Starting /dee2/code/volunteer_pipeline.sh SRR28623295 current disk space = 3049912152064 free memory = 1422784116 SRR28623295 SRAfilesize 3c2caf5f7793f12fef63939f71c8938d SRR28623295.sra SRR28623295.sra file validated SRR28623295 is paired end SRR28623295 is conventional basespace SRR28623295 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623295_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.41325 37.0 37.0 37.0 37.0 37.0 2 36.585 37.0 37.0 37.0 37.0 37.0 3 36.5955 37.0 37.0 37.0 37.0 37.0 4 36.739 37.0 37.0 37.0 37.0 37.0 5 36.7805 37.0 37.0 37.0 37.0 37.0 6 36.647 37.0 37.0 37.0 37.0 37.0 7 36.6395 37.0 37.0 37.0 37.0 37.0 8 36.4825 37.0 37.0 37.0 37.0 37.0 9 36.596 37.0 37.0 37.0 37.0 37.0 10-14 36.655899999999995 37.0 37.0 37.0 37.0 37.0 15-19 36.627300000000005 37.0 37.0 37.0 37.0 37.0 20-24 36.6 37.0 37.0 37.0 37.0 37.0 25-29 36.5133 37.0 37.0 37.0 37.0 37.0 30-34 36.5018 37.0 37.0 37.0 37.0 37.0 35-39 36.4873 37.0 37.0 37.0 37.0 37.0 40-44 36.3077 37.0 37.0 37.0 37.0 37.0 45-49 35.6943 37.0 37.0 37.0 37.0 37.0 50-54 35.9139 37.0 37.0 37.0 37.0 37.0 55-59 35.452 37.0 37.0 37.0 37.0 37.0 60-64 35.4808 37.0 37.0 37.0 37.0 37.0 65-69 35.3901 37.0 37.0 37.0 37.0 37.0 70-74 35.6177 37.0 37.0 37.0 37.0 37.0 75-79 36.1701 37.0 37.0 37.0 37.0 37.0 80-84 36.0438 37.0 37.0 37.0 37.0 37.0 85-89 36.146699999999996 37.0 37.0 37.0 37.0 37.0 90-94 36.031000000000006 37.0 37.0 37.0 37.0 37.0 95-99 35.98479999999999 37.0 37.0 37.0 37.0 37.0 100-104 35.976800000000004 37.0 37.0 37.0 37.0 37.0 105-109 35.985299999999995 37.0 37.0 37.0 37.0 37.0 110-114 35.889300000000006 37.0 37.0 37.0 37.0 37.0 115-119 35.8995 37.0 37.0 37.0 37.0 37.0 120-124 35.69070000000001 37.0 37.0 37.0 37.0 37.0 125-129 35.6613 37.0 37.0 37.0 37.0 37.0 130-134 35.768899999999995 37.0 37.0 37.0 37.0 37.0 135-139 35.6123 37.0 37.0 37.0 37.0 37.0 140-144 35.296800000000005 37.0 37.0 37.0 34.6 37.0 145-149 35.227599999999995 37.0 37.0 37.0 32.2 37.0 150-151 35.03275 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 1.0 20 2.0 21 2.0 22 1.0 23 5.0 24 4.0 25 4.0 26 5.0 27 12.0 28 17.0 29 24.0 30 23.0 31 30.0 32 85.0 33 203.0 34 170.0 35 347.0 36 2790.0 37 274.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.90258599045945 12.628671855385388 11.850364047200603 39.61837810695455 2 17.75 19.475 34.2 28.575 3 17.849999999999998 18.925 30.525000000000002 32.7 4 19.15 26.0 24.875 29.975 5 24.4 32.7 22.625 20.275000000000002 6 24.975 35.05 22.225 17.75 7 13.900000000000002 33.575 37.15 15.375 8 17.675 32.425 29.049999999999997 20.849999999999998 9 20.4 24.15 33.900000000000006 21.55 10-14 18.63 33.26 25.290000000000003 22.82 15-19 18.15 31.305 26.855 23.69 20-24 18.32 31.785000000000004 26.875 23.02 25-29 19.215 31.115 26.47 23.200000000000003 30-34 18.45 29.759999999999998 26.900000000000002 24.89 35-39 20.315 29.509999999999998 27.805000000000003 22.37 40-44 17.915 29.830000000000002 28.63 23.625 45-49 19.655 30.130000000000003 26.695 23.52 50-54 20.330000000000002 29.775000000000002 26.424999999999997 23.47 55-59 18.475 29.310000000000002 28.21 24.005000000000003 60-64 19.925 29.24 27.61 23.225 65-69 20.265 30.795 26.16 22.78 70-74 23.669999999999998 29.270000000000003 24.935 22.125 75-79 23.27 28.725 25.715 22.29 80-84 23.0 28.655 25.869999999999997 22.475 85-89 23.855 29.32 25.045 21.78 90-94 23.195 29.154999999999998 25.235000000000003 22.415 95-99 23.66 28.965000000000003 25.174999999999997 22.2 100-104 23.200000000000003 30.145 24.87 21.785 105-109 23.419999999999998 28.105000000000004 25.145 23.330000000000002 110-114 23.73 28.465 24.945 22.86 115-119 24.044999999999998 27.62 25.4 22.935 120-124 24.005000000000003 27.915 24.85 23.23 125-129 23.849999999999998 28.29 24.46 23.400000000000002 130-134 23.94 27.99 24.22 23.849999999999998 135-139 24.875 27.584999999999997 24.59 22.95 140-144 24.779999999999998 26.93 24.745 23.544999999999998 145-149 25.445 26.265 24.855 23.435 150-151 25.362499999999997 27.200000000000003 24.5375 22.900000000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.5 11 0.5 12 0.0 13 0.5 14 0.5 15 0.5 16 1.0 17 0.5 18 0.5 19 0.5 20 0.0 21 1.5 22 2.0 23 2.0 24 2.5 25 5.5 26 8.5 27 8.5 28 14.0 29 26.5 30 41.5 31 53.0 32 59.5 33 83.0 34 110.0 35 102.5 36 116.0 37 144.0 38 155.0 39 180.0 40 185.0 41 192.5 42 212.5 43 219.0 44 219.0 45 223.5 46 225.0 47 205.5 48 184.0 49 159.0 50 136.5 51 119.5 52 95.5 53 74.5 54 58.5 55 48.0 56 38.0 57 25.5 58 16.0 59 15.0 60 12.0 61 6.5 62 8.0 63 8.0 64 9.0 65 15.5 66 33.0 67 38.5 68 29.0 69 26.0 70 17.0 71 8.5 72 7.0 73 4.5 74 2.5 75 1.0 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.42500000000000004 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 81.0 #Duplication Level Percentage of deduplicated Percentage of total 1 85.30864197530865 69.1 2 11.17283950617284 18.099999999999998 3 2.7160493827160495 6.6000000000000005 4 0.5246913580246914 1.7000000000000002 5 0.12345679012345678 0.5 6 0.030864197530864196 0.15 7 0.0 0.0 8 0.030864197530864196 0.2 9 0.0 0.0 >10 0.030864197530864196 0.27499999999999997 >50 0.06172839506172839 3.375 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGGTTGTTATCTCGTAT 83 2.075 TruSeq Adapter, Index 2 (97% over 37bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGGTTGTTATCGCGTAT 52 1.3 TruSeq Adapter, Index 2 (97% over 37bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGGTTGTTATCTCGTTT 11 0.27499999999999997 TruSeq Adapter, Index 2 (97% over 37bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGGTTGTTATCTCGGAT 8 0.2 TruSeq Adapter, Index 2 (97% over 37bp) GTCATGTTCTTGTGAGCTAGAACGACAAAGGCCCTCCATTCGGCTTCTCA 6 0.15 No Hit CCGGATAATTCATGTACTTCACATTGCTCAAAAGAAGAAAATTTAATACA 5 0.125 No Hit GACGTGAATTGGAAATTGGATTCACGAAGGTGATGATCATCCTCGGGAGC 5 0.125 No Hit CTGCAGGGTTTGTACCCATATACTGGAAGAGGTCGTCCTTGCTAAGTCCA 5 0.125 No Hit CTTCGGTAGAATAAATTAATTCTTCGCAGTTTTCCAACATCTAATAAAAA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.0625 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.15 0.0 0.0 0.0 0.0 64-65 0.1875 0.0 0.0 0.0 0.0 66-67 0.21250000000000002 0.0 0.0 0.0 0.0 68-69 0.2625 0.0 0.0 0.0 0.0 70-71 0.3625 0.0 0.0 0.0 0.0 72-73 0.4 0.0 0.0 0.0 0.0 74-75 0.4375 0.0 0.0 0.0 0.0 76-77 0.5 0.0 0.0 0.0 0.0 78-79 0.6375 0.0 0.0 0.0 0.0 80-81 0.725 0.0 0.0 0.0 0.0 82-83 0.7875000000000001 0.0 0.0 0.0 0.0 84-85 0.9375 0.0 0.0 0.0 0.0 86-87 1.1625 0.0 0.0 0.0 0.0 88-89 1.3624999999999998 0.0 0.0 0.0 0.0 90-91 1.6124999999999998 0.0 0.0 0.0 0.0 92-93 1.95 0.0 0.0 0.0 0.0 94-95 2.2249999999999996 0.0 0.0 0.0 0.0 96-97 2.825 0.0 0.0 0.0 0.0 98-99 3.3125 0.0 0.0 0.0 0.0 100-101 3.6125 0.0 0.0 0.0 0.0 102-103 4.2 0.0 0.0 0.0 0.0 104-105 4.512499999999999 0.0 0.0 0.0 0.0 106-107 5.125 0.0 0.0 0.0 0.0 108-109 5.75 0.0 0.0 0.0 0.0 110-111 6.5875 0.0 0.0 0.0 0.0 112-113 7.125 0.0 0.0 0.0 0.0 114-115 7.7125 0.0 0.0 0.0 0.0 116-117 8.3125 0.0 0.0 0.0 0.0 118-119 9.05 0.0 0.0 0.0 0.0 120-121 9.8125 0.0 0.0 0.0 0.0 122-123 10.6125 0.0 0.0 0.0 0.0 124-125 11.287500000000001 0.0 0.0 0.0 0.0 126-127 11.850000000000001 0.0 0.0 0.0 0.0 128-129 12.7625 0.0 0.0 0.0 0.0 130-131 13.725000000000001 0.0 0.0 0.0 0.0 132-133 14.462499999999999 0.0 0.0 0.0 0.0 134-135 15.325 0.0 0.0 0.0 0.0 136-137 16.2875 0.0 0.0 0.0 0.0 138-139 16.9875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content fail #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGCACA 130 1.8189894E-12 55.76923 9 GATCGGA 135 1.8189894E-12 53.7037 1 TCGGAAG 135 1.8189894E-12 53.7037 3 ATCGGAA 135 1.8189894E-12 53.7037 2 CGGAAGA 140 1.8189894E-12 51.785717 4 AGAGCAC 140 1.8189894E-12 51.785717 8 GGAAGAG 145 3.6379788E-12 50.000004 5 AAGAGCA 150 5.456968E-12 48.333336 7 GAAGAGC 150 5.456968E-12 48.333336 6 TTATCGC 25 4.977651E-4 29.0 40-44 CCGTCTT 40 2.9937655E-7 29.0 50-54 ATGCCGT 40 2.9937655E-7 29.0 45-49 TCGTATG 20 0.00593511 29.0 45-49 GCGTATG 25 4.977651E-4 29.0 45-49 GCCGTCT 40 2.9937655E-7 29.0 50-54 ATCGCGT 25 4.977651E-4 29.0 40-44 GTTATCG 25 4.977651E-4 29.0 35-39 CGTCTTC 35 3.5374105E-6 29.0 50-54 CTCGTAT 20 0.00593511 29.0 40-44 GTATGCC 45 2.538036E-8 28.999998 45-49 >>END_MODULE SRR28623295 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623295_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.6855 37.0 37.0 37.0 37.0 37.0 2 36.259 37.0 37.0 37.0 37.0 37.0 3 36.2635 37.0 37.0 37.0 37.0 37.0 4 36.151 37.0 37.0 37.0 37.0 37.0 5 36.2015 37.0 37.0 37.0 37.0 37.0 6 36.149 37.0 37.0 37.0 37.0 37.0 7 36.015 37.0 37.0 37.0 37.0 37.0 8 36.0145 37.0 37.0 37.0 37.0 37.0 9 35.78 37.0 37.0 37.0 37.0 37.0 10-14 35.658699999999996 37.0 37.0 37.0 37.0 37.0 15-19 35.639599999999994 37.0 37.0 37.0 37.0 37.0 20-24 35.4812 37.0 37.0 37.0 37.0 37.0 25-29 35.167699999999996 37.0 37.0 37.0 37.0 37.0 30-34 35.065200000000004 37.0 37.0 37.0 34.6 37.0 35-39 35.0717 37.0 37.0 37.0 37.0 37.0 40-44 34.970099999999995 37.0 37.0 37.0 32.2 37.0 45-49 34.903200000000005 37.0 37.0 37.0 29.8 37.0 50-54 34.8551 37.0 37.0 37.0 29.8 37.0 55-59 34.6776 37.0 37.0 37.0 25.0 37.0 60-64 34.7476 37.0 37.0 37.0 25.0 37.0 65-69 34.744800000000005 37.0 37.0 37.0 25.0 37.0 70-74 34.701100000000004 37.0 37.0 37.0 25.0 37.0 75-79 34.752500000000005 37.0 37.0 37.0 25.0 37.0 80-84 34.6317 37.0 37.0 37.0 25.0 37.0 85-89 34.707100000000004 37.0 37.0 37.0 25.0 37.0 90-94 34.8293 37.0 37.0 37.0 27.4 37.0 95-99 35.058400000000006 37.0 37.0 37.0 29.8 37.0 100-104 35.0749 37.0 37.0 37.0 27.4 37.0 105-109 35.158699999999996 37.0 37.0 37.0 27.4 37.0 110-114 35.2045 37.0 37.0 37.0 29.8 37.0 115-119 35.214800000000004 37.0 37.0 37.0 29.8 37.0 120-124 35.2327 37.0 37.0 37.0 34.6 37.0 125-129 34.6688 37.0 37.0 37.0 25.0 37.0 130-134 35.0565 37.0 37.0 37.0 27.4 37.0 135-139 34.7649 37.0 37.0 37.0 25.0 37.0 140-144 34.756299999999996 37.0 37.0 37.0 25.0 37.0 145-149 34.741 37.0 37.0 37.0 25.0 37.0 150-151 34.33525 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 3.0 14 11.0 15 11.0 16 5.0 17 5.0 18 3.0 19 14.0 20 17.0 21 18.0 22 21.0 23 35.0 24 48.0 25 41.0 26 24.0 27 23.0 28 14.0 29 23.0 30 30.0 31 47.0 32 57.0 33 107.0 34 219.0 35 700.0 36 2297.0 37 227.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.875 18.775 14.899999999999999 25.45 2 33.1 22.0 27.900000000000002 17.0 3 25.275 27.025 29.675 18.025 4 28.65 30.375000000000004 23.400000000000002 17.575 5 31.95 30.85 21.25 15.950000000000001 6 25.8 36.125 22.1 15.975 7 25.775 19.75 37.724999999999994 16.75 8 26.724999999999998 23.799999999999997 26.6 22.875 9 26.474999999999998 25.575 27.925 20.025000000000002 10-14 28.235 26.640000000000004 25.385 19.74 15-19 28.03 26.085 26.424999999999997 19.46 20-24 26.855 27.18 26.279999999999998 19.685 25-29 27.08 26.82 26.27 19.830000000000002 30-34 25.85 26.765 27.505000000000003 19.88 35-39 26.384999999999998 26.5 27.944999999999997 19.17 40-44 25.955000000000002 26.3 28.549999999999997 19.195 45-49 24.69 26.26 29.404999999999998 19.645000000000003 50-54 25.305 26.584999999999997 29.21 18.9 55-59 25.655 26.77 28.449999999999996 19.125 60-64 26.314999999999998 26.445 27.994999999999997 19.245 65-69 25.835 27.105 27.99 19.07 70-74 24.23 27.68 29.160000000000004 18.93 75-79 24.349999999999998 28.325 28.63 18.695 80-84 25.515 26.72 29.020000000000003 18.745 85-89 26.345000000000002 26.69 28.525 18.44 90-94 26.22 26.505000000000003 28.065 19.21 95-99 27.42 27.005000000000003 27.32 18.255 100-104 27.58 26.979999999999997 27.229999999999997 18.21 105-109 28.27 26.295 27.474999999999998 17.96 110-114 27.744999999999997 26.965 27.005000000000003 18.285 115-119 29.035 26.634999999999998 26.169999999999998 18.16 120-124 28.470000000000002 27.805000000000003 26.3 17.424999999999997 125-129 29.235 26.255 26.87 17.64 130-134 30.03 26.14 26.740000000000002 17.09 135-139 29.709999999999997 26.26 27.12 16.91 140-144 30.485 25.635 26.68 17.2 145-149 31.369999999999997 24.93 26.900000000000002 16.8 150-151 29.762499999999996 26.224999999999998 27.3625 16.650000000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 1.0 5 1.0 6 0.0 7 0.5 8 1.0 9 2.0 10 2.0 11 0.5 12 0.5 13 1.5 14 1.0 15 1.0 16 2.0 17 2.0 18 1.0 19 1.5 20 2.5 21 3.5 22 3.0 23 3.0 24 4.0 25 1.5 26 1.5 27 7.0 28 11.5 29 12.5 30 14.0 31 25.5 32 32.0 33 40.0 34 55.5 35 66.5 36 87.5 37 111.0 38 133.0 39 160.5 40 188.5 41 209.5 42 222.0 43 238.5 44 250.5 45 263.0 46 256.0 47 233.0 48 210.0 49 187.5 50 162.5 51 128.0 52 107.5 53 85.5 54 62.5 55 47.0 56 38.0 57 29.5 58 23.5 59 19.5 60 14.5 61 10.5 62 9.0 63 10.0 64 7.5 65 4.0 66 6.0 67 9.0 68 6.5 69 4.5 70 5.5 71 3.5 72 3.0 73 4.0 74 3.5 75 4.5 76 6.0 77 7.5 78 9.5 79 9.0 80 9.5 81 10.0 82 6.5 83 7.5 84 8.0 85 4.5 86 6.5 87 8.0 88 4.0 89 5.0 90 5.0 91 2.5 92 3.5 93 4.5 94 3.5 95 2.0 96 2.5 97 2.5 98 1.0 99 0.0 100 5.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.7 #Duplication Level Percentage of deduplicated Percentage of total 1 87.13535589264878 74.675 2 10.035005834305718 17.2 3 2.2753792298716453 5.8500000000000005 4 0.40840140023337224 1.4000000000000001 5 0.08751458576429405 0.375 6 0.029171528588098013 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.029171528588098013 0.35000000000000003 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 14 0.35000000000000003 No Hit TCACAGGAAAGGCTCCAACACATACGCAATTGAATGATGAGGGTGTAGAC 6 0.15 No Hit ACACATCCAATGATCCAAGAGCTCTGGCTGTTGCTTGCTTTGATCTCTCG 5 0.125 No Hit TGATAAACGCCACCCACCCTCAGCATCAATTCCAATTGTCTTTGCTTTCG 5 0.125 No Hit CGAATGCAAAACTTGTAACCGGAGTTTCCCATCTTTCCAAGCATTAGGCG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.0625 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.125 0.0 0.0 0.0 0.0 64-65 0.15 0.0 0.0 0.0 0.0 66-67 0.16249999999999998 0.0 0.0 0.0 0.0 68-69 0.21250000000000002 0.0 0.0 0.0 0.0 70-71 0.3125 0.0 0.0 0.0 0.0 72-73 0.35 0.0 0.0 0.0 0.0 74-75 0.3875 0.0 0.0 0.0 0.0 76-77 0.44999999999999996 0.0 0.0 0.0 0.0 78-79 0.5875 0.0 0.0 0.0 0.0 80-81 0.675 0.0 0.0 0.0 0.0 82-83 0.7375 0.0 0.0 0.0 0.0 84-85 0.8875 0.0 0.0 0.0 0.0 86-87 1.1125 0.0 0.0 0.0 0.0 88-89 1.2999999999999998 0.0 0.0 0.0 0.0 90-91 1.5375 0.0 0.0 0.0 0.0 92-93 1.875 0.0 0.0 0.0 0.0 94-95 2.1500000000000004 0.0 0.0 0.0 0.0 96-97 2.75 0.0 0.0 0.0 0.0 98-99 3.2375 0.0 0.0 0.0 0.0 100-101 3.5375 0.0 0.0 0.0 0.0 102-103 4.1 0.0 0.0 0.0 0.0 104-105 4.4125 0.0 0.0 0.0 0.0 106-107 5.012499999999999 0.0 0.0 0.0 0.0 108-109 5.6 0.0 0.0 0.0 0.0 110-111 6.4625 0.0 0.0 0.0 0.0 112-113 7.0 0.0 0.0 0.0 0.0 114-115 7.5875 0.0 0.0 0.0 0.0 116-117 8.2 0.0 0.0 0.0 0.0 118-119 8.925 0.0 0.0 0.0 0.0 120-121 9.6875 0.0 0.0 0.0 0.0 122-123 10.475 0.0 0.0 0.0 0.0 124-125 11.1375 0.0 0.0 0.0 0.0 126-127 11.675 0.0 0.0 0.0 0.0 128-129 12.6125 0.0 0.0 0.0 0.0 130-131 13.575 0.0 0.0 0.0 0.0 132-133 14.3125 0.0 0.0 0.0 0.0 134-135 15.225 0.0 0.0 0.0 0.0 136-137 16.174999999999997 0.0 0.0 0.0 0.0 138-139 16.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAATCAA 10 0.006830828 145.0 145 GTAGGGA 55 0.0025160722 15.818182 135-139 GTCGTGT 60 0.004491891 14.500001 130-134 GAAAGAG 65 0.0076375785 13.384615 140-144 >>END_MODULE Read 1695723 spots for SRR28623295.sra Written 1695723 spots for SRR28623295.sra Read 1695723 spots for SRR28623295.sra Written 1695723 spots for SRR28623295.sra Read 1695723 spots for SRR28623295.sra Written 1695723 spots for SRR28623295.sra Read 1695723 spots for SRR28623295.sra Written 1695723 spots for SRR28623295.sra Read 1695723 spots for SRR28623295.sra Written 1695723 spots for SRR28623295.sra Read 1695723 spots for SRR28623295.sra Written 1695723 spots for SRR28623295.sra Read 1695723 spots for SRR28623295.sra Written 1695723 spots for SRR28623295.sra Read 1695723 spots for SRR28623295.sra Written 1695723 spots for SRR28623295.sra Read 1695723 spots for SRR28623295.sra Written 1695723 spots for SRR28623295.sra Read 1695723 spots for SRR28623295.sra Written 1695723 spots for SRR28623295.sra Read 1695723 spots for SRR28623295.sra Written 1695723 spots for SRR28623295.sra Read 1695723 spots for SRR28623295.sra Written 1695723 spots for SRR28623295.sra Read 1695733 spots for SRR28623295.sra Written 1695733 spots for SRR28623295.sra Read 1695723 spots for SRR28623295.sra Written 1695723 spots for SRR28623295.sra Read 1695723 spots for SRR28623295.sra Written 1695723 spots for SRR28623295.sra Read 1695723 spots for SRR28623295.sra Written 1695723 spots for SRR28623295.sra Read 1695723 spots for SRR28623295.sra Written 1695723 spots for SRR28623295.sra Read 1695723 spots for SRR28623295.sra Written 1695723 spots for SRR28623295.sra Read 1695723 spots for SRR28623295.sra Written 1695723 spots for SRR28623295.sra Read 1695723 spots for SRR28623295.sra Written 1695723 spots for SRR28623295.sra SRR ids: ['SRR28623295.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_nmaf2d56 SRR28623295.sra spots: 33914470 blocks: [[1, 1695723], [1695724, 3391446], [3391447, 5087169], [5087170, 6782892], [6782893, 8478615], [8478616, 10174338], [10174339, 11870061], [11870062, 13565784], [13565785, 15261507], [15261508, 16957230], [16957231, 18652953], [18652954, 20348676], [20348677, 22044399], [22044400, 23740122], [23740123, 25435845], [25435846, 27131568], [27131569, 28827291], [28827292, 30523014], [30523015, 32218737], [32218738, 33914470]] SRR28623295 file size 12523736 SRR28623295 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR28623295 SRR28623295_1.fastq SRR28623295_2.fastq Input file: SRR28623295_1.fastq Paired file: SRR28623295_2.fastq trimmed: SRR28623295-trimmed-pair1.fastq, SRR28623295-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 14:45:16 2025 >> started Tue Feb 11 14:45:57 2025 >> done (40.615s) 33914470 read pairs processed; of these: 49 ( 0.00%) short read pairs filtered out after trimming by size control 1502894 ( 4.43%) empty read pairs filtered out after trimming by size control 32411527 (95.57%) read pairs available; of these: 7449788 (22.98%) trimmed read pairs available after processing 24961739 (77.02%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 3 0.00% 20 3 0.00% 21 6 0.00% 22 1 0.00% 23 12 0.00% 24 7 0.00% 25 10 0.00% 26 8 0.00% 27 17 0.00% 28 17 0.00% 29 16 0.00% 30 19 0.00% 31 15 0.00% 32 29 0.00% 33 24 0.00% 34 33 0.00% 35 42 0.00% 36 41 0.00% 37 77 0.00% 38 141 0.00% 39 76 0.00% 40 144 0.00% 41 123 0.00% 42 135 0.00% 43 120 0.00% 44 156 0.00% 45 154 0.00% 46 170 0.00% 47 245 0.00% 48 278 0.00% 49 331 0.00% 50 458 0.00% 51 449 0.00% 52 699 0.00% 53 635 0.00% 54 741 0.00% 55 841 0.00% 56 940 0.00% 57 1099 0.00% 58 1317 0.00% 59 1570 0.00% 60 1813 0.01% 61 2126 0.01% 62 2348 0.01% 63 2953 0.01% 64 3389 0.01% 65 3414 0.01% 66 3723 0.01% 67 4201 0.01% 68 4841 0.01% 69 5558 0.02% 70 6627 0.02% 71 7641 0.02% 72 8871 0.03% 73 10196 0.03% 74 11401 0.04% 75 12527 0.04% 76 13976 0.04% 77 15365 0.05% 78 17123 0.05% 79 18798 0.06% 80 20939 0.06% 81 23319 0.07% 82 26243 0.08% 83 28963 0.09% 84 31892 0.10% 85 34501 0.11% 86 37224 0.11% 87 39306 0.12% 88 41270 0.13% 89 43354 0.13% 90 46578 0.14% 91 49470 0.15% 92 53573 0.17% 93 57477 0.18% 94 61424 0.19% 95 64855 0.20% 96 67502 0.21% 97 70207 0.22% 98 71554 0.22% 99 74198 0.23% 100 76588 0.24% 101 80123 0.25% 102 82973 0.26% 103 86532 0.27% 104 89921 0.28% 105 92780 0.29% 106 95583 0.29% 107 97042 0.30% 108 98941 0.31% 109 100150 0.31% 110 101412 0.31% 111 103517 0.32% 112 107136 0.33% 113 109186 0.34% 114 113144 0.35% 115 116411 0.36% 116 117911 0.36% 117 119751 0.37% 118 121743 0.38% 119 120371 0.37% 120 121770 0.38% 121 123352 0.38% 122 124293 0.38% 123 126585 0.39% 124 129320 0.40% 125 131605 0.41% 126 134151 0.41% 127 135423 0.42% 128 136329 0.42% 129 134884 0.42% 130 136994 0.42% 131 136177 0.42% 132 136238 0.42% 133 138528 0.43% 134 138409 0.43% 135 139858 0.43% 136 142485 0.44% 137 143445 0.44% 138 144912 0.45% 139 144180 0.44% 140 142459 0.44% 141 144089 0.44% 142 144118 0.44% 143 145120 0.45% 144 146187 0.45% 145 146437 0.45% 146 147252 0.45% 147 147537 0.46% 148 149133 0.46% 149 147563 0.46% 150 147794 0.46% 151 24961739 77.02% 32411527 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=16.40 fanout-score-rank=13 prefix-density=0.17 prefix-fanout=16.4 sequence=GGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGGTTGTTATCTCGTATGCCGTCTTCTGCTTGAAAA criterion=fanout-score sequence-density=0.03 sequence-density-rank=33 fanout-score=426.74 fanout-score-rank=1 prefix-density=0.44 prefix-fanout=26.3 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTTGTCCCAGTAACTGGGATCAGCCTTGCACTTCTCAAAGAAGTCAACAAGG criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=4.50 fanout-score-rank=21 prefix-density=0.23 prefix-fanout=3.3 sequence=GTTGTCAAGCCCCTCAAATGGGAGAAGCC criterion=fanout-score sequence-density=0.04 sequence-density-rank=30 fanout-score=51.34 fanout-score-rank=1 prefix-density=0.48 prefix-fanout=4.2 sequence=TCTTGAAGAATTGCTATGACGCCTTGCCGGAAAACGGCAAGGTGATACTTGTTGAGTGCATTCTTCCCGTGGCTCCTGACACAAGCCTTGCCACCAAGGGAGTCGTGCACATTGATGTTATCATGCTGGCGCACAACCCCGGTGGGAAAGAGAGGACCGAAAAGGAATTTGAGGGCTTAGCAAAGGGAGCTGGCTTTCAAGGTTTTGAAGTAATGTGCTGTGCATTCAACACACATGTCATTGAATTCCGCAAGAACTAAGGCTCAAGTCCAAGCTCCAAGTGACTTGGGGTTTTCCATACAACGTTGCTGCTGTCTCTGCTTTTGATGTTGTGATTGCTTTTTTATACGAGGAGTAGCTATCTCTTATGAAACATATAA SRR28623295 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 14:47:08 Started mapping on | Feb 11 14:47:08 Finished on | Feb 11 14:50:02 Mapping speed, Million of reads per hour | 670.58 Number of input reads | 32411527 Average input read length | 288 UNIQUE READS: Uniquely mapped reads number | 29859633 Uniquely mapped reads % | 92.13% Average mapped length | 286.50 Number of splices: Total | 20365965 Number of splices: Annotated (sjdb) | 19834504 Number of splices: GT/AG | 20004718 Number of splices: GC/AG | 260625 Number of splices: AT/AC | 21990 Number of splices: Non-canonical | 78632 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.05% Deletion average length | 2.84 Insertion rate per base | 0.03% Insertion average length | 2.21 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 705164 % of reads mapped to multiple loci | 2.18% Number of reads mapped to too many loci | 689822 % of reads mapped to too many loci | 2.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.96% % of reads unmapped: other | 0.61% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1846730 1846730 1846730 N_multimapping 705164 705164 705164 N_noFeature 1195361 29404008 1386340 N_ambiguous 392351 3787 124910 UnstrandedReadsAssigned:28271921 PositiveStrandReadsAssigned:451838 NegativeStrandReadsAssigned:28348383 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=143 echo kmer=139 SRR28623295 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR28623295-trimmed-pair1.fastq SRR28623295-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 32,411,527 reads, 29,315,697 reads pseudoaligned [quant] estimated average fragment length: 205.008 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,166 rounds 52401 SRR28623295.ke.tsv 34699 SRR28623295.se.tsv 87100 total ==> SRR28623295.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1813.99 782 14.7786 Potri.005G024800.1.v4.1 1035 830.992 237 9.77715 Potri.004G059700.1.v4.1 961 757.008 60 2.71714 Potri.007G009000.2.v4.1 1416 1211.99 0 0 Potri.003G141000.2.v4.1 2943 2738.99 317.19 3.97 Potri.016G087400.1.v4.1 270 104.357 3067.79 1007.78 Potri.015G069301.1.v4.1 564 363.653 0 0 Potri.010G195200.1.v4.1 1773 1568.99 82 1.79165 Potri.012G127500.1.v4.1 977 772.997 5667 251.325 ==> SRR28623295.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 3892 Potri.001G233950.v4.1 4 Potri.001G122700.v4.1 652 Potri.001G212900.v4.1 7 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR28623295 completed mapping pipeline successfully