Starting /dee2/code/volunteer_pipeline.sh SRR28623296 current disk space = 3051434332160 free memory = 1579808392 SRR28623296 SRAfilesize 3f6fe741ddf8f3b588b9724c1b0cdf37 SRR28623296.sra SRR28623296.sra file validated SRR28623296 is paired end SRR28623296 is conventional basespace SRR28623296 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623296_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.50175 37.0 37.0 37.0 37.0 37.0 2 36.464 37.0 37.0 37.0 37.0 37.0 3 36.561 37.0 37.0 37.0 37.0 37.0 4 36.569 37.0 37.0 37.0 37.0 37.0 5 36.59 37.0 37.0 37.0 37.0 37.0 6 36.618 37.0 37.0 37.0 37.0 37.0 7 36.5395 37.0 37.0 37.0 37.0 37.0 8 36.541 37.0 37.0 37.0 37.0 37.0 9 36.604 37.0 37.0 37.0 37.0 37.0 10-14 36.5775 37.0 37.0 37.0 37.0 37.0 15-19 36.513400000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.5292 37.0 37.0 37.0 37.0 37.0 25-29 36.4892 37.0 37.0 37.0 37.0 37.0 30-34 36.4332 37.0 37.0 37.0 37.0 37.0 35-39 36.416700000000006 37.0 37.0 37.0 37.0 37.0 40-44 36.438700000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.3579 37.0 37.0 37.0 37.0 37.0 50-54 36.23780000000001 37.0 37.0 37.0 37.0 37.0 55-59 36.2495 37.0 37.0 37.0 37.0 37.0 60-64 36.291 37.0 37.0 37.0 37.0 37.0 65-69 36.201499999999996 37.0 37.0 37.0 37.0 37.0 70-74 36.141999999999996 37.0 37.0 37.0 37.0 37.0 75-79 36.143499999999996 37.0 37.0 37.0 37.0 37.0 80-84 36.0497 37.0 37.0 37.0 37.0 37.0 85-89 36.1004 37.0 37.0 37.0 37.0 37.0 90-94 36.0673 37.0 37.0 37.0 37.0 37.0 95-99 35.8729 37.0 37.0 37.0 37.0 37.0 100-104 35.952600000000004 37.0 37.0 37.0 37.0 37.0 105-109 35.9769 37.0 37.0 37.0 37.0 37.0 110-114 35.815099999999994 37.0 37.0 37.0 37.0 37.0 115-119 35.834900000000005 37.0 37.0 37.0 37.0 37.0 120-124 35.729499999999994 37.0 37.0 37.0 37.0 37.0 125-129 35.6977 37.0 37.0 37.0 37.0 37.0 130-134 35.789100000000005 37.0 37.0 37.0 37.0 37.0 135-139 35.6577 37.0 37.0 37.0 37.0 37.0 140-144 35.3895 37.0 37.0 37.0 37.0 37.0 145-149 35.2718 37.0 37.0 37.0 34.6 37.0 150-151 35.0265 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 0.0 22 2.0 23 4.0 24 2.0 25 4.0 26 8.0 27 10.0 28 13.0 29 19.0 30 38.0 31 40.0 32 71.0 33 89.0 34 130.0 35 395.0 36 2939.0 37 235.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.048286214660997 13.034776082061548 10.482862146609957 45.4340755566675 2 18.25 16.075 37.9 27.775 3 19.1 18.099999999999998 27.975 34.825 4 22.900000000000002 27.200000000000003 22.825 27.075 5 22.875 32.324999999999996 25.35 19.45 6 19.775000000000002 36.9 23.425 19.900000000000002 7 14.774999999999999 27.275 40.625 17.325 8 17.974999999999998 27.6 31.175000000000004 23.25 9 18.3 23.7 35.425000000000004 22.575 10-14 19.175 29.705 27.685 23.435 15-19 19.435 28.810000000000002 27.834999999999997 23.919999999999998 20-24 19.115 29.435 28.155 23.294999999999998 25-29 19.41 29.304999999999996 27.034999999999997 24.25 30-34 19.965 28.849999999999998 27.705000000000002 23.48 35-39 19.34 28.79 27.994999999999997 23.875 40-44 19.785 29.455 27.205000000000002 23.555 45-49 19.384999999999998 29.17 28.07 23.375 50-54 20.335 28.455000000000002 27.49 23.72 55-59 20.05 28.360000000000003 27.810000000000002 23.78 60-64 19.78 29.14 27.37 23.71 65-69 20.61 28.794999999999998 27.48 23.115 70-74 19.775000000000002 28.895 27.96 23.369999999999997 75-79 19.825 28.4 27.575 24.2 80-84 21.0 28.46 27.49 23.05 85-89 19.695 28.98 27.485 23.84 90-94 20.495 28.09 27.665 23.75 95-99 20.915 28.410000000000004 27.04 23.635 100-104 20.615 29.26 27.27 22.855 105-109 20.419999999999998 28.71 27.400000000000002 23.47 110-114 20.66 28.225 28.025 23.09 115-119 21.52 28.89 26.340000000000003 23.25 120-124 21.0 29.325000000000003 26.240000000000002 23.435 125-129 21.575 28.535 26.474999999999998 23.415 130-134 21.22 29.26 26.090000000000003 23.43 135-139 21.025 29.005 26.064999999999998 23.905 140-144 20.955 28.689999999999998 26.645000000000003 23.71 145-149 21.195 28.7 26.125 23.98 150-151 21.0125 29.9 26.187500000000004 22.900000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 0.5 21 1.0 22 1.0 23 1.5 24 2.0 25 2.0 26 4.0 27 9.0 28 17.5 29 22.0 30 18.5 31 18.5 32 35.5 33 47.5 34 61.0 35 84.5 36 95.5 37 113.0 38 134.5 39 165.5 40 201.5 41 227.5 42 247.0 43 261.0 44 279.5 45 276.0 46 260.5 47 237.0 48 210.5 49 187.5 50 157.5 51 145.0 52 110.5 53 77.0 54 67.5 55 53.0 56 34.0 57 27.0 58 27.5 59 18.0 60 16.0 61 11.0 62 6.0 63 6.0 64 5.0 65 3.5 66 1.5 67 1.0 68 1.5 69 0.5 70 0.0 71 0.5 72 1.5 73 2.0 74 1.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 85.8228588132125 73.4 2 11.98479976615025 20.5 3 1.7831043554516222 4.575 4 0.3215434083601286 1.0999999999999999 5 0.029231218941829874 0.125 6 0.05846243788365975 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCTTCATCACTTGAAAAGTCCTTCGGTATATTGAGGTTGGCCATCTTCTC 6 0.15 No Hit CGGCATGCAATGTCTACAACTTCAACTCCTTTTAATTCTTCTACTGAACA 6 0.15 No Hit GTCCATGATCATACGGCTTGCACAGGCAGGCAAAAACTTGGCATGAAATT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.025 0.0 0.0 0.0 44-45 0.0 0.05 0.0 0.0 0.0 46-47 0.0 0.05 0.0 0.0 0.0 48-49 0.0 0.05 0.0 0.0 0.0 50-51 0.0 0.05 0.0 0.0 0.0 52-53 0.0 0.05 0.0 0.0 0.0 54-55 0.0 0.05 0.0 0.0 0.0 56-57 0.0 0.05 0.0 0.0 0.0 58-59 0.0 0.05 0.0 0.0 0.0 60-61 0.0 0.05 0.0 0.0 0.0 62-63 0.0 0.05 0.0 0.0 0.0 64-65 0.0 0.05 0.0 0.0 0.0 66-67 0.0 0.05 0.0 0.0 0.0 68-69 0.0 0.05 0.0 0.0 0.0 70-71 0.05 0.05 0.0 0.0 0.0 72-73 0.0625 0.05 0.0 0.0 0.0 74-75 0.075 0.05 0.0 0.0 0.0 76-77 0.075 0.05 0.0 0.0 0.0 78-79 0.1 0.05 0.0 0.0 0.0 80-81 0.1 0.05 0.0 0.0 0.0 82-83 0.1 0.05 0.0 0.0 0.0 84-85 0.16249999999999998 0.05 0.0 0.0 0.0 86-87 0.2 0.05 0.0 0.0 0.0 88-89 0.225 0.05 0.0 0.0 0.0 90-91 0.35 0.05 0.0 0.0 0.0 92-93 0.575 0.05 0.0 0.0 0.0 94-95 0.8 0.05 0.0 0.0 0.0 96-97 0.9 0.05 0.0 0.0 0.0 98-99 1.1625 0.05 0.0 0.0 0.0 100-101 1.4375 0.05 0.0 0.0 0.0 102-103 1.725 0.05 0.0 0.0 0.0 104-105 2.1 0.05 0.0 0.0 0.0 106-107 2.45 0.05 0.0 0.0 0.0 108-109 2.8625 0.05 0.0 0.0 0.0 110-111 3.4 0.05 0.0 0.0 0.0 112-113 3.9749999999999996 0.05 0.0 0.0 0.0 114-115 4.425000000000001 0.05 0.0 0.0 0.0 116-117 4.8375 0.05 0.0 0.0 0.0 118-119 5.1125 0.05 0.0 0.0 0.0 120-121 5.6625 0.05 0.0 0.0 0.0 122-123 6.0625 0.05 0.0 0.0 0.0 124-125 6.65 0.05 0.0 0.0 0.0 126-127 7.1875 0.05 0.0 0.0 0.0 128-129 7.7 0.05 0.0 0.0 0.0 130-131 8.45 0.05 0.0 0.0 0.0 132-133 8.9375 0.05 0.0 0.0 0.0 134-135 9.7375 0.05 0.0 0.0 0.0 136-137 10.2 0.05 0.0 0.0 0.0 138-139 11.0 0.05 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCCATGA 10 0.006830828 145.0 145 CTGGAGA 10 0.006830828 145.0 2 >>END_MODULE SRR28623296 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623296_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.8955 37.0 37.0 37.0 37.0 37.0 2 36.26 37.0 37.0 37.0 37.0 37.0 3 36.189 37.0 37.0 37.0 37.0 37.0 4 36.2435 37.0 37.0 37.0 37.0 37.0 5 36.2955 37.0 37.0 37.0 37.0 37.0 6 36.3245 37.0 37.0 37.0 37.0 37.0 7 36.2315 37.0 37.0 37.0 37.0 37.0 8 36.171 37.0 37.0 37.0 37.0 37.0 9 36.1725 37.0 37.0 37.0 37.0 37.0 10-14 36.131899999999995 37.0 37.0 37.0 37.0 37.0 15-19 36.126999999999995 37.0 37.0 37.0 37.0 37.0 20-24 36.190599999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.1091 37.0 37.0 37.0 37.0 37.0 30-34 36.041999999999994 37.0 37.0 37.0 37.0 37.0 35-39 36.027499999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.0304 37.0 37.0 37.0 37.0 37.0 45-49 35.951 37.0 37.0 37.0 37.0 37.0 50-54 35.9844 37.0 37.0 37.0 37.0 37.0 55-59 35.8665 37.0 37.0 37.0 37.0 37.0 60-64 35.82809999999999 37.0 37.0 37.0 37.0 37.0 65-69 35.8595 37.0 37.0 37.0 37.0 37.0 70-74 35.845600000000005 37.0 37.0 37.0 37.0 37.0 75-79 35.9033 37.0 37.0 37.0 37.0 37.0 80-84 35.763999999999996 37.0 37.0 37.0 37.0 37.0 85-89 35.6895 37.0 37.0 37.0 37.0 37.0 90-94 35.7322 37.0 37.0 37.0 37.0 37.0 95-99 35.6761 37.0 37.0 37.0 37.0 37.0 100-104 35.5643 37.0 37.0 37.0 37.0 37.0 105-109 35.546099999999996 37.0 37.0 37.0 37.0 37.0 110-114 35.5522 37.0 37.0 37.0 37.0 37.0 115-119 35.5319 37.0 37.0 37.0 37.0 37.0 120-124 35.5869 37.0 37.0 37.0 37.0 37.0 125-129 35.0887 37.0 37.0 37.0 32.2 37.0 130-134 35.276700000000005 37.0 37.0 37.0 32.2 37.0 135-139 35.1167 37.0 37.0 37.0 25.0 37.0 140-144 35.2204 37.0 37.0 37.0 32.2 37.0 145-149 35.18220000000001 37.0 37.0 37.0 32.2 37.0 150-151 34.656000000000006 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 1.0 14 4.0 15 2.0 16 2.0 17 2.0 18 2.0 19 0.0 20 4.0 21 6.0 22 2.0 23 11.0 24 9.0 25 7.0 26 11.0 27 17.0 28 22.0 29 18.0 30 34.0 31 35.0 32 63.0 33 121.0 34 194.0 35 636.0 36 2538.0 37 257.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.5 19.075 15.225 29.2 2 26.900000000000002 25.224999999999998 32.275 15.6 3 20.724999999999998 27.900000000000002 31.474999999999998 19.900000000000002 4 25.35 31.900000000000002 24.75 18.0 5 24.85 35.975 22.475 16.7 6 19.875 37.95 24.125 18.05 7 21.8 21.8 37.2 19.2 8 22.825 25.424999999999997 27.700000000000003 24.05 9 21.275 24.825 30.725 23.175 10-14 24.085 28.74 26.340000000000003 20.835 15-19 23.544999999999998 27.295 28.470000000000002 20.69 20-24 22.97 28.535 27.665 20.830000000000002 25-29 24.09 27.805000000000003 27.650000000000002 20.455000000000002 30-34 22.405 28.92 27.92 20.755000000000003 35-39 22.770000000000003 28.835 27.35 21.044999999999998 40-44 23.09 28.57 27.889999999999997 20.45 45-49 22.75 27.72 28.994999999999997 20.535 50-54 23.26 28.09 28.54 20.11 55-59 22.955000000000002 27.96 28.82 20.265 60-64 23.035 28.345 28.044999999999998 20.575 65-69 22.695 27.985 28.62 20.7 70-74 23.395 27.965 27.944999999999997 20.695 75-79 23.150000000000002 28.389999999999997 28.27 20.19 80-84 23.89 28.310000000000002 28.105000000000004 19.695 85-89 23.925 28.13 28.139999999999997 19.805 90-94 24.03 28.15 27.73 20.09 95-99 23.3 28.255000000000003 28.075 20.369999999999997 100-104 24.275 27.515 28.455000000000002 19.755 105-109 23.880000000000003 28.455000000000002 27.915 19.75 110-114 24.19 28.655 27.255000000000003 19.900000000000002 115-119 24.785 28.000000000000004 27.900000000000002 19.314999999999998 120-124 24.81 27.35 28.1 19.74 125-129 25.235000000000003 27.875 27.295 19.595000000000002 130-134 24.59 28.549999999999997 27.345000000000002 19.515 135-139 25.605 28.494999999999997 26.515 19.384999999999998 140-144 25.729999999999997 28.875 26.69 18.705 145-149 25.919999999999998 28.395 26.590000000000003 19.095000000000002 150-151 25.95 28.449999999999996 26.8375 18.7625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.5 10 0.5 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 2.5 19 2.5 20 0.5 21 0.0 22 2.0 23 2.5 24 3.5 25 5.5 26 8.0 27 13.5 28 13.0 29 11.5 30 20.0 31 24.0 32 29.0 33 33.5 34 41.5 35 64.5 36 95.5 37 121.0 38 133.0 39 160.5 40 206.0 41 247.0 42 263.0 43 267.5 44 280.5 45 275.5 46 265.0 47 248.0 48 226.5 49 193.0 50 162.0 51 135.5 52 104.5 53 89.0 54 64.5 55 48.0 56 31.5 57 15.5 58 15.0 59 16.5 60 10.5 61 5.5 62 7.0 63 7.0 64 3.5 65 2.0 66 2.0 67 1.0 68 0.5 69 0.5 70 1.5 71 1.5 72 0.5 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.5 90 0.5 91 0.0 92 0.5 93 1.0 94 0.5 95 0.5 96 1.0 97 0.5 98 0.5 99 0.5 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 86.1 #Duplication Level Percentage of deduplicated Percentage of total 1 86.58536585365853 74.55000000000001 2 11.207897793263646 19.3 3 1.8292682926829267 4.725 4 0.29036004645760743 1.0 5 0.029036004645760744 0.125 6 0.05807200929152149 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATTTAGGAATGAGGGTATTGATTTGACACATAATCCAGAGTTCACAACTT 6 0.15 No Hit GGGGTTATCTGGCTGATGGTAGGTTAGGAAAGATGGGTGGTCTTGTTGAG 6 0.15 No Hit GAGAGAAAAGGAGTGAGATATTCAAGAGAAATACGTTTAGAAATCAAGAG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.575 0.0 0.0 0.0 0.0 94-95 0.8 0.0 0.0 0.0 0.0 96-97 0.9 0.0 0.0 0.0 0.0 98-99 1.1625 0.0 0.0 0.0 0.0 100-101 1.425 0.0 0.0 0.0 0.0 102-103 1.7000000000000002 0.0 0.0 0.0 0.0 104-105 2.05 0.0 0.0 0.0 0.0 106-107 2.4 0.0 0.0 0.0 0.0 108-109 2.8125 0.0 0.0 0.0 0.0 110-111 3.35 0.0 0.0 0.0 0.0 112-113 3.9000000000000004 0.0 0.0 0.0 0.0 114-115 4.3375 0.0 0.0 0.0 0.0 116-117 4.75 0.0 0.0 0.0 0.0 118-119 5.0125 0.0 0.0 0.0 0.0 120-121 5.625 0.0 0.0 0.0 0.0 122-123 6.025 0.0 0.0 0.0 0.0 124-125 6.5625 0.0 0.0 0.0 0.0 126-127 7.1 0.0 0.0 0.0 0.0 128-129 7.6 0.0 0.0 0.0 0.0 130-131 8.325 0.0 0.0 0.0 0.0 132-133 8.8125 0.0 0.0 0.0 0.0 134-135 9.587499999999999 0.0 0.0 0.0 0.0 136-137 10.0625 0.0 0.0 0.0 0.0 138-139 10.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGAATCA 10 0.006830828 145.0 3 >>END_MODULE Read 988398 spots for SRR28623296.sra Written 988398 spots for SRR28623296.sra Read 988398 spots for SRR28623296.sra Written 988398 spots for SRR28623296.sra Read 988398 spots for SRR28623296.sra Written 988398 spots for SRR28623296.sra Read 988398 spots for SRR28623296.sra Written 988398 spots for SRR28623296.sra Read 988398 spots for SRR28623296.sra Written 988398 spots for SRR28623296.sra Read 988398 spots for SRR28623296.sra Written 988398 spots for SRR28623296.sra Read 988398 spots for SRR28623296.sra Written 988398 spots for SRR28623296.sra Read 988398 spots for SRR28623296.sra Written 988398 spots for SRR28623296.sra Read 988398 spots for SRR28623296.sra Written 988398 spots for SRR28623296.sra Read 988398 spots for SRR28623296.sra Written 988398 spots for SRR28623296.sra Read 988398 spots for SRR28623296.sra Written 988398 spots for SRR28623296.sra Read 988398 spots for SRR28623296.sra Written 988398 spots for SRR28623296.sra Read 988406 spots for SRR28623296.sra Written 988406 spots for SRR28623296.sra Read 988398 spots for SRR28623296.sra Written 988398 spots for SRR28623296.sra Read 988398 spots for SRR28623296.sra Written 988398 spots for SRR28623296.sra Read 988398 spots for SRR28623296.sra Written 988398 spots for SRR28623296.sra Read 988398 spots for SRR28623296.sra Written 988398 spots for SRR28623296.sra Read 988398 spots for SRR28623296.sra Written 988398 spots for SRR28623296.sra Read 988398 spots for SRR28623296.sra Written 988398 spots for SRR28623296.sra Read 988398 spots for SRR28623296.sra Written 988398 spots for SRR28623296.sra SRR ids: ['SRR28623296.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_lkz97_o7 SRR28623296.sra spots: 19767968 blocks: [[1, 988398], [988399, 1976796], [1976797, 2965194], [2965195, 3953592], [3953593, 4941990], [4941991, 5930388], [5930389, 6918786], [6918787, 7907184], [7907185, 8895582], [8895583, 9883980], [9883981, 10872378], [10872379, 11860776], [11860777, 12849174], [12849175, 13837572], [13837573, 14825970], [14825971, 15814368], [15814369, 16802766], [16802767, 17791164], [17791165, 18779562], [18779563, 19767968]] SRR28623296 file size 7295305 SRR28623296 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR28623296 SRR28623296_1.fastq SRR28623296_2.fastq Input file: SRR28623296_1.fastq Paired file: SRR28623296_2.fastq trimmed: SRR28623296-trimmed-pair1.fastq, SRR28623296-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 17:43:50 2025 >> started Tue Feb 11 17:44:13 2025 >> done (22.203s) 19767968 read pairs processed; of these: 24 ( 0.00%) short read pairs filtered out after trimming by size control 33867 ( 0.17%) empty read pairs filtered out after trimming by size control 19734077 (99.83%) read pairs available; of these: 2920902 (14.80%) trimmed read pairs available after processing 16813175 (85.20%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 4 0.00% 20 2 0.00% 21 4 0.00% 22 8 0.00% 23 4 0.00% 24 3 0.00% 25 7 0.00% 26 8 0.00% 27 10 0.00% 28 10 0.00% 29 13 0.00% 30 10 0.00% 31 13 0.00% 32 12 0.00% 33 35 0.00% 34 26 0.00% 35 22 0.00% 36 21 0.00% 37 31 0.00% 38 43 0.00% 39 47 0.00% 40 48 0.00% 41 42 0.00% 42 56 0.00% 43 51 0.00% 44 65 0.00% 45 57 0.00% 46 92 0.00% 47 120 0.00% 48 121 0.00% 49 136 0.00% 50 153 0.00% 51 192 0.00% 52 202 0.00% 53 209 0.00% 54 212 0.00% 55 228 0.00% 56 272 0.00% 57 342 0.00% 58 387 0.00% 59 427 0.00% 60 503 0.00% 61 556 0.00% 62 608 0.00% 63 748 0.00% 64 861 0.00% 65 876 0.00% 66 1048 0.01% 67 1113 0.01% 68 1312 0.01% 69 1466 0.01% 70 1737 0.01% 71 1911 0.01% 72 2152 0.01% 73 2520 0.01% 74 2869 0.01% 75 3177 0.02% 76 3581 0.02% 77 3899 0.02% 78 4312 0.02% 79 4887 0.02% 80 5338 0.03% 81 5991 0.03% 82 6770 0.03% 83 7498 0.04% 84 8501 0.04% 85 9205 0.05% 86 9980 0.05% 87 10615 0.05% 88 11619 0.06% 89 12374 0.06% 90 13451 0.07% 91 14370 0.07% 92 15968 0.08% 93 17264 0.09% 94 18160 0.09% 95 19277 0.10% 96 20071 0.10% 97 21638 0.11% 98 22702 0.12% 99 23781 0.12% 100 24914 0.13% 101 25834 0.13% 102 27528 0.14% 103 28614 0.14% 104 29892 0.15% 105 30721 0.16% 106 32810 0.17% 107 33684 0.17% 108 34630 0.18% 109 35713 0.18% 110 36460 0.18% 111 37560 0.19% 112 39313 0.20% 113 40357 0.20% 114 41357 0.21% 115 42793 0.22% 116 43823 0.22% 117 45097 0.23% 118 45856 0.23% 119 46665 0.24% 120 47756 0.24% 121 48762 0.25% 122 49389 0.25% 123 50436 0.26% 124 52865 0.27% 125 52668 0.27% 126 54041 0.27% 127 54850 0.28% 128 55550 0.28% 129 56071 0.28% 130 57599 0.29% 131 57780 0.29% 132 58681 0.30% 133 60438 0.31% 134 60256 0.31% 135 60890 0.31% 136 62299 0.32% 137 62953 0.32% 138 62866 0.32% 139 64430 0.33% 140 65438 0.33% 141 65289 0.33% 142 66230 0.34% 143 67070 0.34% 144 67468 0.34% 145 68254 0.35% 146 68762 0.35% 147 68670 0.35% 148 69957 0.35% 149 70329 0.36% 150 70779 0.36% 151 16813175 85.20% 19734077 reads passed initial QC criterion=sequence-density sequence-density=0.10 sequence-density-rank=1 fanout-score=3.17 fanout-score-rank=35 prefix-density=0.12 prefix-fanout=2.6 sequence=TAGCAGAATATT criterion=fanout-score sequence-density=0.06 sequence-density-rank=16 fanout-score=539.65 fanout-score-rank=1 prefix-density=0.90 prefix-fanout=36.3 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=29.24 fanout-score-rank=10 prefix-density=0.19 prefix-fanout=16.2 sequence=GAGAGAGAGAGTTAAGACAATGGCCTCGAAGAAATCTGCAATCGTATTACCTGGTTCAAAGGTGTTGAAGCACATAGTTTTTGTACGGTTTAATGATGGGATCACTGATGAACAAATTGAGAA criterion=fanout-score sequence-density=0.08 sequence-density-rank=9 fanout-score=322.25 fanout-score-rank=1 prefix-density=0.84 prefix-fanout=30.2 sequence=GAAGAAGAAGAAA SRR28623296 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 17:44:58 Started mapping on | Feb 11 17:44:59 Finished on | Feb 11 17:46:54 Mapping speed, Million of reads per hour | 617.76 Number of input reads | 19734077 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 18656357 Uniquely mapped reads % | 94.54% Average mapped length | 292.63 Number of splices: Total | 17488862 Number of splices: Annotated (sjdb) | 17135068 Number of splices: GT/AG | 17189699 Number of splices: GC/AG | 232789 Number of splices: AT/AC | 16049 Number of splices: Non-canonical | 50325 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.03% Deletion average length | 2.97 Insertion rate per base | 0.03% Insertion average length | 2.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 510859 % of reads mapped to multiple loci | 2.59% Number of reads mapped to too many loci | 67391 % of reads mapped to too many loci | 0.34% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.37% % of reads unmapped: other | 0.16% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 566861 566861 566861 N_multimapping 510859 510859 510859 N_noFeature 623609 18471334 718132 N_ambiguous 186179 1329 94725 UnstrandedReadsAssigned:17846569 PositiveStrandReadsAssigned:183694 NegativeStrandReadsAssigned:17843500 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR28623296 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR28623296-trimmed-pair1.fastq SRR28623296-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,734,077 reads, 18,037,243 reads pseudoaligned [quant] estimated average fragment length: 239.301 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,064 rounds 52401 SRR28623296.ke.tsv 34699 SRR28623296.se.tsv 87100 total ==> SRR28623296.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1779.7 440 14.2379 Potri.005G024800.1.v4.1 1035 796.699 201 14.5292 Potri.004G059700.1.v4.1 961 722.736 40 3.18727 Potri.007G009000.2.v4.1 1416 1177.7 0 0 Potri.003G141000.2.v4.1 2943 2704.7 538.243 11.4604 Potri.016G087400.1.v4.1 270 93.3462 1427.22 880.505 Potri.015G069301.1.v4.1 564 334.803 0 0 Potri.010G195200.1.v4.1 1773 1534.7 37 1.38841 Potri.012G127500.1.v4.1 977 738.72 13429 1046.89 ==> SRR28623296.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 116 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 200 Potri.001G212900.v4.1 7 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 0 SRR28623296 completed mapping pipeline successfully