Starting /dee2/code/volunteer_pipeline.sh SRR28623297 current disk space = 3049412706304 free memory = 1494344508 SRR28623297 SRAfilesize a8ef73ff7e4b507cbd7b9d3bde5caacb SRR28623297.sra SRR28623297.sra file validated SRR28623297 is paired end SRR28623297 is conventional basespace SRR28623297 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623297_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.31825 37.0 37.0 37.0 37.0 37.0 2 36.514 37.0 37.0 37.0 37.0 37.0 3 36.6105 37.0 37.0 37.0 37.0 37.0 4 36.638 37.0 37.0 37.0 37.0 37.0 5 36.58 37.0 37.0 37.0 37.0 37.0 6 36.6925 37.0 37.0 37.0 37.0 37.0 7 36.588 37.0 37.0 37.0 37.0 37.0 8 36.4975 37.0 37.0 37.0 37.0 37.0 9 36.6045 37.0 37.0 37.0 37.0 37.0 10-14 36.5871 37.0 37.0 37.0 37.0 37.0 15-19 36.601800000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.5542 37.0 37.0 37.0 37.0 37.0 25-29 36.5194 37.0 37.0 37.0 37.0 37.0 30-34 36.4514 37.0 37.0 37.0 37.0 37.0 35-39 36.4122 37.0 37.0 37.0 37.0 37.0 40-44 36.4159 37.0 37.0 37.0 37.0 37.0 45-49 36.3853 37.0 37.0 37.0 37.0 37.0 50-54 36.3725 37.0 37.0 37.0 37.0 37.0 55-59 36.3377 37.0 37.0 37.0 37.0 37.0 60-64 36.3366 37.0 37.0 37.0 37.0 37.0 65-69 36.313300000000005 37.0 37.0 37.0 37.0 37.0 70-74 36.258300000000006 37.0 37.0 37.0 37.0 37.0 75-79 36.2057 37.0 37.0 37.0 37.0 37.0 80-84 36.1543 37.0 37.0 37.0 37.0 37.0 85-89 36.184200000000004 37.0 37.0 37.0 37.0 37.0 90-94 36.09930000000001 37.0 37.0 37.0 37.0 37.0 95-99 35.9534 37.0 37.0 37.0 37.0 37.0 100-104 36.0212 37.0 37.0 37.0 37.0 37.0 105-109 36.034800000000004 37.0 37.0 37.0 37.0 37.0 110-114 35.8424 37.0 37.0 37.0 37.0 37.0 115-119 35.8797 37.0 37.0 37.0 37.0 37.0 120-124 35.7971 37.0 37.0 37.0 37.0 37.0 125-129 35.726800000000004 37.0 37.0 37.0 37.0 37.0 130-134 35.8048 37.0 37.0 37.0 37.0 37.0 135-139 35.6767 37.0 37.0 37.0 37.0 37.0 140-144 35.3661 37.0 37.0 37.0 37.0 37.0 145-149 35.370799999999996 37.0 37.0 37.0 34.6 37.0 150-151 35.12325 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 2.0 22 1.0 23 3.0 24 2.0 25 4.0 26 6.0 27 16.0 28 9.0 29 19.0 30 27.0 31 35.0 32 54.0 33 90.0 34 139.0 35 356.0 36 2932.0 37 304.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.16570279104853 12.99974855418657 10.359567513200906 43.474981141563994 2 18.9 14.249999999999998 36.449999999999996 30.4 3 16.275000000000002 17.724999999999998 27.675 38.324999999999996 4 22.650000000000002 25.4 24.349999999999998 27.6 5 25.0 31.8 23.375 19.825 6 20.200000000000003 35.05 24.125 20.625 7 15.65 27.125 40.525 16.7 8 17.525 26.8 33.825 21.85 9 17.175 24.75 34.075 24.0 10-14 19.805 29.965000000000003 27.105 23.125 15-19 19.505 29.12 28.025 23.35 20-24 19.64 29.665000000000003 27.245 23.45 25-29 19.73 28.93 27.85 23.49 30-34 19.35 28.71 27.68 24.26 35-39 19.125 28.96 27.685 24.23 40-44 20.419999999999998 28.849999999999998 27.55 23.18 45-49 20.330000000000002 28.265 27.555000000000003 23.849999999999998 50-54 20.105 27.644999999999996 28.749999999999996 23.5 55-59 19.97 28.525 28.28 23.225 60-64 19.605 29.515 27.125 23.755000000000003 65-69 19.869999999999997 29.020000000000003 27.355 23.755000000000003 70-74 20.155 28.83 28.43 22.585 75-79 20.255000000000003 27.095000000000002 28.4 24.25 80-84 20.14 28.51 27.965 23.385 85-89 20.315 28.42 27.66 23.605 90-94 20.54 28.535 27.375 23.549999999999997 95-99 19.785 29.160000000000004 27.584999999999997 23.47 100-104 19.84 29.080000000000002 27.334999999999997 23.745 105-109 20.275000000000002 28.15 27.765 23.810000000000002 110-114 20.39 28.435 27.54 23.635 115-119 20.78 28.970000000000002 27.089999999999996 23.16 120-124 21.16 28.825 27.015 23.0 125-129 21.095 28.694999999999997 26.995 23.215 130-134 21.55 28.04 26.645000000000003 23.765 135-139 20.715 28.050000000000004 26.955000000000002 24.279999999999998 140-144 21.095 27.875 26.495 24.535 145-149 21.32 28.54 26.39 23.75 150-151 22.125 28.9375 25.387500000000003 23.549999999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.5 22 1.5 23 1.5 24 3.5 25 5.5 26 5.0 27 4.0 28 8.5 29 15.5 30 18.0 31 25.5 32 38.0 33 44.5 34 57.5 35 80.5 36 100.0 37 121.0 38 148.0 39 179.0 40 209.5 41 230.5 42 240.0 43 260.0 44 259.5 45 240.0 46 247.5 47 233.5 48 206.5 49 188.5 50 177.5 51 159.5 52 117.5 53 86.0 54 65.0 55 54.0 56 40.5 57 26.0 58 21.0 59 17.5 60 17.0 61 12.5 62 8.5 63 5.5 64 6.5 65 5.5 66 1.5 67 0.5 68 0.5 69 0.5 70 1.0 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.575 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.3 #Duplication Level Percentage of deduplicated Percentage of total 1 86.10785463071512 73.45 2 11.283704572098475 19.25 3 2.1395076201641263 5.475 4 0.3223915592028136 1.0999999999999999 5 0.029308323563892142 0.125 6 0.11723329425556857 0.6 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCTAAAGCACAAGATATGATGGTGATGGTGGTGGTGGTGGTGTTGTTGT 6 0.15 No Hit GTCCGACTTCCCTGTCAATCTCCGCTTTCACCCTCTCTAATCTCTCTGGA 6 0.15 No Hit GCCTCCCAAGCTCCCCAACCTCAACCAAAGTAGTACAAATTGAGGATCCC 6 0.15 No Hit CTCACCATGTGTCCTTGGTTACAAATTAATTCAGACTTCAGAGCCCGCCA 6 0.15 No Hit ATAGAATACATGATGAAAAACAATAAAAATGTTAATCTCTCTCTAATTAG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.025 0.0 0.0 0.0 68-69 0.1 0.025 0.0 0.0 0.0 70-71 0.1125 0.025 0.0 0.0 0.0 72-73 0.1625 0.025 0.0 0.0 0.0 74-75 0.25 0.025 0.0 0.0 0.0 76-77 0.2625 0.025 0.0 0.0 0.0 78-79 0.3625 0.025 0.0 0.0 0.0 80-81 0.375 0.025 0.0 0.0 0.0 82-83 0.4 0.025 0.0 0.0 0.0 84-85 0.475 0.025 0.0 0.0 0.0 86-87 0.7 0.025 0.0 0.0 0.0 88-89 0.9 0.025 0.0 0.0 0.0 90-91 1.075 0.025 0.0 0.0 0.0 92-93 1.2000000000000002 0.025 0.0 0.0 0.0 94-95 1.3 0.025 0.0 0.0 0.0 96-97 1.5875 0.025 0.0 0.0 0.0 98-99 1.6875 0.025 0.0 0.0 0.0 100-101 1.8875000000000002 0.025 0.0 0.0 0.0 102-103 2.2 0.025 0.0 0.0 0.0 104-105 2.7 0.025 0.0 0.0 0.0 106-107 3.1 0.025 0.0 0.0 0.0 108-109 3.4875 0.025 0.0 0.0 0.0 110-111 3.8 0.025 0.0 0.0 0.0 112-113 4.3375 0.025 0.0 0.0 0.0 114-115 5.0 0.025 0.0 0.0 0.0 116-117 5.3 0.025 0.0 0.0 0.0 118-119 5.6875 0.025 0.0 0.0 0.0 120-121 6.2125 0.025 0.0 0.0 0.0 122-123 6.85 0.025 0.0 0.0 0.0 124-125 7.625 0.025 0.0 0.0 0.0 126-127 8.25 0.025 0.0 0.0 0.0 128-129 8.675 0.025 0.0 0.0 0.0 130-131 9.1 0.025 0.0 0.0 0.0 132-133 9.6625 0.025 0.0 0.0 0.0 134-135 10.325 0.025 0.0 0.0 0.0 136-137 10.975000000000001 0.025 0.0 0.0 0.0 138-139 11.6 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR28623297 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623297_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.6025 37.0 37.0 37.0 37.0 37.0 2 36.042 37.0 37.0 37.0 37.0 37.0 3 36.065 37.0 37.0 37.0 37.0 37.0 4 36.0675 37.0 37.0 37.0 37.0 37.0 5 36.262 37.0 37.0 37.0 37.0 37.0 6 36.094 37.0 37.0 37.0 37.0 37.0 7 36.1815 37.0 37.0 37.0 37.0 37.0 8 36.125 37.0 37.0 37.0 37.0 37.0 9 36.134 37.0 37.0 37.0 37.0 37.0 10-14 36.0558 37.0 37.0 37.0 37.0 37.0 15-19 36.0544 37.0 37.0 37.0 37.0 37.0 20-24 36.065099999999994 37.0 37.0 37.0 37.0 37.0 25-29 35.9808 37.0 37.0 37.0 37.0 37.0 30-34 35.884100000000004 37.0 37.0 37.0 37.0 37.0 35-39 35.900400000000005 37.0 37.0 37.0 37.0 37.0 40-44 35.835800000000006 37.0 37.0 37.0 37.0 37.0 45-49 35.928700000000006 37.0 37.0 37.0 37.0 37.0 50-54 35.8266 37.0 37.0 37.0 37.0 37.0 55-59 35.6732 37.0 37.0 37.0 37.0 37.0 60-64 35.745900000000006 37.0 37.0 37.0 37.0 37.0 65-69 35.78359999999999 37.0 37.0 37.0 37.0 37.0 70-74 35.7556 37.0 37.0 37.0 37.0 37.0 75-79 35.764599999999994 37.0 37.0 37.0 37.0 37.0 80-84 35.55650000000001 37.0 37.0 37.0 37.0 37.0 85-89 35.5767 37.0 37.0 37.0 37.0 37.0 90-94 35.5438 37.0 37.0 37.0 37.0 37.0 95-99 35.46810000000001 37.0 37.0 37.0 37.0 37.0 100-104 35.4427 37.0 37.0 37.0 34.6 37.0 105-109 35.27589999999999 37.0 37.0 37.0 34.6 37.0 110-114 35.381099999999996 37.0 37.0 37.0 34.6 37.0 115-119 35.2684 37.0 37.0 37.0 32.2 37.0 120-124 35.2257 37.0 37.0 37.0 34.6 37.0 125-129 34.794399999999996 37.0 37.0 37.0 27.4 37.0 130-134 35.1689 37.0 37.0 37.0 27.4 37.0 135-139 34.908500000000004 37.0 37.0 37.0 25.0 37.0 140-144 34.9423 37.0 37.0 37.0 25.0 37.0 145-149 34.874700000000004 37.0 37.0 37.0 25.0 37.0 150-151 34.64275 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 5.0 15 0.0 16 1.0 17 3.0 18 1.0 19 1.0 20 3.0 21 4.0 22 5.0 23 10.0 24 7.0 25 12.0 26 15.0 27 11.0 28 20.0 29 31.0 30 38.0 31 54.0 32 90.0 33 154.0 34 271.0 35 729.0 36 2347.0 37 187.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.85 20.599999999999998 13.600000000000001 27.950000000000003 2 25.424999999999997 28.225 30.725 15.625 3 21.975 27.125 30.9 20.0 4 24.175 34.425 23.150000000000002 18.25 5 24.875 36.9 22.525000000000002 15.7 6 19.35 41.25 22.0 17.4 7 21.575 22.45 36.6 19.375 8 23.05 26.0 27.450000000000003 23.5 9 23.0 25.324999999999996 29.425 22.25 10-14 23.599999999999998 29.69 26.13 20.580000000000002 15-19 23.925 27.825 27.750000000000004 20.5 20-24 23.265 28.015 28.53 20.19 25-29 23.915 28.439999999999998 27.54 20.105 30-34 22.95 28.615000000000002 27.944999999999997 20.49 35-39 22.535 28.345 28.215 20.905 40-44 23.189999999999998 28.544999999999998 27.98 20.285 45-49 22.994999999999997 28.73 27.96 20.315 50-54 22.38 28.025 28.59 21.005 55-59 23.07 28.1 27.735 21.095 60-64 23.0 27.76 28.435 20.805 65-69 22.91 28.115000000000002 28.59 20.385 70-74 23.84 27.93 27.779999999999998 20.45 75-79 23.080000000000002 28.34 28.560000000000002 20.02 80-84 23.189999999999998 28.449999999999996 27.46 20.9 85-89 23.674999999999997 28.139999999999997 28.155 20.03 90-94 23.555 28.349999999999998 27.685 20.41 95-99 23.135 28.88 27.715 20.27 100-104 24.224999999999998 28.185 27.025 20.565 105-109 23.965 28.04 27.355 20.64 110-114 24.505 28.345 27.455000000000002 19.695 115-119 24.375 28.025 27.389999999999997 20.21 120-124 25.019999999999996 28.205000000000002 27.279999999999998 19.495 125-129 25.295 28.194999999999997 26.99 19.52 130-134 25.83 28.735 26.525 18.91 135-139 25.495 28.194999999999997 27.075 19.235 140-144 25.945 27.845 26.915 19.295 145-149 26.25 28.315 26.700000000000003 18.735 150-151 26.825 28.287499999999998 26.224999999999998 18.6625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.5 7 0.5 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.5 14 1.0 15 1.0 16 1.5 17 1.5 18 0.5 19 0.0 20 0.5 21 1.5 22 1.0 23 2.5 24 3.5 25 4.0 26 8.0 27 10.5 28 12.5 29 13.0 30 15.5 31 18.5 32 30.0 33 47.0 34 66.5 35 82.5 36 95.0 37 131.5 38 161.5 39 173.0 40 187.0 41 215.5 42 253.0 43 273.5 44 254.0 45 248.0 46 241.0 47 216.0 48 208.5 49 207.5 50 196.0 51 150.0 52 108.0 53 86.0 54 67.5 55 45.0 56 32.0 57 29.0 58 21.0 59 14.0 60 15.0 61 11.0 62 5.5 63 4.0 64 3.0 65 4.0 66 2.0 67 0.5 68 2.5 69 3.0 70 1.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.5 90 0.5 91 0.0 92 0.5 93 0.5 94 0.5 95 0.5 96 0.0 97 0.0 98 0.0 99 0.0 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.45 #Duplication Level Percentage of deduplicated Percentage of total 1 86.19075482738442 73.65 2 11.322410766530135 19.35 3 1.989467524868344 5.1 4 0.32182562902282036 1.0999999999999999 5 0.11702750146284377 0.5 6 0.058513750731421885 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTTCACCAACTTGATGCTTTATACAAGGAGAAAAACAAGATTGATGGTC 6 0.15 No Hit GGGAAAGTCTAAAAATGCGTTGTTGTCAACTTTCTTGTTTCTTGATCAAA 6 0.15 No Hit CCCAAGAGAGGGCAAGTTAAGGTGGCAATAGTTCTGGGTCTGGCCCATAC 5 0.125 No Hit GCTGAACATGGTGGTGCTGGTGGTGGAGGAGGCAGTGGTGCTGGTGGTGG 5 0.125 No Hit GAATTCTTGCAGGGCTTGATAGAAGAGGTGAAACGAAAGGAAACAAGTTC 5 0.125 No Hit AAGAAACACTAAAAAAATCACACAAGCGAAATCTCCAGCGAGAAGAGAAA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1125 0.0 0.0 0.0 0.0 72-73 0.1625 0.0 0.0 0.0 0.0 74-75 0.25 0.0 0.0 0.0 0.0 76-77 0.2625 0.0 0.0 0.0 0.0 78-79 0.3625 0.0 0.0 0.0 0.0 80-81 0.375 0.0 0.0 0.0 0.0 82-83 0.4 0.0 0.0 0.0 0.0 84-85 0.475 0.0 0.0 0.0 0.0 86-87 0.7 0.0 0.0 0.0 0.0 88-89 0.9 0.0 0.0 0.0 0.0 90-91 1.075 0.0 0.0 0.0 0.0 92-93 1.2125 0.0 0.0 0.0 0.0 94-95 1.325 0.0 0.0 0.0 0.0 96-97 1.6 0.0 0.0 0.0 0.0 98-99 1.6875 0.0 0.0 0.0 0.0 100-101 1.8875000000000002 0.0 0.0 0.0 0.0 102-103 2.2 0.0 0.0 0.0 0.0 104-105 2.7125 0.0 0.0 0.0 0.0 106-107 3.1125 0.0 0.0 0.0 0.0 108-109 3.5 0.0 0.0 0.0 0.0 110-111 3.8875 0.0 0.0 0.0 0.0 112-113 4.45 0.0 0.0 0.0 0.0 114-115 5.075 0.0 0.0 0.0 0.0 116-117 5.362500000000001 0.0 0.0 0.0 0.0 118-119 5.75 0.0 0.0 0.0 0.0 120-121 6.3 0.0 0.0 0.0 0.0 122-123 6.9 0.0 0.0 0.0 0.0 124-125 7.6375 0.0 0.0 0.0 0.0 126-127 8.2 0.0 0.0 0.0 0.0 128-129 8.65 0.0 0.0 0.0 0.0 130-131 9.075 0.0 0.0 0.0 0.0 132-133 9.6375 0.0 0.0 0.0 0.0 134-135 10.2375 0.0 0.0 0.0 0.0 136-137 10.875 0.0 0.0 0.0 0.0 138-139 11.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTGAGTT 10 0.006830828 145.0 8 GTTGAAG 10 0.006830828 145.0 2 GCTGAGT 10 0.006830828 145.0 7 TTGAAGG 20 3.5877043E-4 108.75 3 GGGGGGG 40 0.0076550315 18.125 1 >>END_MODULE Read 1900716 spots for SRR28623297.sra Written 1900716 spots for SRR28623297.sra Read 1900716 spots for SRR28623297.sra Written 1900716 spots for SRR28623297.sra Read 1900716 spots for SRR28623297.sra Written 1900716 spots for SRR28623297.sra Read 1900716 spots for SRR28623297.sra Written 1900716 spots for SRR28623297.sra Read 1900716 spots for SRR28623297.sra Written 1900716 spots for SRR28623297.sra Read 1900716 spots for SRR28623297.sra Written 1900716 spots for SRR28623297.sra Read 1900716 spots for SRR28623297.sra Written 1900716 spots for SRR28623297.sra Read 1900716 spots for SRR28623297.sra Written 1900716 spots for SRR28623297.sra Read 1900716 spots for SRR28623297.sra Written 1900716 spots for SRR28623297.sra Read 1900716 spots for SRR28623297.sra Written 1900716 spots for SRR28623297.sra Read 1900716 spots for SRR28623297.sra Written 1900716 spots for SRR28623297.sra Read 1900716 spots for SRR28623297.sra Written 1900716 spots for SRR28623297.sra Read 1900716 spots for SRR28623297.sra Written 1900716 spots for SRR28623297.sra Read 1900716 spots for SRR28623297.sra Written 1900716 spots for SRR28623297.sra Read 1900716 spots for SRR28623297.sra Written 1900716 spots for SRR28623297.sra Read 1900730 spots for SRR28623297.sra Written 1900730 spots for SRR28623297.sra Read 1900716 spots for SRR28623297.sra Written 1900716 spots for SRR28623297.sra Read 1900716 spots for SRR28623297.sra Written 1900716 spots for SRR28623297.sra Read 1900716 spots for SRR28623297.sra Written 1900716 spots for SRR28623297.sra Read 1900716 spots for SRR28623297.sra Written 1900716 spots for SRR28623297.sra SRR ids: ['SRR28623297.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_bcn51_5c SRR28623297.sra spots: 38014334 blocks: [[1, 1900716], [1900717, 3801432], [3801433, 5702148], [5702149, 7602864], [7602865, 9503580], [9503581, 11404296], [11404297, 13305012], [13305013, 15205728], [15205729, 17106444], [17106445, 19007160], [19007161, 20907876], [20907877, 22808592], [22808593, 24709308], [24709309, 26610024], [26610025, 28510740], [28510741, 30411456], [30411457, 32312172], [32312173, 34212888], [34212889, 36113604], [36113605, 38014334]] SRR28623297 file size 14039053 SRR28623297 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR28623297 SRR28623297_1.fastq SRR28623297_2.fastq Input file: SRR28623297_1.fastq Paired file: SRR28623297_2.fastq trimmed: SRR28623297-trimmed-pair1.fastq, SRR28623297-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 16:05:21 2025 >> started Tue Feb 11 16:06:05 2025 >> done (44.081s) 38014334 read pairs processed; of these: 38 ( 0.00%) short read pairs filtered out after trimming by size control 15084 ( 0.04%) empty read pairs filtered out after trimming by size control 37999212 (99.96%) read pairs available; of these: 6033869 (15.88%) trimmed read pairs available after processing 31965343 (84.12%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 3 0.00% 20 4 0.00% 21 8 0.00% 22 10 0.00% 23 9 0.00% 24 15 0.00% 25 9 0.00% 26 16 0.00% 27 15 0.00% 28 12 0.00% 29 17 0.00% 30 26 0.00% 31 15 0.00% 32 18 0.00% 33 14 0.00% 34 30 0.00% 35 36 0.00% 36 27 0.00% 37 32 0.00% 38 52 0.00% 39 59 0.00% 40 60 0.00% 41 80 0.00% 42 86 0.00% 43 80 0.00% 44 73 0.00% 45 102 0.00% 46 128 0.00% 47 141 0.00% 48 156 0.00% 49 188 0.00% 50 260 0.00% 51 289 0.00% 52 292 0.00% 53 344 0.00% 54 384 0.00% 55 456 0.00% 56 450 0.00% 57 595 0.00% 58 632 0.00% 59 773 0.00% 60 888 0.00% 61 1004 0.00% 62 1187 0.00% 63 1402 0.00% 64 1482 0.00% 65 1711 0.00% 66 1945 0.01% 67 2248 0.01% 68 2474 0.01% 69 2841 0.01% 70 3347 0.01% 71 3906 0.01% 72 4459 0.01% 73 5113 0.01% 74 5652 0.01% 75 6559 0.02% 76 7300 0.02% 77 8141 0.02% 78 9077 0.02% 79 10201 0.03% 80 11293 0.03% 81 12417 0.03% 82 14130 0.04% 83 15534 0.04% 84 17411 0.05% 85 19115 0.05% 86 20750 0.05% 87 22556 0.06% 88 24693 0.06% 89 26534 0.07% 90 28640 0.08% 91 30588 0.08% 92 32702 0.09% 93 35217 0.09% 94 38126 0.10% 95 39998 0.11% 96 43096 0.11% 97 44754 0.12% 98 47438 0.12% 99 49454 0.13% 100 51707 0.14% 101 53712 0.14% 102 56273 0.15% 103 59023 0.16% 104 61449 0.16% 105 64530 0.17% 106 67622 0.18% 107 69338 0.18% 108 72160 0.19% 109 73569 0.19% 110 75098 0.20% 111 78422 0.21% 112 80700 0.21% 113 82275 0.22% 114 85105 0.22% 115 88388 0.23% 116 90530 0.24% 117 92395 0.24% 118 95766 0.25% 119 97225 0.26% 120 99579 0.26% 121 101326 0.27% 122 102559 0.27% 123 104864 0.28% 124 107422 0.28% 125 108989 0.29% 126 111571 0.29% 127 114147 0.30% 128 114603 0.30% 129 117320 0.31% 130 119154 0.31% 131 119553 0.31% 132 121559 0.32% 133 123710 0.33% 134 124431 0.33% 135 126313 0.33% 136 127626 0.34% 137 129891 0.34% 138 130620 0.34% 139 133169 0.35% 140 134609 0.35% 141 134987 0.36% 142 137123 0.36% 143 136882 0.36% 144 138639 0.36% 145 141389 0.37% 146 141224 0.37% 147 141612 0.37% 148 143491 0.38% 149 143148 0.38% 150 145687 0.38% 151 31965343 84.12% 37999212 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=11.16 fanout-score-rank=14 prefix-density=0.30 prefix-fanout=5.3 sequence=CTTCTTGTCAAA criterion=fanout-score sequence-density=0.06 sequence-density-rank=21 fanout-score=248.02 fanout-score-rank=1 prefix-density=0.53 prefix-fanout=29.1 sequence=TCATCTTCATCA criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=6.84 fanout-score-rank=19 prefix-density=0.22 prefix-fanout=4.7 sequence=AATGGCCACTGTTGAGGTTG criterion=fanout-score sequence-density=0.08 sequence-density-rank=13 fanout-score=360.89 fanout-score-rank=1 prefix-density=0.95 prefix-fanout=31.4 sequence=AAGAAGAAGAAA SRR28623297 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 16:06:49 Started mapping on | Feb 11 16:06:50 Finished on | Feb 11 16:10:40 Mapping speed, Million of reads per hour | 594.77 Number of input reads | 37999212 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 35845172 Uniquely mapped reads % | 94.33% Average mapped length | 292.02 Number of splices: Total | 31960874 Number of splices: Annotated (sjdb) | 31187384 Number of splices: GT/AG | 31399911 Number of splices: GC/AG | 436096 Number of splices: AT/AC | 32089 Number of splices: Non-canonical | 92778 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.03% Deletion average length | 3.06 Insertion rate per base | 0.03% Insertion average length | 2.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 918081 % of reads mapped to multiple loci | 2.42% Number of reads mapped to too many loci | 151678 % of reads mapped to too many loci | 0.40% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.71% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1235959 1235959 1235959 N_multimapping 918081 918081 918081 N_noFeature 1606779 35429677 1806671 N_ambiguous 424330 2862 206689 UnstrandedReadsAssigned:33814063 PositiveStrandReadsAssigned:412633 NegativeStrandReadsAssigned:33831812 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR28623297 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR28623297-trimmed-pair1.fastq SRR28623297-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 37,999,212 reads, 34,171,381 reads pseudoaligned [quant] estimated average fragment length: 228.746 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,211 rounds 52401 SRR28623297.ke.tsv 34699 SRR28623297.se.tsv 87100 total ==> SRR28623297.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1790.25 1458 24.3591 Potri.005G024800.1.v4.1 1035 807.254 1933 71.6209 Potri.004G059700.1.v4.1 961 733.274 125 5.09873 Potri.007G009000.2.v4.1 1416 1188.25 0 0 Potri.003G141000.2.v4.1 2943 2715.25 1116.88 12.3031 Potri.016G087400.1.v4.1 270 93.6167 2166.58 692.214 Potri.015G069301.1.v4.1 564 341.515 0 0 Potri.010G195200.1.v4.1 1773 1545.25 137 2.65179 Potri.012G127500.1.v4.1 977 749.26 10741 428.777 ==> SRR28623297.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1319 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 737 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 9 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 4 Potri.001G452600.v4.1 15 SRR28623297 completed mapping pipeline successfully