.1 8 Potri.001G182400.v4.1 47 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR28623293 completed mapping pipeline successfully