Starting /dee2/code/volunteer_pipeline.sh SRR28623300 current disk space = 3088838176768 free memory = 1444572936 SRR28623300 SRAfilesize 59c7a29d7942f6d30ee4d230bbc8d375 SRR28623300.sra SRR28623300.sra file validated SRR28623300 is paired end SRR28623300 is conventional basespace SRR28623300 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623300_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.41925 37.0 37.0 37.0 37.0 37.0 2 36.46 37.0 37.0 37.0 37.0 37.0 3 36.6145 37.0 37.0 37.0 37.0 37.0 4 36.6575 37.0 37.0 37.0 37.0 37.0 5 36.6745 37.0 37.0 37.0 37.0 37.0 6 36.6765 37.0 37.0 37.0 37.0 37.0 7 36.6645 37.0 37.0 37.0 37.0 37.0 8 36.522 37.0 37.0 37.0 37.0 37.0 9 36.667 37.0 37.0 37.0 37.0 37.0 10-14 36.6394 37.0 37.0 37.0 37.0 37.0 15-19 36.6188 37.0 37.0 37.0 37.0 37.0 20-24 36.6142 37.0 37.0 37.0 37.0 37.0 25-29 36.5127 37.0 37.0 37.0 37.0 37.0 30-34 36.5311 37.0 37.0 37.0 37.0 37.0 35-39 36.501599999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.50450000000001 37.0 37.0 37.0 37.0 37.0 45-49 36.413599999999995 37.0 37.0 37.0 37.0 37.0 50-54 36.3831 37.0 37.0 37.0 37.0 37.0 55-59 36.366 37.0 37.0 37.0 37.0 37.0 60-64 36.4067 37.0 37.0 37.0 37.0 37.0 65-69 36.342200000000005 37.0 37.0 37.0 37.0 37.0 70-74 36.2947 37.0 37.0 37.0 37.0 37.0 75-79 36.2753 37.0 37.0 37.0 37.0 37.0 80-84 36.158899999999996 37.0 37.0 37.0 37.0 37.0 85-89 36.2063 37.0 37.0 37.0 37.0 37.0 90-94 36.1591 37.0 37.0 37.0 37.0 37.0 95-99 36.099199999999996 37.0 37.0 37.0 37.0 37.0 100-104 36.1106 37.0 37.0 37.0 37.0 37.0 105-109 36.1177 37.0 37.0 37.0 37.0 37.0 110-114 35.949799999999996 37.0 37.0 37.0 37.0 37.0 115-119 35.9895 37.0 37.0 37.0 37.0 37.0 120-124 35.835499999999996 37.0 37.0 37.0 37.0 37.0 125-129 35.7576 37.0 37.0 37.0 37.0 37.0 130-134 35.9299 37.0 37.0 37.0 37.0 37.0 135-139 35.7235 37.0 37.0 37.0 37.0 37.0 140-144 35.4303 37.0 37.0 37.0 37.0 37.0 145-149 35.4486 37.0 37.0 37.0 37.0 37.0 150-151 35.19175 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 2.0 24 2.0 25 1.0 26 5.0 27 6.0 28 13.0 29 25.0 30 19.0 31 27.0 32 56.0 33 73.0 34 142.0 35 354.0 36 2994.0 37 280.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.586820345778 12.37785016286645 8.494111751440741 40.541217739914806 2 19.75 15.7 36.725 27.825 3 17.175 20.875 29.95 32.0 4 22.875 26.6 22.85 27.675 5 22.975 34.575 22.075 20.375 6 21.2 36.35 21.224999999999998 21.224999999999998 7 15.024999999999999 28.95 39.825 16.2 8 17.974999999999998 26.775 30.575000000000003 24.675 9 16.975 23.400000000000002 35.375 24.25 10-14 19.759999999999998 30.18 26.83 23.23 15-19 20.585 28.494999999999997 27.57 23.35 20-24 20.735 28.84 26.895000000000003 23.53 25-29 20.4 29.225 26.790000000000003 23.585 30-34 20.24 28.955 27.515 23.29 35-39 19.814999999999998 29.505 26.82 23.86 40-44 20.165 29.265 27.24 23.330000000000002 45-49 20.655 28.68 27.195000000000004 23.47 50-54 20.474999999999998 29.315 27.22 22.99 55-59 20.330000000000002 29.020000000000003 27.055 23.595 60-64 20.435 28.439999999999998 27.165 23.96 65-69 19.475 28.49 27.575 24.46 70-74 20.715 28.585 26.55 24.15 75-79 20.64 28.725 27.650000000000002 22.985 80-84 21.105 28.439999999999998 27.0 23.455000000000002 85-89 20.77 27.705000000000002 27.694999999999997 23.830000000000002 90-94 21.035 28.48 27.105 23.380000000000003 95-99 21.55 28.139999999999997 26.985 23.325000000000003 100-104 21.95 28.425 26.090000000000003 23.535 105-109 22.009999999999998 28.4 27.165 22.425 110-114 20.945 28.299999999999997 26.865 23.89 115-119 21.205 28.67 26.345000000000002 23.78 120-124 21.044999999999998 28.13 26.640000000000004 24.185000000000002 125-129 21.490000000000002 28.03 26.314999999999998 24.165 130-134 21.955 28.249999999999996 26.025 23.77 135-139 21.455 27.555000000000003 26.575 24.415 140-144 21.915000000000003 26.924999999999997 26.8 24.36 145-149 22.55 26.815 26.41 24.224999999999998 150-151 22.112499999999997 26.1125 26.4625 25.3125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 1.5 25 5.0 26 5.5 27 9.0 28 17.5 29 24.0 30 23.5 31 26.5 32 34.0 33 39.0 34 50.5 35 86.0 36 104.0 37 113.5 38 134.5 39 165.0 40 178.5 41 192.0 42 208.0 43 214.5 44 235.5 45 236.0 46 257.5 47 258.0 48 226.5 49 216.0 50 188.5 51 140.0 52 123.0 53 114.0 54 81.0 55 65.0 56 54.0 57 41.5 58 35.5 59 26.0 60 23.0 61 16.5 62 9.0 63 6.0 64 3.0 65 1.0 66 1.0 67 2.0 68 1.5 69 0.0 70 0.5 71 1.0 72 1.5 73 1.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.22499999999999998 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 82.45 #Duplication Level Percentage of deduplicated Percentage of total 1 82.9896907216495 68.425 2 13.493026076409945 22.25 3 2.8805336567616737 7.124999999999999 4 0.5154639175257731 1.7000000000000002 5 0.1212856276531231 0.5 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGTGGTTGAGGTACTTTGGAGGAATCTTGGGGTGAGGAGGAAGCTTAGG 5 0.125 No Hit CTTATCTTTAAAGTTTATTGCGGTAATGGACGTAATTCCCGTAAACAGAA 5 0.125 No Hit CTTGGCCAATTCCTCCTCTGTGAGATCTGGAAGGTAAGAAAGAGTCTCGA 5 0.125 No Hit GCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.11249999999999999 0.0 0.0 0.0 0.0 72-73 0.16249999999999998 0.0 0.0 0.0 0.0 74-75 0.2 0.0 0.0 0.0 0.0 76-77 0.3125 0.0 0.0 0.0 0.0 78-79 0.3875 0.0 0.0 0.0 0.0 80-81 0.44999999999999996 0.0 0.0 0.0 0.0 82-83 0.6125 0.0 0.0 0.0 0.0 84-85 0.7124999999999999 0.0 0.0 0.0 0.0 86-87 0.9375 0.0 0.0 0.0 0.0 88-89 1.0875 0.0 0.0 0.0 0.0 90-91 1.1875 0.0 0.0 0.0 0.0 92-93 1.4249999999999998 0.0 0.0 0.0 0.0 94-95 1.75 0.0 0.0 0.0 0.0 96-97 2.075 0.0 0.0 0.0 0.0 98-99 2.325 0.0 0.0 0.0 0.0 100-101 2.7125 0.0 0.0 0.0 0.0 102-103 3.1875 0.0 0.0 0.0 0.0 104-105 3.7125000000000004 0.0 0.0 0.0 0.0 106-107 4.2375 0.0 0.0 0.0 0.0 108-109 4.737500000000001 0.0 0.0 0.0 0.0 110-111 5.025 0.0 0.0 0.0 0.0 112-113 5.5375 0.0 0.0 0.0 0.0 114-115 6.0625 0.0 0.0 0.0 0.0 116-117 6.7125 0.0 0.0 0.0 0.0 118-119 7.475 0.0 0.0 0.0 0.0 120-121 8.3375 0.0 0.0 0.0 0.0 122-123 8.8625 0.0 0.0 0.0 0.0 124-125 9.600000000000001 0.0 0.0 0.0 0.0 126-127 10.412500000000001 0.0 0.0 0.0 0.0 128-129 11.2125 0.0 0.0 0.0 0.0 130-131 12.125 0.0 0.0 0.0 0.0 132-133 12.875 0.0 0.0 0.0 0.0 134-135 13.587499999999999 0.0 0.0 0.0 0.0 136-137 14.125 0.0 0.0 0.0 0.0 138-139 15.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR28623300 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623300_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.5375 37.0 37.0 37.0 37.0 37.0 2 36.259 37.0 37.0 37.0 37.0 37.0 3 36.1795 37.0 37.0 37.0 37.0 37.0 4 36.133 37.0 37.0 37.0 37.0 37.0 5 36.3255 37.0 37.0 37.0 37.0 37.0 6 36.323 37.0 37.0 37.0 37.0 37.0 7 36.24 37.0 37.0 37.0 37.0 37.0 8 36.33 37.0 37.0 37.0 37.0 37.0 9 36.075 37.0 37.0 37.0 37.0 37.0 10-14 36.1559 37.0 37.0 37.0 37.0 37.0 15-19 36.217 37.0 37.0 37.0 37.0 37.0 20-24 36.184999999999995 37.0 37.0 37.0 37.0 37.0 25-29 36.14130000000001 37.0 37.0 37.0 37.0 37.0 30-34 36.0664 37.0 37.0 37.0 37.0 37.0 35-39 36.1012 37.0 37.0 37.0 37.0 37.0 40-44 36.077999999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.0731 37.0 37.0 37.0 37.0 37.0 50-54 36.044 37.0 37.0 37.0 37.0 37.0 55-59 35.898 37.0 37.0 37.0 37.0 37.0 60-64 35.893 37.0 37.0 37.0 37.0 37.0 65-69 35.9557 37.0 37.0 37.0 37.0 37.0 70-74 35.957499999999996 37.0 37.0 37.0 37.0 37.0 75-79 35.9524 37.0 37.0 37.0 37.0 37.0 80-84 35.865899999999996 37.0 37.0 37.0 37.0 37.0 85-89 35.75449999999999 37.0 37.0 37.0 37.0 37.0 90-94 35.6978 37.0 37.0 37.0 37.0 37.0 95-99 35.784800000000004 37.0 37.0 37.0 37.0 37.0 100-104 35.6431 37.0 37.0 37.0 37.0 37.0 105-109 35.5657 37.0 37.0 37.0 37.0 37.0 110-114 35.6449 37.0 37.0 37.0 37.0 37.0 115-119 35.522400000000005 37.0 37.0 37.0 37.0 37.0 120-124 35.60340000000001 37.0 37.0 37.0 37.0 37.0 125-129 35.0901 37.0 37.0 37.0 32.2 37.0 130-134 35.375 37.0 37.0 37.0 34.6 37.0 135-139 35.1961 37.0 37.0 37.0 29.8 37.0 140-144 35.223 37.0 37.0 37.0 32.2 37.0 145-149 35.1682 37.0 37.0 37.0 29.8 37.0 150-151 34.734 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 3.0 14 0.0 15 4.0 16 1.0 17 3.0 18 2.0 19 3.0 20 4.0 21 3.0 22 9.0 23 9.0 24 8.0 25 4.0 26 9.0 27 15.0 28 16.0 29 22.0 30 20.0 31 36.0 32 55.0 33 114.0 34 203.0 35 641.0 36 2568.0 37 248.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.675000000000004 18.575 12.8 26.950000000000003 2 27.950000000000003 23.325000000000003 29.525000000000002 19.2 3 21.0 27.05 32.625 19.325 4 25.174999999999997 32.9 23.474999999999998 18.45 5 26.35 35.975 20.4 17.275 6 21.625 38.224999999999994 23.7 16.45 7 21.675 21.825 36.875 19.625 8 22.825 25.775 26.724999999999998 24.675 9 21.099999999999998 25.05 30.525000000000002 23.325000000000003 10-14 23.39 29.085 26.465 21.060000000000002 15-19 23.365 28.49 26.965 21.18 20-24 23.835 29.095 25.900000000000002 21.17 25-29 24.275 27.589999999999996 27.01 21.125 30-34 23.535 28.165000000000003 27.435 20.865000000000002 35-39 23.09 28.18 26.965 21.765 40-44 23.380000000000003 28.02 27.24 21.36 45-49 23.025000000000002 27.27 28.215 21.490000000000002 50-54 24.065 27.665 27.779999999999998 20.49 55-59 22.93 27.295 27.485 22.29 60-64 23.655 27.485 27.345000000000002 21.515 65-69 22.994999999999997 27.400000000000002 27.96 21.645 70-74 23.330000000000002 27.284999999999997 27.839999999999996 21.545 75-79 22.8 27.825 27.925 21.45 80-84 23.56 28.084999999999997 27.52 20.835 85-89 23.075000000000003 27.825 27.965 21.135 90-94 23.599999999999998 27.405 27.27 21.725 95-99 23.76 28.060000000000002 27.345000000000002 20.835 100-104 24.67 27.985 26.775 20.57 105-109 24.05 27.525 27.92 20.505000000000003 110-114 24.135 28.194999999999997 26.515 21.154999999999998 115-119 24.465 27.71 27.325 20.5 120-124 24.610000000000003 28.395 26.875 20.119999999999997 125-129 25.105 28.37 26.255 20.27 130-134 25.95 26.705000000000002 27.365000000000002 19.98 135-139 26.235000000000003 26.71 27.515 19.54 140-144 25.11 27.455000000000002 27.310000000000002 20.125 145-149 26.534999999999997 27.644999999999996 26.919999999999998 18.9 150-151 26.8 26.650000000000002 26.5625 19.9875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.5 5 0.5 6 0.5 7 0.5 8 0.5 9 0.5 10 0.0 11 0.0 12 1.0 13 2.0 14 1.0 15 0.5 16 1.0 17 0.5 18 0.5 19 2.5 20 3.0 21 2.0 22 2.0 23 3.0 24 4.0 25 3.0 26 1.0 27 3.0 28 6.0 29 8.0 30 15.0 31 23.5 32 33.5 33 40.0 34 43.5 35 57.0 36 86.0 37 109.0 38 124.5 39 134.5 40 164.5 41 204.0 42 227.5 43 228.5 44 228.0 45 245.5 46 266.5 47 261.5 48 231.5 49 221.5 50 196.0 51 156.0 52 121.5 53 101.5 54 87.5 55 74.5 56 63.0 57 53.0 58 47.5 59 32.0 60 19.5 61 13.0 62 10.0 63 10.0 64 5.5 65 1.5 66 1.0 67 1.0 68 0.5 69 0.5 70 0.5 71 0.5 72 0.5 73 0.0 74 0.5 75 1.5 76 1.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 1.0 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.15 #Duplication Level Percentage of deduplicated Percentage of total 1 84.00481058328322 69.85 2 12.687913409500903 21.099999999999998 3 2.6458208057727 6.6000000000000005 4 0.4810583283223091 1.6 5 0.12026458208057728 0.5 6 0.0 0.0 7 0.06013229104028864 0.35000000000000003 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGGGAGCACTGCATAGCTTATAAGCTTGTAAGAGATGGCTTCCTCCTCTA 7 0.17500000000000002 No Hit CACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTC 7 0.17500000000000002 No Hit CACTACTGAGCAATTGGCCCAGGAAATTGAGTACCTTCTTCGCAACAAGT 5 0.125 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit GCAAGTTAAATGCGGTTCGGTATGAGGGAGATTGGTAATTTCTTGATTTG 5 0.125 No Hit CTTGGGAAAAGGTCTATGATGGCTGCAACTGATCTCTTAGCTGCTGGTTT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.11249999999999999 0.0 0.0 0.0 0.0 72-73 0.16249999999999998 0.0 0.0 0.0 0.0 74-75 0.2 0.0 0.0 0.0 0.0 76-77 0.35 0.0 0.0 0.0 0.0 78-79 0.4375 0.0 0.0 0.0 0.0 80-81 0.4875 0.0 0.0 0.0 0.0 82-83 0.6375 0.0 0.0 0.0 0.0 84-85 0.7375 0.0 0.0 0.0 0.0 86-87 0.9624999999999999 0.0 0.0 0.0 0.0 88-89 1.1125 0.0 0.0 0.0 0.0 90-91 1.225 0.0 0.0 0.0 0.0 92-93 1.475 0.0 0.0 0.0 0.0 94-95 1.8 0.0 0.0 0.0 0.0 96-97 2.175 0.0 0.0 0.0 0.0 98-99 2.4375 0.0 0.0 0.0 0.0 100-101 2.85 0.0 0.0 0.0 0.0 102-103 3.3375 0.0 0.0 0.0 0.0 104-105 3.8625 0.0 0.0 0.0 0.0 106-107 4.3875 0.0 0.0 0.0 0.0 108-109 4.9125 0.0 0.0 0.0 0.0 110-111 5.2125 0.0 0.0 0.0 0.0 112-113 5.7625 0.0 0.0 0.0 0.0 114-115 6.275 0.0 0.0 0.0 0.0 116-117 6.9125 0.0 0.0 0.0 0.0 118-119 7.675 0.0 0.0 0.0 0.0 120-121 8.524999999999999 0.0 0.0 0.0 0.0 122-123 9.05 0.0 0.0 0.0 0.0 124-125 9.825 0.0 0.0 0.0 0.0 126-127 10.6125 0.0 0.0 0.0 0.0 128-129 11.4 0.0 0.0 0.0 0.0 130-131 12.287500000000001 0.0 0.0 0.0 0.0 132-133 13.05 0.0 0.0 0.0 0.0 134-135 13.7375 0.0 0.0 0.0 0.0 136-137 14.275 0.0 0.0 0.0 0.0 138-139 15.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1828243 spots for SRR28623300.sra Written 1828243 spots for SRR28623300.sra Read 1828243 spots for SRR28623300.sra Written 1828243 spots for SRR28623300.sra Read 1828243 spots for SRR28623300.sra Written 1828243 spots for SRR28623300.sra Read 1828243 spots for SRR28623300.sra Written 1828243 spots for SRR28623300.sra Read 1828243 spots for SRR28623300.sra Written 1828243 spots for SRR28623300.sra Read 1828243 spots for SRR28623300.sra Written 1828243 spots for SRR28623300.sra Read 1828243 spots for SRR28623300.sra Written 1828243 spots for SRR28623300.sra Read 1828243 spots for SRR28623300.sra Written 1828243 spots for SRR28623300.sra Read 1828243 spots for SRR28623300.sra Written 1828243 spots for SRR28623300.sra Read 1828243 spots for SRR28623300.sra Written 1828243 spots for SRR28623300.sra Read 1828243 spots for SRR28623300.sra Written 1828243 spots for SRR28623300.sra Read 1828243 spots for SRR28623300.sra Written 1828243 spots for SRR28623300.sra Read 1828256 spots for SRR28623300.sra Written 1828256 spots for SRR28623300.sra Read 1828243 spots for SRR28623300.sra Written 1828243 spots for SRR28623300.sra Read 1828243 spots for SRR28623300.sra Written 1828243 spots for SRR28623300.sra Read 1828243 spots for SRR28623300.sra Written 1828243 spots for SRR28623300.sra Read 1828243 spots for SRR28623300.sra Written 1828243 spots for SRR28623300.sra Read 1828243 spots for SRR28623300.sra Written 1828243 spots for SRR28623300.sra Read 1828243 spots for SRR28623300.sra Written 1828243 spots for SRR28623300.sra Read 1828243 spots for SRR28623300.sra Written 1828243 spots for SRR28623300.sra SRR ids: ['SRR28623300.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_tofmrwmv SRR28623300.sra spots: 36564873 blocks: [[1, 1828243], [1828244, 3656486], [3656487, 5484729], [5484730, 7312972], [7312973, 9141215], [9141216, 10969458], [10969459, 12797701], [12797702, 14625944], [14625945, 16454187], [16454188, 18282430], [18282431, 20110673], [20110674, 21938916], [21938917, 23767159], [23767160, 25595402], [25595403, 27423645], [27423646, 29251888], [29251889, 31080131], [31080132, 32908374], [32908375, 34736617], [34736618, 36564873]] SRR28623300 file size 13503359 SRR28623300 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR28623300 SRR28623300_1.fastq SRR28623300_2.fastq Input file: SRR28623300_1.fastq Paired file: SRR28623300_2.fastq trimmed: SRR28623300-trimmed-pair1.fastq, SRR28623300-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 16:05:56 2025 >> started Thu Feb 13 16:06:38 2025 >> done (41.513s) 36564873 read pairs processed; of these: 35 ( 0.00%) short read pairs filtered out after trimming by size control 27461 ( 0.08%) empty read pairs filtered out after trimming by size control 36537377 (99.92%) read pairs available; of these: 7328305 (20.06%) trimmed read pairs available after processing 29209072 (79.94%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 10 0.00% 20 8 0.00% 21 5 0.00% 22 5 0.00% 23 7 0.00% 24 9 0.00% 25 15 0.00% 26 11 0.00% 27 10 0.00% 28 20 0.00% 29 21 0.00% 30 16 0.00% 31 25 0.00% 32 32 0.00% 33 39 0.00% 34 41 0.00% 35 43 0.00% 36 61 0.00% 37 46 0.00% 38 72 0.00% 39 76 0.00% 40 97 0.00% 41 99 0.00% 42 111 0.00% 43 139 0.00% 44 150 0.00% 45 175 0.00% 46 185 0.00% 47 213 0.00% 48 284 0.00% 49 319 0.00% 50 404 0.00% 51 431 0.00% 52 588 0.00% 53 609 0.00% 54 660 0.00% 55 730 0.00% 56 839 0.00% 57 987 0.00% 58 1109 0.00% 59 1419 0.00% 60 1698 0.00% 61 1922 0.01% 62 2212 0.01% 63 2490 0.01% 64 2798 0.01% 65 3137 0.01% 66 3469 0.01% 67 3938 0.01% 68 4555 0.01% 69 5221 0.01% 70 6161 0.02% 71 7267 0.02% 72 8193 0.02% 73 9479 0.03% 74 10584 0.03% 75 11741 0.03% 76 12769 0.03% 77 14203 0.04% 78 15850 0.04% 79 17405 0.05% 80 19596 0.05% 81 21633 0.06% 82 24454 0.07% 83 26861 0.07% 84 29253 0.08% 85 32120 0.09% 86 33663 0.09% 87 36287 0.10% 88 38362 0.10% 89 40905 0.11% 90 43769 0.12% 91 46980 0.13% 92 50127 0.14% 93 53818 0.15% 94 57173 0.16% 95 60838 0.17% 96 63104 0.17% 97 65210 0.18% 98 67147 0.18% 99 69087 0.19% 100 72460 0.20% 101 74439 0.20% 102 78220 0.21% 103 81170 0.22% 104 85051 0.23% 105 87565 0.24% 106 90647 0.25% 107 91775 0.25% 108 93822 0.26% 109 96556 0.26% 110 96515 0.26% 111 98945 0.27% 112 102437 0.28% 113 104609 0.29% 114 107706 0.29% 115 111699 0.31% 116 113417 0.31% 117 115875 0.32% 118 116867 0.32% 119 117686 0.32% 120 119173 0.33% 121 121578 0.33% 122 120517 0.33% 123 124414 0.34% 124 126945 0.35% 125 129563 0.35% 126 132188 0.36% 127 133339 0.36% 128 134352 0.37% 129 135713 0.37% 130 136294 0.37% 131 135341 0.37% 132 137526 0.38% 133 140486 0.38% 134 140494 0.38% 135 142181 0.39% 136 143843 0.39% 137 144779 0.40% 138 147054 0.40% 139 148320 0.41% 140 146261 0.40% 141 147030 0.40% 142 148466 0.41% 143 148219 0.41% 144 150578 0.41% 145 151067 0.41% 146 151736 0.42% 147 152651 0.42% 148 155931 0.43% 149 153518 0.42% 150 155685 0.43% 151 29209072 79.94% 36537377 reads passed initial QC criterion=sequence-density sequence-density=0.87 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=16 prefix-density=0.89 prefix-fanout=2.0 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.34 sequence-density-rank=16 fanout-score=5.58 fanout-score-rank=1 prefix-density=0.46 prefix-fanout=4.2 sequence=CCAGCAGTGTCCCAGCCGTAGTCACCAGGGAACTCACCAGTCAAGTAGGATGGGGGCTCACCAGAGAACGGGCCCAAGTATTTAACACGGTCTGGTCCGTACCATGGGCTCCCGGAGGGAACAGGCTTGGTGGTTTTCCTCATGGAGACACGGCCATTGCCCATGATCTCAGAGGAGGAGGGGTTGAGCTTCACC criterion=sequence-density sequence-density=0.99 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=19 prefix-density=0.99 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.28 sequence-density-rank=21 fanout-score=7.71 fanout-score-rank=1 prefix-density=0.43 prefix-fanout=5.1 sequence=AACAACAACGCCTGGGCATATGCCACAAACTTCGTTCCCGGAAAGTG SRR28623300 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 16:07:18 Started mapping on | Feb 13 16:07:19 Finished on | Feb 13 16:10:32 Mapping speed, Million of reads per hour | 681.53 Number of input reads | 36537377 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 34449198 Uniquely mapped reads % | 94.28% Average mapped length | 289.11 Number of splices: Total | 29651596 Number of splices: Annotated (sjdb) | 29049807 Number of splices: GT/AG | 29016150 Number of splices: GC/AG | 528346 Number of splices: AT/AC | 21989 Number of splices: Non-canonical | 85111 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.76 Insertion rate per base | 0.02% Insertion average length | 2.36 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 986790 % of reads mapped to multiple loci | 2.70% Number of reads mapped to too many loci | 203953 % of reads mapped to too many loci | 0.56% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.30% % of reads unmapped: other | 0.16% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1101389 1101389 1101389 N_multimapping 986790 986790 986790 N_noFeature 1188458 33947962 1425489 N_ambiguous 495017 2433 229082 UnstrandedReadsAssigned:32765723 PositiveStrandReadsAssigned:498803 NegativeStrandReadsAssigned:32794627 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR28623300 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR28623300-trimmed-pair1.fastq SRR28623300-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 36,537,377 reads, 33,352,341 reads pseudoaligned [quant] estimated average fragment length: 218.696 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,185 rounds 52401 SRR28623300.ke.tsv 34699 SRR28623300.se.tsv 87100 total ==> SRR28623300.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1800.3 635 10.9664 Potri.005G024800.1.v4.1 1035 817.304 102 3.88019 Potri.004G059700.1.v4.1 961 743.32 95 3.9736 Potri.007G009000.2.v4.1 1416 1198.3 2 0.0518918 Potri.003G141000.2.v4.1 2943 2725.3 472.327 5.38845 Potri.016G087400.1.v4.1 270 99.6381 1142.64 356.551 Potri.015G069301.1.v4.1 564 351.669 0 0 Potri.010G195200.1.v4.1 1773 1555.3 0 0 Potri.012G127500.1.v4.1 977 759.315 3658 149.781 ==> SRR28623300.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 37 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 529 Potri.001G212900.v4.1 791 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR28623300 completed mapping pipeline successfully