Starting /dee2/code/volunteer_pipeline.sh SRR28623298 current disk space = 3049435705344 free memory = 1019451800 SRR28623298 SRAfilesize fa55054d985f697597c8928b68b7e2bf SRR28623298.sra SRR28623298.sra file validated SRR28623298 is paired end SRR28623298 is conventional basespace SRR28623298 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623298_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.42725 37.0 37.0 37.0 37.0 37.0 2 36.4095 37.0 37.0 37.0 37.0 37.0 3 36.6125 37.0 37.0 37.0 37.0 37.0 4 36.6695 37.0 37.0 37.0 37.0 37.0 5 36.603 37.0 37.0 37.0 37.0 37.0 6 36.625 37.0 37.0 37.0 37.0 37.0 7 36.621 37.0 37.0 37.0 37.0 37.0 8 36.484 37.0 37.0 37.0 37.0 37.0 9 36.537 37.0 37.0 37.0 37.0 37.0 10-14 36.5596 37.0 37.0 37.0 37.0 37.0 15-19 36.5407 37.0 37.0 37.0 37.0 37.0 20-24 36.541399999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.5363 37.0 37.0 37.0 37.0 37.0 30-34 36.4754 37.0 37.0 37.0 37.0 37.0 35-39 36.45719999999999 37.0 37.0 37.0 37.0 37.0 40-44 36.420700000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.3472 37.0 37.0 37.0 37.0 37.0 50-54 36.2841 37.0 37.0 37.0 37.0 37.0 55-59 36.18820000000001 37.0 37.0 37.0 37.0 37.0 60-64 36.20700000000001 37.0 37.0 37.0 37.0 37.0 65-69 36.1737 37.0 37.0 37.0 37.0 37.0 70-74 36.148 37.0 37.0 37.0 37.0 37.0 75-79 36.1817 37.0 37.0 37.0 37.0 37.0 80-84 36.1026 37.0 37.0 37.0 37.0 37.0 85-89 36.1524 37.0 37.0 37.0 37.0 37.0 90-94 36.0662 37.0 37.0 37.0 37.0 37.0 95-99 35.9578 37.0 37.0 37.0 37.0 37.0 100-104 36.076100000000004 37.0 37.0 37.0 37.0 37.0 105-109 36.0565 37.0 37.0 37.0 37.0 37.0 110-114 35.969899999999996 37.0 37.0 37.0 37.0 37.0 115-119 35.94350000000001 37.0 37.0 37.0 37.0 37.0 120-124 35.8561 37.0 37.0 37.0 37.0 37.0 125-129 35.6929 37.0 37.0 37.0 37.0 37.0 130-134 35.831399999999995 37.0 37.0 37.0 37.0 37.0 135-139 35.5876 37.0 37.0 37.0 37.0 37.0 140-144 35.34009999999999 37.0 37.0 37.0 37.0 37.0 145-149 35.1687 37.0 37.0 37.0 34.6 37.0 150-151 34.9015 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 1.0 21 1.0 22 1.0 23 1.0 24 5.0 25 4.0 26 6.0 27 5.0 28 18.0 29 15.0 30 24.0 31 26.0 32 67.0 33 95.0 34 159.0 35 443.0 36 2842.0 37 286.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.996239659062425 13.211331160691902 11.8576084231637 39.93482075708197 2 19.85 16.3 34.449999999999996 29.4 3 17.675 19.900000000000002 27.900000000000002 34.525 4 22.650000000000002 27.425 23.9 26.025 5 24.425 33.85 23.875 17.849999999999998 6 20.275000000000002 36.225 24.175 19.325 7 15.675 27.325 40.25 16.75 8 18.8 27.775 30.0 23.425 9 18.675 23.275000000000002 34.675 23.375 10-14 20.200000000000003 30.080000000000002 26.685 23.035 15-19 20.09 28.775000000000002 27.310000000000002 23.825 20-24 20.195 28.375 27.905 23.525 25-29 20.22 29.244999999999997 27.025 23.51 30-34 19.405 28.93 27.800000000000004 23.865 35-39 20.145 28.18 27.455000000000002 24.22 40-44 20.095 28.42 27.529999999999998 23.955000000000002 45-49 20.61 28.349999999999998 27.655 23.385 50-54 20.735 28.144999999999996 27.994999999999997 23.125 55-59 20.76 28.410000000000004 27.52 23.31 60-64 20.405 27.800000000000004 27.825 23.97 65-69 20.28 28.64 27.05 24.03 70-74 21.21 28.76 26.895000000000003 23.135 75-79 20.46 28.044999999999998 27.375 24.12 80-84 20.705000000000002 28.199999999999996 27.055 24.04 85-89 20.96 28.76 27.07 23.21 90-94 21.26 28.610000000000003 26.8 23.330000000000002 95-99 21.015 28.58 27.16 23.244999999999997 100-104 21.495 27.955000000000002 26.915 23.635 105-109 21.055 28.610000000000003 26.815 23.52 110-114 21.279999999999998 28.225 26.665 23.830000000000002 115-119 21.67 27.87 26.369999999999997 24.09 120-124 21.025 28.16 26.735 24.08 125-129 21.584999999999997 28.43 25.979999999999997 24.005000000000003 130-134 21.745 28.005000000000003 26.455000000000002 23.794999999999998 135-139 21.95 28.375 25.415 24.26 140-144 21.875 27.855 26.22 24.05 145-149 22.02 28.255000000000003 25.619999999999997 24.104999999999997 150-151 22.412499999999998 26.9125 25.474999999999998 25.2 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 2.0 17 1.5 18 0.0 19 0.5 20 2.5 21 2.5 22 1.0 23 1.5 24 2.0 25 4.0 26 8.0 27 10.0 28 11.5 29 13.0 30 21.0 31 29.5 32 38.0 33 50.5 34 56.0 35 72.0 36 95.5 37 115.5 38 141.0 39 158.5 40 168.5 41 186.5 42 206.5 43 246.0 44 262.5 45 243.5 46 249.5 47 250.0 48 227.0 49 206.5 50 178.5 51 142.0 52 114.0 53 97.5 54 83.0 55 72.0 56 58.5 57 35.5 58 25.5 59 23.5 60 20.5 61 15.5 62 7.5 63 5.5 64 4.5 65 2.5 66 2.5 67 2.0 68 2.5 69 5.0 70 5.5 71 2.5 72 1.5 73 2.5 74 2.5 75 2.0 76 1.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.27499999999999997 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.475 #Duplication Level Percentage of deduplicated Percentage of total 1 85.52826279964486 72.25 2 11.275525303344185 19.05 3 2.6339153595738383 6.675000000000001 4 0.5031074282332051 1.7000000000000002 5 0.029594554601953243 0.125 6 0.0 0.0 7 0.0 0.0 8 0.029594554601953243 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCTGACACAATCTCGGTT 8 0.2 TruSeq Adapter, Index 7 (97% over 37bp) ACCGTGATTCGACACAATAATCCCTGCTGCTCCAGCTTGAACTGAAAGCC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.25 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.475 0.0 0.0 0.0 0.0 86-87 0.5875 0.0 0.0 0.0 0.0 88-89 0.7 0.0 0.0 0.0 0.0 90-91 0.8625 0.0 0.0 0.0 0.0 92-93 1.1 0.0 0.0 0.0 0.0 94-95 1.35 0.0 0.0 0.0 0.0 96-97 1.75 0.0 0.0 0.0 0.0 98-99 2.0250000000000004 0.0 0.0 0.0 0.0 100-101 2.2625 0.0 0.0 0.0 0.0 102-103 2.75 0.0 0.0 0.0 0.0 104-105 3.1 0.0 0.0 0.0 0.0 106-107 3.4875 0.0 0.0 0.0 0.0 108-109 3.85 0.0 0.0 0.0 0.0 110-111 4.475 0.0 0.0 0.0 0.0 112-113 5.0 0.0 0.0 0.0 0.0 114-115 5.4125 0.0 0.0 0.0 0.0 116-117 6.0 0.0 0.0 0.0 0.0 118-119 6.4125 0.0 0.0 0.0 0.0 120-121 6.9375 0.0 0.0 0.0 0.0 122-123 7.3125 0.0 0.0 0.0 0.0 124-125 7.8125 0.0 0.0 0.0 0.0 126-127 8.412500000000001 0.0 0.0 0.0 0.0 128-129 9.2625 0.0 0.0 0.0 0.0 130-131 10.225 0.0 0.0 0.0 0.0 132-133 10.9125 0.0 0.0 0.0 0.0 134-135 11.625 0.0 0.0 0.0 0.0 136-137 12.412500000000001 0.0 0.0 0.0 0.0 138-139 13.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCATGCC 10 0.006830828 145.0 8 CTTAGAT 10 0.006830828 145.0 1 GCAATGA 10 0.006830828 145.0 2 AGCAATG 10 0.006830828 145.0 1 >>END_MODULE SRR28623298 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623298_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.8985 37.0 37.0 37.0 37.0 37.0 2 36.225 37.0 37.0 37.0 37.0 37.0 3 36.243 37.0 37.0 37.0 37.0 37.0 4 36.0415 37.0 37.0 37.0 37.0 37.0 5 36.2345 37.0 37.0 37.0 37.0 37.0 6 36.108 37.0 37.0 37.0 37.0 37.0 7 36.068 37.0 37.0 37.0 37.0 37.0 8 36.0495 37.0 37.0 37.0 37.0 37.0 9 36.0485 37.0 37.0 37.0 37.0 37.0 10-14 35.983700000000006 37.0 37.0 37.0 37.0 37.0 15-19 36.025499999999994 37.0 37.0 37.0 37.0 37.0 20-24 35.935500000000005 37.0 37.0 37.0 37.0 37.0 25-29 35.817499999999995 37.0 37.0 37.0 37.0 37.0 30-34 35.74720000000001 37.0 37.0 37.0 37.0 37.0 35-39 35.774699999999996 37.0 37.0 37.0 37.0 37.0 40-44 35.6536 37.0 37.0 37.0 37.0 37.0 45-49 35.633500000000005 37.0 37.0 37.0 37.0 37.0 50-54 35.640600000000006 37.0 37.0 37.0 37.0 37.0 55-59 35.5107 37.0 37.0 37.0 37.0 37.0 60-64 35.5291 37.0 37.0 37.0 37.0 37.0 65-69 35.545899999999996 37.0 37.0 37.0 37.0 37.0 70-74 35.476800000000004 37.0 37.0 37.0 37.0 37.0 75-79 35.580799999999996 37.0 37.0 37.0 37.0 37.0 80-84 35.4385 37.0 37.0 37.0 37.0 37.0 85-89 35.4221 37.0 37.0 37.0 37.0 37.0 90-94 35.4165 37.0 37.0 37.0 37.0 37.0 95-99 35.4104 37.0 37.0 37.0 37.0 37.0 100-104 35.3125 37.0 37.0 37.0 34.6 37.0 105-109 35.3556 37.0 37.0 37.0 37.0 37.0 110-114 35.4114 37.0 37.0 37.0 37.0 37.0 115-119 35.3397 37.0 37.0 37.0 34.6 37.0 120-124 35.3069 37.0 37.0 37.0 34.6 37.0 125-129 34.81379999999999 37.0 37.0 37.0 25.0 37.0 130-134 35.0986 37.0 37.0 37.0 27.4 37.0 135-139 34.8994 37.0 37.0 37.0 25.0 37.0 140-144 34.9868 37.0 37.0 37.0 25.0 37.0 145-149 34.918099999999995 37.0 37.0 37.0 25.0 37.0 150-151 34.601749999999996 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 3.0 14 8.0 15 4.0 16 5.0 17 7.0 18 4.0 19 4.0 20 3.0 21 6.0 22 11.0 23 10.0 24 11.0 25 18.0 26 12.0 27 13.0 28 20.0 29 29.0 30 29.0 31 55.0 32 71.0 33 119.0 34 249.0 35 709.0 36 2362.0 37 237.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.4 22.175 14.625 24.8 2 29.7 24.775 28.1 17.424999999999997 3 21.9 27.375 30.425 20.3 4 23.925 33.800000000000004 23.7 18.575 5 25.45 34.875 22.975 16.7 6 22.325 36.175000000000004 23.575 17.925 7 21.775 20.325 38.9 19.0 8 24.2 24.8 27.025 23.974999999999998 9 22.175 26.700000000000003 28.4 22.725 10-14 23.494999999999997 28.939999999999998 26.790000000000003 20.775 15-19 24.0 28.51 26.85 20.64 20-24 23.97 28.7 26.645000000000003 20.685000000000002 25-29 23.59 28.255000000000003 27.345000000000002 20.810000000000002 30-34 23.275000000000002 28.544999999999998 27.975 20.205000000000002 35-39 23.65 28.24 27.029999999999998 21.08 40-44 23.45 28.084999999999997 27.845 20.62 45-49 23.23 28.46 27.694999999999997 20.615 50-54 23.89 27.534999999999997 27.794999999999998 20.78 55-59 23.630000000000003 27.735 27.485 21.15 60-64 23.355 27.744999999999997 28.08 20.82 65-69 23.595 28.395 27.08 20.93 70-74 23.945 27.55 27.62 20.885 75-79 23.195 27.950000000000003 27.744999999999997 21.11 80-84 23.765 28.01 26.91 21.315 85-89 24.025 27.655 27.339999999999996 20.979999999999997 90-94 24.2 28.299999999999997 27.08 20.419999999999998 95-99 24.495 28.24 26.815 20.45 100-104 24.805 28.055000000000003 26.505000000000003 20.635 105-109 24.845 27.42 27.0 20.735 110-114 24.98 28.22 26.39 20.41 115-119 25.259999999999998 27.655 27.04 20.044999999999998 120-124 25.395 28.21 26.13 20.265 125-129 25.495 27.735 26.724999999999998 20.044999999999998 130-134 26.195 27.37 26.825 19.61 135-139 26.06 28.075 26.235000000000003 19.63 140-144 26.06 27.405 26.765 19.77 145-149 26.369999999999997 27.534999999999997 26.965 19.13 150-151 27.500000000000004 27.0625 26.125 19.3125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 1.0 3 1.0 4 0.0 5 0.5 6 1.0 7 1.0 8 0.5 9 0.5 10 1.0 11 1.0 12 0.5 13 0.0 14 0.0 15 1.5 16 2.0 17 0.5 18 1.0 19 1.5 20 1.0 21 1.0 22 1.0 23 4.5 24 5.0 25 2.0 26 2.5 27 6.5 28 11.5 29 17.5 30 21.5 31 24.0 32 28.5 33 42.0 34 51.5 35 66.0 36 84.5 37 102.5 38 128.0 39 154.5 40 180.5 41 202.5 42 245.5 43 259.5 44 263.0 45 260.5 46 238.0 47 237.5 48 222.0 49 197.0 50 171.0 51 149.5 52 119.0 53 84.5 54 74.5 55 65.5 56 52.5 57 51.5 58 43.0 59 22.0 60 12.0 61 9.5 62 8.0 63 8.0 64 5.5 65 2.5 66 2.0 67 1.0 68 2.0 69 2.0 70 1.0 71 1.5 72 1.0 73 0.5 74 0.5 75 1.0 76 1.0 77 1.0 78 2.0 79 1.0 80 1.5 81 2.0 82 1.5 83 2.0 84 1.5 85 1.0 86 1.0 87 1.0 88 0.5 89 0.5 90 1.5 91 1.5 92 0.5 93 1.0 94 2.0 95 1.5 96 0.5 97 0.5 98 1.0 99 1.0 100 2.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.5 #Duplication Level Percentage of deduplicated Percentage of total 1 86.90058479532163 74.3 2 10.087719298245613 17.25 3 2.456140350877193 6.3 4 0.46783625730994155 1.6 5 0.029239766081871347 0.125 6 0.0 0.0 7 0.029239766081871347 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.029239766081871347 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 10 0.25 No Hit AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 7 0.17500000000000002 No Hit AAATGGACAAGGCTGCTGACTCTGGACTTGCGTCGTATGTTGCTGGTCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.25 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.475 0.0 0.0 0.0 0.0 86-87 0.5875 0.0 0.0 0.0 0.0 88-89 0.7 0.0 0.0 0.0 0.0 90-91 0.9125 0.0 0.0 0.0 0.0 92-93 1.1625 0.0 0.0 0.0 0.0 94-95 1.4 0.0 0.0 0.0 0.0 96-97 1.825 0.0 0.0 0.0 0.0 98-99 2.0999999999999996 0.0 0.0 0.0 0.0 100-101 2.3375 0.0 0.0 0.0 0.0 102-103 2.8125 0.0 0.0 0.0 0.0 104-105 3.2 0.0 0.0 0.0 0.0 106-107 3.5875 0.0 0.0 0.0 0.0 108-109 3.9625000000000004 0.0 0.0 0.0 0.0 110-111 4.574999999999999 0.0 0.0 0.0 0.0 112-113 5.1 0.0 0.0 0.0 0.0 114-115 5.5375 0.0 0.0 0.0 0.0 116-117 6.125 0.0 0.0 0.0 0.0 118-119 6.5375 0.0 0.0 0.0 0.0 120-121 7.0875 0.0 0.0 0.0 0.0 122-123 7.487500000000001 0.0 0.0 0.0 0.0 124-125 7.9625 0.0 0.0 0.0 0.0 126-127 8.55 0.0 0.0 0.0 0.0 128-129 9.3875 0.0 0.0 0.0 0.0 130-131 10.3625 0.0 0.0 0.0 0.0 132-133 11.0875 0.0 0.0 0.0 0.0 134-135 11.8125 0.0 0.0 0.0 0.0 136-137 12.55 0.0 0.0 0.0 0.0 138-139 13.3375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTATTGT 10 0.006830828 145.0 4 GCAGCCT 10 0.006830828 145.0 8 TTTATTG 10 0.006830828 145.0 3 AAAAAAA 25 4.977651E-4 29.0 35-39 >>END_MODULE Read 1662003 spots for SRR28623298.sra Written 1662003 spots for SRR28623298.sra Read 1662003 spots for SRR28623298.sra Written 1662003 spots for SRR28623298.sra Read 1662003 spots for SRR28623298.sra Written 1662003 spots for SRR28623298.sra Read 1662003 spots for SRR28623298.sra Written 1662003 spots for SRR28623298.sra Read 1662003 spots for SRR28623298.sra Written 1662003 spots for SRR28623298.sra Read 1662003 spots for SRR28623298.sra Written 1662003 spots for SRR28623298.sra Read 1662003 spots for SRR28623298.sra Written 1662003 spots for SRR28623298.sra Read 1662003 spots for SRR28623298.sra Written 1662003 spots for SRR28623298.sra Read 1662003 spots for SRR28623298.sra Written 1662003 spots for SRR28623298.sra Read 1662003 spots for SRR28623298.sra Written 1662003 spots for SRR28623298.sra Read 1662003 spots for SRR28623298.sra Written 1662003 spots for SRR28623298.sra Read 1662003 spots for SRR28623298.sra Written 1662003 spots for SRR28623298.sra Read 1662003 spots for SRR28623298.sra Written 1662003 spots for SRR28623298.sra Read 1662004 spots for SRR28623298.sra Written 1662004 spots for SRR28623298.sra Read 1662003 spots for SRR28623298.sra Written 1662003 spots for SRR28623298.sra Read 1662003 spots for SRR28623298.sra Written 1662003 spots for SRR28623298.sra Read 1662003 spots for SRR28623298.sra Written 1662003 spots for SRR28623298.sra Read 1662003 spots for SRR28623298.sra Written 1662003 spots for SRR28623298.sra Read 1662003 spots for SRR28623298.sra Written 1662003 spots for SRR28623298.sra Read 1662003 spots for SRR28623298.sra Written 1662003 spots for SRR28623298.sra SRR ids: ['SRR28623298.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_c3som8un SRR28623298.sra spots: 33240061 blocks: [[1, 1662003], [1662004, 3324006], [3324007, 4986009], [4986010, 6648012], [6648013, 8310015], [8310016, 9972018], [9972019, 11634021], [11634022, 13296024], [13296025, 14958027], [14958028, 16620030], [16620031, 18282033], [18282034, 19944036], [19944037, 21606039], [21606040, 23268042], [23268043, 24930045], [24930046, 26592048], [26592049, 28254051], [28254052, 29916054], [29916055, 31578057], [31578058, 33240061]] SRR28623298 file size 12274525 SRR28623298 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR28623298 SRR28623298_1.fastq SRR28623298_2.fastq Input file: SRR28623298_1.fastq Paired file: SRR28623298_2.fastq trimmed: SRR28623298-trimmed-pair1.fastq, SRR28623298-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 15:56:25 2025 >> started Tue Feb 11 15:57:08 2025 >> done (43.942s) 33240061 read pairs processed; of these: 38 ( 0.00%) short read pairs filtered out after trimming by size control 182657 ( 0.55%) empty read pairs filtered out after trimming by size control 33057366 (99.45%) read pairs available; of these: 5464950 (16.53%) trimmed read pairs available after processing 27592416 (83.47%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 8 0.00% 20 4 0.00% 21 6 0.00% 22 4 0.00% 23 8 0.00% 24 4 0.00% 25 9 0.00% 26 2 0.00% 27 3 0.00% 28 14 0.00% 29 17 0.00% 30 11 0.00% 31 16 0.00% 32 24 0.00% 33 22 0.00% 34 23 0.00% 35 25 0.00% 36 33 0.00% 37 53 0.00% 38 55 0.00% 39 56 0.00% 40 64 0.00% 41 76 0.00% 42 82 0.00% 43 109 0.00% 44 110 0.00% 45 123 0.00% 46 151 0.00% 47 155 0.00% 48 177 0.00% 49 240 0.00% 50 231 0.00% 51 322 0.00% 52 330 0.00% 53 363 0.00% 54 383 0.00% 55 410 0.00% 56 463 0.00% 57 619 0.00% 58 614 0.00% 59 773 0.00% 60 869 0.00% 61 1118 0.00% 62 1273 0.00% 63 1437 0.00% 64 1559 0.00% 65 1668 0.01% 66 2003 0.01% 67 2117 0.01% 68 2433 0.01% 69 2806 0.01% 70 3293 0.01% 71 3927 0.01% 72 4480 0.01% 73 5208 0.02% 74 5679 0.02% 75 6315 0.02% 76 6975 0.02% 77 7743 0.02% 78 8687 0.03% 79 9790 0.03% 80 11015 0.03% 81 12365 0.04% 82 14292 0.04% 83 15738 0.05% 84 17412 0.05% 85 18953 0.06% 86 19990 0.06% 87 21572 0.07% 88 23200 0.07% 89 24619 0.07% 90 27194 0.08% 91 30095 0.09% 92 32270 0.10% 93 34977 0.11% 94 37685 0.11% 95 39987 0.12% 96 41834 0.13% 97 43495 0.13% 98 45015 0.14% 99 46765 0.14% 100 49481 0.15% 101 51571 0.16% 102 55230 0.17% 103 58310 0.18% 104 60715 0.18% 105 63893 0.19% 106 65514 0.20% 107 66391 0.20% 108 66702 0.20% 109 68426 0.21% 110 71205 0.22% 111 73158 0.22% 112 76502 0.23% 113 78581 0.24% 114 81597 0.25% 115 84526 0.26% 116 86191 0.26% 117 86630 0.26% 118 88252 0.27% 119 88086 0.27% 120 90305 0.27% 121 92441 0.28% 122 93639 0.28% 123 96187 0.29% 124 98998 0.30% 125 100260 0.30% 126 103031 0.31% 127 103612 0.31% 128 102384 0.31% 129 104235 0.32% 130 103668 0.31% 131 104881 0.32% 132 105854 0.32% 133 109561 0.33% 134 109763 0.33% 135 111130 0.34% 136 113550 0.34% 137 113539 0.34% 138 114390 0.35% 139 115021 0.35% 140 114461 0.35% 141 114187 0.35% 142 116297 0.35% 143 117056 0.35% 144 120023 0.36% 145 120598 0.36% 146 121586 0.37% 147 121181 0.37% 148 123524 0.37% 149 121734 0.37% 150 122843 0.37% 151 27592416 83.47% 33057366 reads passed initial QC criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=35 prefix-density=0.36 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.03 sequence-density-rank=39 fanout-score=149.99 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=14.5 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTGT criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=2.17 fanout-score-rank=33 prefix-density=0.43 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=40 fanout-score=61.15 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=4.1 sequence=AAACAAGCAGAGAGCAGATCAAGCAAAGCTTAAACACTAATTAATCATGGCAACCAGCTCAGTTATGGCTTCATCAATGAGCCTGAAACCAGCTCCTTTTACAGTCAAGAAACCTTCTCTCCCAAGTCTTTCAAGGAGATCATCTTTCAAAGTTGAGGCTAGTCGTTCGAGGAAGTCCAAGACTGATCAGCCTTATGGAATCAATGGTGGCATGGATTTAAGGGGTGGGCTTGATGCTTCTGGGAGAAAGGG SRR28623298 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 15:57:54 Started mapping on | Feb 11 15:57:54 Finished on | Feb 11 16:01:50 Mapping speed, Million of reads per hour | 504.26 Number of input reads | 33057366 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 30546764 Uniquely mapped reads % | 92.41% Average mapped length | 291.30 Number of splices: Total | 28525601 Number of splices: Annotated (sjdb) | 27893988 Number of splices: GT/AG | 27892619 Number of splices: GC/AG | 520391 Number of splices: AT/AC | 19871 Number of splices: Non-canonical | 92720 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 2.73 Insertion rate per base | 0.02% Insertion average length | 2.29 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 700013 % of reads mapped to multiple loci | 2.12% Number of reads mapped to too many loci | 82758 % of reads mapped to too many loci | 0.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.00% % of reads unmapped: other | 0.23% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1810589 1810589 1810589 N_multimapping 700013 700013 700013 N_noFeature 1189562 29949079 1395063 N_ambiguous 584370 2269 190675 UnstrandedReadsAssigned:28772832 PositiveStrandReadsAssigned:595416 NegativeStrandReadsAssigned:28961026 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR28623298 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR28623298-trimmed-pair1.fastq SRR28623298-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 33,057,366 reads, 29,187,807 reads pseudoaligned [quant] estimated average fragment length: 236.546 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,038 rounds 52401 SRR28623298.ke.tsv 34699 SRR28623298.se.tsv 87100 total ==> SRR28623298.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1782.45 1498 25.0133 Potri.005G024800.1.v4.1 1035 799.454 447 16.6414 Potri.004G059700.1.v4.1 961 725.479 99 4.06151 Potri.007G009000.2.v4.1 1416 1180.45 0 0 Potri.003G141000.2.v4.1 2943 2707.45 1588 17.4569 Potri.016G087400.1.v4.1 270 96.5621 1144.62 352.803 Potri.015G069301.1.v4.1 564 337.154 0 0 Potri.010G195200.1.v4.1 1773 1537.45 9 0.174228 Potri.012G127500.1.v4.1 977 741.464 69 2.76972 ==> SRR28623298.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 360 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 442 Potri.001G212900.v4.1 99 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 31 SRR28623298 completed mapping pipeline successfully