Starting /dee2/code/volunteer_pipeline.sh SRR28623294 current disk space = 3049930330112 free memory = 1472661148 SRR28623294 SRAfilesize 29c4ca3bea477dd448aa263a42d6168d SRR28623294.sra SRR28623294.sra file validated SRR28623294 is paired end SRR28623294 is conventional basespace SRR28623294 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623294_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.271 37.0 37.0 37.0 37.0 37.0 2 36.353 37.0 37.0 37.0 37.0 37.0 3 36.4635 37.0 37.0 37.0 37.0 37.0 4 36.639 37.0 37.0 37.0 37.0 37.0 5 36.632 37.0 37.0 37.0 37.0 37.0 6 36.5935 37.0 37.0 37.0 37.0 37.0 7 36.5335 37.0 37.0 37.0 37.0 37.0 8 36.361 37.0 37.0 37.0 37.0 37.0 9 36.534 37.0 37.0 37.0 37.0 37.0 10-14 36.5456 37.0 37.0 37.0 37.0 37.0 15-19 36.498000000000005 37.0 37.0 37.0 37.0 37.0 20-24 36.4776 37.0 37.0 37.0 37.0 37.0 25-29 36.3994 37.0 37.0 37.0 37.0 37.0 30-34 36.3826 37.0 37.0 37.0 37.0 37.0 35-39 36.28090000000001 37.0 37.0 37.0 37.0 37.0 40-44 36.2688 37.0 37.0 37.0 37.0 37.0 45-49 36.2587 37.0 37.0 37.0 37.0 37.0 50-54 36.23870000000001 37.0 37.0 37.0 37.0 37.0 55-59 36.1575 37.0 37.0 37.0 37.0 37.0 60-64 36.187400000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.153 37.0 37.0 37.0 37.0 37.0 70-74 36.0998 37.0 37.0 37.0 37.0 37.0 75-79 36.0393 37.0 37.0 37.0 37.0 37.0 80-84 35.956599999999995 37.0 37.0 37.0 37.0 37.0 85-89 36.052499999999995 37.0 37.0 37.0 37.0 37.0 90-94 35.983900000000006 37.0 37.0 37.0 37.0 37.0 95-99 35.8426 37.0 37.0 37.0 37.0 37.0 100-104 35.851099999999995 37.0 37.0 37.0 37.0 37.0 105-109 35.882 37.0 37.0 37.0 37.0 37.0 110-114 35.7768 37.0 37.0 37.0 37.0 37.0 115-119 35.8058 37.0 37.0 37.0 37.0 37.0 120-124 35.6677 37.0 37.0 37.0 37.0 37.0 125-129 35.5369 37.0 37.0 37.0 37.0 37.0 130-134 35.67 37.0 37.0 37.0 37.0 37.0 135-139 35.524699999999996 37.0 37.0 37.0 37.0 37.0 140-144 35.2202 37.0 37.0 37.0 29.8 37.0 145-149 35.231199999999994 37.0 37.0 37.0 29.8 37.0 150-151 35.0165 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 1.0 21 1.0 22 4.0 23 2.0 24 2.0 25 8.0 26 11.0 27 11.0 28 18.0 29 29.0 30 37.0 31 41.0 32 66.0 33 116.0 34 147.0 35 382.0 36 2877.0 37 246.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.50803212851406 14.332329317269076 8.810240963855422 37.34939759036144 2 18.925 15.675 35.725 29.675 3 16.575 18.8 28.975 35.65 4 21.15 27.6 25.1 26.150000000000002 5 25.2 32.2 23.175 19.425 6 20.549999999999997 35.949999999999996 23.799999999999997 19.7 7 14.825 27.275 40.875 17.025000000000002 8 17.925 26.85 31.374999999999996 23.849999999999998 9 17.25 23.75 34.525 24.474999999999998 10-14 19.675 29.94 28.03 22.355 15-19 19.689999999999998 28.249999999999996 28.884999999999998 23.175 20-24 19.585 29.01 27.639999999999997 23.765 25-29 19.785 29.075 27.334999999999997 23.805 30-34 19.0 28.694999999999997 28.910000000000004 23.395 35-39 19.29 29.005 28.194999999999997 23.51 40-44 19.015 29.205 27.939999999999998 23.84 45-49 19.235 29.575000000000003 27.900000000000002 23.29 50-54 19.79 29.299999999999997 28.005000000000003 22.905 55-59 19.685 29.459999999999997 27.810000000000002 23.044999999999998 60-64 19.105 28.67 28.549999999999997 23.674999999999997 65-69 19.650000000000002 29.299999999999997 27.584999999999997 23.465 70-74 19.975 28.74 27.47 23.815 75-79 20.24 28.215 28.1 23.445 80-84 20.29 28.15 28.144999999999996 23.415 85-89 20.485 29.080000000000002 27.595 22.84 90-94 20.345 29.659999999999997 27.42 22.575 95-99 20.605 28.985 27.295 23.115 100-104 20.200000000000003 28.465 28.26 23.075000000000003 105-109 20.055 29.054999999999996 27.675 23.215 110-114 20.53 28.82 27.57 23.080000000000002 115-119 21.055 28.810000000000002 27.21 22.925 120-124 21.224999999999998 28.68 26.590000000000003 23.505000000000003 125-129 20.36 28.165000000000003 27.255000000000003 24.22 130-134 20.925 29.18 26.955000000000002 22.939999999999998 135-139 20.76 28.425 26.974999999999998 23.84 140-144 21.135 28.21 26.55 24.104999999999997 145-149 21.68 28.12 26.61 23.59 150-151 20.8625 28.050000000000004 26.85 24.2375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.5 19 1.0 20 1.5 21 1.5 22 2.5 23 3.0 24 2.0 25 5.0 26 5.5 27 6.5 28 10.5 29 18.0 30 24.0 31 25.5 32 36.5 33 47.5 34 69.5 35 87.5 36 91.0 37 118.5 38 152.0 39 185.5 40 202.0 41 219.5 42 261.0 43 271.5 44 289.5 45 279.5 46 248.5 47 236.5 48 216.5 49 190.0 50 149.0 51 122.5 52 104.0 53 83.0 54 63.0 55 47.0 56 32.5 57 25.0 58 18.5 59 10.5 60 7.0 61 6.0 62 5.5 63 2.5 64 2.5 65 2.5 66 0.5 67 0.0 68 0.0 69 0.5 70 2.0 71 2.5 72 1.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.4 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.45 #Duplication Level Percentage of deduplicated Percentage of total 1 85.83967232299591 73.35000000000001 2 11.81977764774722 20.200000000000003 3 1.8431831480397893 4.725 4 0.4681100058513751 1.6 5 0.029256875365710942 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCAAGTCATTAATCCCAAGCTTACACTCTGAGAAGAGTAAATTCTGCACT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0875 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.2 0.0 0.0 0.0 0.0 74-75 0.225 0.0 0.0 0.0 0.0 76-77 0.25 0.0 0.0 0.0 0.0 78-79 0.325 0.0 0.0 0.0 0.0 80-81 0.4 0.0 0.0 0.0 0.0 82-83 0.4875 0.0 0.0 0.0 0.0 84-85 0.525 0.0 0.0 0.0 0.0 86-87 0.6375 0.0 0.0 0.0 0.0 88-89 0.7749999999999999 0.0 0.0 0.0 0.0 90-91 0.825 0.0 0.0 0.0 0.0 92-93 0.9375 0.0 0.0 0.0 0.0 94-95 1.0 0.0 0.0 0.0 0.0 96-97 1.1875 0.0 0.0 0.0 0.0 98-99 1.425 0.0 0.0 0.0 0.0 100-101 1.525 0.0 0.0 0.0 0.0 102-103 1.7374999999999998 0.0 0.0 0.0 0.0 104-105 1.9375 0.0 0.0 0.0 0.0 106-107 2.2 0.0 0.0 0.0 0.0 108-109 2.575 0.0 0.0 0.0 0.0 110-111 3.0 0.0 0.0 0.0 0.0 112-113 3.4 0.0 0.0 0.0 0.0 114-115 3.825 0.0 0.0 0.0 0.0 116-117 4.2625 0.0 0.0 0.0 0.0 118-119 4.725 0.0 0.0 0.0 0.0 120-121 5.2 0.0 0.0 0.0 0.0 122-123 5.775 0.0 0.0 0.0 0.0 124-125 6.35 0.0 0.0 0.0 0.0 126-127 6.9875 0.0 0.0 0.0 0.0 128-129 7.575 0.0 0.0 0.0 0.0 130-131 8.3625 0.0 0.0 0.0 0.0 132-133 9.0 0.0 0.0 0.0 0.0 134-135 9.675 0.0 0.0 0.0 0.0 136-137 10.3375 0.0 0.0 0.0 0.0 138-139 11.0625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACTCCAG 35 0.0035366106 20.714287 135-139 TCTGAAC 35 0.0035366106 20.714287 130-134 AGTCACC 35 0.0035366106 20.714287 140-144 >>END_MODULE SRR28623294 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623294_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.562 37.0 37.0 37.0 37.0 37.0 2 36.0435 37.0 37.0 37.0 37.0 37.0 3 35.9235 37.0 37.0 37.0 37.0 37.0 4 35.9355 37.0 37.0 37.0 37.0 37.0 5 36.131 37.0 37.0 37.0 37.0 37.0 6 36.1085 37.0 37.0 37.0 37.0 37.0 7 36.043 37.0 37.0 37.0 37.0 37.0 8 36.073 37.0 37.0 37.0 37.0 37.0 9 35.9765 37.0 37.0 37.0 37.0 37.0 10-14 35.9488 37.0 37.0 37.0 37.0 37.0 15-19 35.9288 37.0 37.0 37.0 37.0 37.0 20-24 35.866 37.0 37.0 37.0 37.0 37.0 25-29 35.7803 37.0 37.0 37.0 37.0 37.0 30-34 35.678999999999995 37.0 37.0 37.0 37.0 37.0 35-39 35.767399999999995 37.0 37.0 37.0 37.0 37.0 40-44 35.6466 37.0 37.0 37.0 37.0 37.0 45-49 35.6441 37.0 37.0 37.0 37.0 37.0 50-54 35.643899999999995 37.0 37.0 37.0 37.0 37.0 55-59 35.476099999999995 37.0 37.0 37.0 37.0 37.0 60-64 35.456900000000005 37.0 37.0 37.0 37.0 37.0 65-69 35.5319 37.0 37.0 37.0 37.0 37.0 70-74 35.527300000000004 37.0 37.0 37.0 37.0 37.0 75-79 35.5492 37.0 37.0 37.0 37.0 37.0 80-84 35.46 37.0 37.0 37.0 37.0 37.0 85-89 35.34589999999999 37.0 37.0 37.0 34.6 37.0 90-94 35.331 37.0 37.0 37.0 37.0 37.0 95-99 35.3251 37.0 37.0 37.0 34.6 37.0 100-104 35.1959 37.0 37.0 37.0 29.8 37.0 105-109 35.206999999999994 37.0 37.0 37.0 32.2 37.0 110-114 35.233799999999995 37.0 37.0 37.0 37.0 37.0 115-119 35.12519999999999 37.0 37.0 37.0 27.4 37.0 120-124 35.1005 37.0 37.0 37.0 27.4 37.0 125-129 34.605399999999996 37.0 37.0 37.0 25.0 37.0 130-134 35.0764 37.0 37.0 37.0 27.4 37.0 135-139 34.7734 37.0 37.0 37.0 25.0 37.0 140-144 34.8546 37.0 37.0 37.0 25.0 37.0 145-149 34.7749 37.0 37.0 37.0 25.0 37.0 150-151 34.473 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 6.0 14 7.0 15 10.0 16 7.0 17 6.0 18 2.0 19 3.0 20 5.0 21 7.0 22 10.0 23 7.0 24 14.0 25 12.0 26 16.0 27 17.0 28 17.0 29 30.0 30 36.0 31 58.0 32 67.0 33 129.0 34 265.0 35 716.0 36 2354.0 37 197.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.425000000000004 20.150000000000002 12.775 23.65 2 26.974999999999998 25.575 30.25 17.2 3 22.650000000000002 27.875 31.474999999999998 18.0 4 25.85 32.625 24.025 17.5 5 25.825 36.75 20.775 16.650000000000002 6 21.775 38.224999999999994 22.7 17.299999999999997 7 21.95 21.825 37.0 19.225 8 20.775 26.375 27.675 25.174999999999997 9 22.725 26.625 29.349999999999998 21.3 10-14 24.154999999999998 30.330000000000002 25.66 19.855 15-19 23.605 28.494999999999997 27.33 20.57 20-24 23.51 28.854999999999997 27.625 20.01 25-29 23.849999999999998 28.12 27.589999999999996 20.44 30-34 23.96 28.134999999999998 28.055000000000003 19.85 35-39 23.22 28.660000000000004 28.139999999999997 19.98 40-44 23.205000000000002 28.185 28.000000000000004 20.61 45-49 23.325000000000003 28.92 28.32 19.435 50-54 23.145 29.01 28.305000000000003 19.54 55-59 24.33 28.48 27.544999999999998 19.645000000000003 60-64 23.345 28.744999999999997 27.339999999999996 20.57 65-69 23.25 28.939999999999998 27.800000000000004 20.01 70-74 24.235 28.42 27.51 19.835 75-79 23.549999999999997 28.444999999999997 28.305000000000003 19.7 80-84 24.14 28.67 27.18 20.01 85-89 23.330000000000002 28.910000000000004 27.615000000000002 20.145 90-94 23.75 28.925 27.58 19.744999999999997 95-99 23.849999999999998 28.9 28.075 19.175 100-104 23.73 28.560000000000002 27.48 20.23 105-109 23.75 28.884999999999998 27.925 19.439999999999998 110-114 23.599999999999998 29.220000000000002 27.375 19.805 115-119 23.885 28.804999999999996 27.47 19.84 120-124 24.795 28.79 26.88 19.535 125-129 25.655 28.645 26.715 18.985 130-134 24.759999999999998 28.645 27.3 19.295 135-139 25.259999999999998 28.505000000000003 26.86 19.375 140-144 25.39 28.815 25.965 19.830000000000002 145-149 25.540000000000003 28.74 26.784999999999997 18.935 150-151 25.9875 28.675 26.9625 18.375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.5 3 1.0 4 1.0 5 0.5 6 0.0 7 0.5 8 0.5 9 1.0 10 1.0 11 0.5 12 2.0 13 2.0 14 1.0 15 1.5 16 2.0 17 2.0 18 1.5 19 0.5 20 1.0 21 2.5 22 3.0 23 2.5 24 5.0 25 6.0 26 3.5 27 6.0 28 10.5 29 17.5 30 19.5 31 28.5 32 39.0 33 46.5 34 54.5 35 72.5 36 95.5 37 112.0 38 142.5 39 174.5 40 208.0 41 250.5 42 276.5 43 272.0 44 268.5 45 253.0 46 241.0 47 228.5 48 210.0 49 188.5 50 148.5 51 118.0 52 100.0 53 80.5 54 58.5 55 45.0 56 37.0 57 31.5 58 22.5 59 20.5 60 17.0 61 8.0 62 7.0 63 7.5 64 4.0 65 1.0 66 1.0 67 1.5 68 1.0 69 0.5 70 1.0 71 0.5 72 0.0 73 1.0 74 2.5 75 1.5 76 0.0 77 0.0 78 1.0 79 2.0 80 1.5 81 1.0 82 1.0 83 1.5 84 1.0 85 0.0 86 0.0 87 0.5 88 0.5 89 1.0 90 1.5 91 1.5 92 1.0 93 0.0 94 0.0 95 1.0 96 1.5 97 0.5 98 0.5 99 1.0 100 3.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 86.05000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 86.66472980825102 74.575 2 11.243463102847182 19.35 3 1.568855316676351 4.05 4 0.43579314352120857 1.5 5 0.058105752469494475 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.029052876234747237 0.27499999999999997 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 11 0.27499999999999997 No Hit AGTTTCCATATGTCCCATGCCGAAATCAAGCCAATATCTGATGTACTTAG 5 0.125 No Hit AGAAAATCCTCGTGTTCCCCCACCTGCACTAGATGCTGCTAGTCTTGATT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.1125 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.225 0.0 0.0 0.0 0.0 74-75 0.25 0.0 0.0 0.0 0.0 76-77 0.275 0.0 0.0 0.0 0.0 78-79 0.35 0.0 0.0 0.0 0.0 80-81 0.42500000000000004 0.0 0.0 0.0 0.0 82-83 0.5125 0.0 0.0 0.0 0.0 84-85 0.55 0.0 0.0 0.0 0.0 86-87 0.6625000000000001 0.0 0.0 0.0 0.0 88-89 0.8 0.0 0.0 0.0 0.0 90-91 0.85 0.0 0.0 0.0 0.0 92-93 0.95 0.0 0.0 0.0 0.0 94-95 1.0 0.0 0.0 0.0 0.0 96-97 1.1875 0.0 0.0 0.0 0.0 98-99 1.425 0.0 0.0 0.0 0.0 100-101 1.55 0.0 0.0 0.0 0.0 102-103 1.7625000000000002 0.0 0.0 0.0 0.0 104-105 1.9625 0.0 0.0 0.0 0.0 106-107 2.2375 0.0 0.0 0.0 0.0 108-109 2.625 0.0 0.0 0.0 0.0 110-111 3.05 0.0 0.0 0.0 0.0 112-113 3.4375 0.0 0.0 0.0 0.0 114-115 3.8625 0.0 0.0 0.0 0.0 116-117 4.3 0.0 0.0 0.0 0.0 118-119 4.737500000000001 0.0 0.0 0.0 0.0 120-121 5.2125 0.0 0.0 0.0 0.0 122-123 5.8125 0.0 0.0 0.0 0.0 124-125 6.425000000000001 0.0 0.0 0.0 0.0 126-127 7.05 0.0 0.0 0.0 0.0 128-129 7.65 0.0 0.0 0.0 0.0 130-131 8.4375 0.0 0.0 0.0 0.0 132-133 9.075 0.0 0.0 0.0 0.0 134-135 9.775 0.0 0.0 0.0 0.0 136-137 10.4375 0.0 0.0 0.0 0.0 138-139 11.1875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTAGGGA 30 0.0014437955 24.166668 130-134 >>END_MODULE Read 1906869 spots for SRR28623294.sra Written 1906869 spots for SRR28623294.sra Read 1906869 spots for SRR28623294.sra Written 1906869 spots for SRR28623294.sra Read 1906869 spots for SRR28623294.sra Written 1906869 spots for SRR28623294.sra Read 1906869 spots for SRR28623294.sra Written 1906869 spots for SRR28623294.sra Read 1906869 spots for SRR28623294.sra Written 1906869 spots for SRR28623294.sra Read 1906869 spots for SRR28623294.sra Written 1906869 spots for SRR28623294.sra Read 1906869 spots for SRR28623294.sra Written 1906869 spots for SRR28623294.sra Read 1906869 spots for SRR28623294.sra Written 1906869 spots for SRR28623294.sra Read 1906869 spots for SRR28623294.sra Written 1906869 spots for SRR28623294.sra Read 1906869 spots for SRR28623294.sra Written 1906869 spots for SRR28623294.sra Read 1906869 spots for SRR28623294.sra Written 1906869 spots for SRR28623294.sra Read 1906869 spots for SRR28623294.sra Written 1906869 spots for SRR28623294.sra Read 1906869 spots for SRR28623294.sra Written 1906869 spots for SRR28623294.sra Read 1906869 spots for SRR28623294.sra Written 1906869 spots for SRR28623294.sra Read 1906869 spots for SRR28623294.sra Written 1906869 spots for SRR28623294.sra Read 1906870 spots for SRR28623294.sra Written 1906870 spots for SRR28623294.sra Read 1906869 spots for SRR28623294.sra Written 1906869 spots for SRR28623294.sra Read 1906869 spots for SRR28623294.sra Written 1906869 spots for SRR28623294.sra Read 1906869 spots for SRR28623294.sra Written 1906869 spots for SRR28623294.sra Read 1906869 spots for SRR28623294.sra Written 1906869 spots for SRR28623294.sra SRR ids: ['SRR28623294.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__rd_j583 SRR28623294.sra spots: 38137381 blocks: [[1, 1906869], [1906870, 3813738], [3813739, 5720607], [5720608, 7627476], [7627477, 9534345], [9534346, 11441214], [11441215, 13348083], [13348084, 15254952], [15254953, 17161821], [17161822, 19068690], [19068691, 20975559], [20975560, 22882428], [22882429, 24789297], [24789298, 26696166], [26696167, 28603035], [28603036, 30509904], [30509905, 32416773], [32416774, 34323642], [34323643, 36230511], [36230512, 38137381]] SRR28623294 file size 14084511 SRR28623294 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR28623294 SRR28623294_1.fastq SRR28623294_2.fastq Input file: SRR28623294_1.fastq Paired file: SRR28623294_2.fastq trimmed: SRR28623294-trimmed-pair1.fastq, SRR28623294-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 14:51:18 2025 >> started Tue Feb 11 14:52:12 2025 >> done (54.089s) 38137381 read pairs processed; of these: 29 ( 0.00%) short read pairs filtered out after trimming by size control 37807 ( 0.10%) empty read pairs filtered out after trimming by size control 38099545 (99.90%) read pairs available; of these: 5470067 (14.36%) trimmed read pairs available after processing 32629478 (85.64%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 7 0.00% 20 4 0.00% 21 8 0.00% 22 6 0.00% 23 7 0.00% 24 7 0.00% 25 14 0.00% 26 10 0.00% 27 13 0.00% 28 8 0.00% 29 12 0.00% 30 23 0.00% 31 22 0.00% 32 23 0.00% 33 16 0.00% 34 26 0.00% 35 31 0.00% 36 41 0.00% 37 39 0.00% 38 49 0.00% 39 43 0.00% 40 41 0.00% 41 69 0.00% 42 62 0.00% 43 74 0.00% 44 71 0.00% 45 87 0.00% 46 97 0.00% 47 104 0.00% 48 142 0.00% 49 189 0.00% 50 181 0.00% 51 246 0.00% 52 215 0.00% 53 269 0.00% 54 244 0.00% 55 331 0.00% 56 368 0.00% 57 397 0.00% 58 472 0.00% 59 608 0.00% 60 680 0.00% 61 752 0.00% 62 907 0.00% 63 969 0.00% 64 1144 0.00% 65 1295 0.00% 66 1423 0.00% 67 1668 0.00% 68 1906 0.01% 69 2157 0.01% 70 2485 0.01% 71 2931 0.01% 72 3317 0.01% 73 3820 0.01% 74 4277 0.01% 75 4704 0.01% 76 5431 0.01% 77 6207 0.02% 78 6837 0.02% 79 7628 0.02% 80 8586 0.02% 81 9772 0.03% 82 10832 0.03% 83 12128 0.03% 84 13820 0.04% 85 15323 0.04% 86 16353 0.04% 87 17609 0.05% 88 19296 0.05% 89 21089 0.06% 90 22425 0.06% 91 24755 0.06% 92 26613 0.07% 93 28600 0.08% 94 31170 0.08% 95 33197 0.09% 96 35246 0.09% 97 37805 0.10% 98 38832 0.10% 99 41583 0.11% 100 43474 0.11% 101 45626 0.12% 102 48285 0.13% 103 51473 0.14% 104 53884 0.14% 105 55755 0.15% 106 59291 0.16% 107 60613 0.16% 108 62782 0.16% 109 65414 0.17% 110 65990 0.17% 111 69111 0.18% 112 71510 0.19% 113 73424 0.19% 114 75958 0.20% 115 79368 0.21% 116 81322 0.21% 117 83122 0.22% 118 86641 0.23% 119 87882 0.23% 120 89507 0.23% 121 92331 0.24% 122 93570 0.25% 123 95608 0.25% 124 98054 0.26% 125 100012 0.26% 126 102857 0.27% 127 105428 0.28% 128 106656 0.28% 129 107941 0.28% 130 110960 0.29% 131 111182 0.29% 132 112352 0.29% 133 114930 0.30% 134 116462 0.31% 135 117605 0.31% 136 119630 0.31% 137 120801 0.32% 138 122530 0.32% 139 124155 0.33% 140 125512 0.33% 141 126737 0.33% 142 129055 0.34% 143 129281 0.34% 144 133091 0.35% 145 132845 0.35% 146 132423 0.35% 147 134617 0.35% 148 137255 0.36% 149 136548 0.36% 150 138954 0.36% 151 32629478 85.64% 38099545 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=11.63 fanout-score-rank=15 prefix-density=0.10 prefix-fanout=11.6 sequence=GGATCGGAAGAGCACACGTCTGAACTCCAGTCACCACTGACAATCTCGTATGCCGTCTTCT criterion=fanout-score sequence-density=0.07 sequence-density-rank=25 fanout-score=454.68 fanout-score-rank=1 prefix-density=0.91 prefix-fanout=33.4 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=2.95 fanout-score-rank=34 prefix-density=0.17 prefix-fanout=2.6 sequence=GGGATGGAGAAGCTGGTTTCAGAGGTTGATCTTGTCAAGTCCTTTGAATGGGGGCA criterion=fanout-score sequence-density=0.09 sequence-density-rank=11 fanout-score=345.51 fanout-score-rank=1 prefix-density=0.91 prefix-fanout=33.7 sequence=AAGAAGAAGAAA SRR28623294 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 14:52:55 Started mapping on | Feb 11 14:52:55 Finished on | Feb 11 14:57:05 Mapping speed, Million of reads per hour | 548.63 Number of input reads | 38099545 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 35368460 Uniquely mapped reads % | 92.83% Average mapped length | 292.89 Number of splices: Total | 31981646 Number of splices: Annotated (sjdb) | 31172747 Number of splices: GT/AG | 31398918 Number of splices: GC/AG | 453616 Number of splices: AT/AC | 33040 Number of splices: Non-canonical | 96072 Mismatch rate per base, % | 0.44% Deletion rate per base | 0.03% Deletion average length | 2.99 Insertion rate per base | 0.03% Insertion average length | 2.40 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 980445 % of reads mapped to multiple loci | 2.57% Number of reads mapped to too many loci | 188093 % of reads mapped to too many loci | 0.49% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.82% % of reads unmapped: other | 0.28% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1750640 1750640 1750640 N_multimapping 980445 980445 980445 N_noFeature 1585769 34902559 1824521 N_ambiguous 430587 3312 201182 UnstrandedReadsAssigned:33352104 PositiveStrandReadsAssigned:462589 NegativeStrandReadsAssigned:33342757 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR28623294 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR28623294-trimmed-pair1.fastq SRR28623294-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 38,099,545 reads, 33,937,834 reads pseudoaligned [quant] estimated average fragment length: 235.734 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,093 rounds 52401 SRR28623294.ke.tsv 34699 SRR28623294.se.tsv 87100 total ==> SRR28623294.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1783.27 1903.02 31.419 Potri.005G024800.1.v4.1 1035 800.266 1620 59.6002 Potri.004G059700.1.v4.1 961 726.29 121 4.90504 Potri.007G009000.2.v4.1 1416 1181.27 0 0 Potri.003G141000.2.v4.1 2943 2708.27 1160.74 12.6185 Potri.016G087400.1.v4.1 270 91.8074 3108.03 996.721 Potri.015G069301.1.v4.1 564 336.49 0 0 Potri.010G195200.1.v4.1 1773 1538.27 87 1.66515 Potri.012G127500.1.v4.1 977 742.266 14097 559.157 ==> SRR28623294.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 3786 Potri.001G233950.v4.1 5 Potri.001G122700.v4.1 621 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 4 Potri.001G452600.v4.1 9 SRR28623294 completed mapping pipeline successfully