Starting /dee2/code/volunteer_pipeline.sh SRR28623301 current disk space = 3088897069056 free memory = 1437603768 SRR28623301 SRAfilesize cd9cf7d2e4e9ef481d49478d3cae733d SRR28623301.sra SRR28623301.sra file validated SRR28623301 is paired end SRR28623301 is conventional basespace SRR28623301 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623301_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.451 37.0 37.0 37.0 37.0 37.0 2 36.4155 37.0 37.0 37.0 37.0 37.0 3 36.627 37.0 37.0 37.0 37.0 37.0 4 36.6495 37.0 37.0 37.0 37.0 37.0 5 36.6665 37.0 37.0 37.0 37.0 37.0 6 36.625 37.0 37.0 37.0 37.0 37.0 7 36.5675 37.0 37.0 37.0 37.0 37.0 8 36.4065 37.0 37.0 37.0 37.0 37.0 9 36.5885 37.0 37.0 37.0 37.0 37.0 10-14 36.599399999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.547200000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.5521 37.0 37.0 37.0 37.0 37.0 25-29 36.5141 37.0 37.0 37.0 37.0 37.0 30-34 36.476 37.0 37.0 37.0 37.0 37.0 35-39 36.438100000000006 37.0 37.0 37.0 37.0 37.0 40-44 36.4047 37.0 37.0 37.0 37.0 37.0 45-49 36.37949999999999 37.0 37.0 37.0 37.0 37.0 50-54 36.3634 37.0 37.0 37.0 37.0 37.0 55-59 36.2466 37.0 37.0 37.0 37.0 37.0 60-64 36.2348 37.0 37.0 37.0 37.0 37.0 65-69 36.255 37.0 37.0 37.0 37.0 37.0 70-74 36.153000000000006 37.0 37.0 37.0 37.0 37.0 75-79 36.188 37.0 37.0 37.0 37.0 37.0 80-84 36.084999999999994 37.0 37.0 37.0 37.0 37.0 85-89 36.0803 37.0 37.0 37.0 37.0 37.0 90-94 36.03529999999999 37.0 37.0 37.0 37.0 37.0 95-99 35.8843 37.0 37.0 37.0 37.0 37.0 100-104 36.022 37.0 37.0 37.0 37.0 37.0 105-109 36.0188 37.0 37.0 37.0 37.0 37.0 110-114 35.82340000000001 37.0 37.0 37.0 37.0 37.0 115-119 35.8785 37.0 37.0 37.0 37.0 37.0 120-124 35.7271 37.0 37.0 37.0 37.0 37.0 125-129 35.6216 37.0 37.0 37.0 37.0 37.0 130-134 35.773 37.0 37.0 37.0 37.0 37.0 135-139 35.6055 37.0 37.0 37.0 37.0 37.0 140-144 35.441500000000005 37.0 37.0 37.0 37.0 37.0 145-149 35.3466 37.0 37.0 37.0 34.6 37.0 150-151 35.16025 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 2.0 24 4.0 25 6.0 26 6.0 27 12.0 28 15.0 29 28.0 30 27.0 31 37.0 32 41.0 33 91.0 34 153.0 35 401.0 36 2889.0 37 287.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.82722250125565 12.882973380210949 11.401305876443999 41.8884982420894 2 17.625 16.175 36.8 29.4 3 17.25 18.099999999999998 29.75 34.9 4 20.825 28.275 23.400000000000002 27.500000000000004 5 23.175 33.650000000000006 24.224999999999998 18.95 6 21.95 35.15 23.05 19.85 7 14.45 28.1 39.725 17.724999999999998 8 17.675 27.450000000000003 31.075000000000003 23.799999999999997 9 17.5 24.3 33.15 25.05 10-14 19.175 31.135 27.115000000000002 22.575 15-19 19.035 29.265 28.155 23.544999999999998 20-24 19.744999999999997 29.304999999999996 27.41 23.54 25-29 19.25 29.310000000000002 28.08 23.36 30-34 19.77 29.775000000000002 27.205000000000002 23.25 35-39 19.685 29.01 27.625 23.68 40-44 20.21 29.404999999999998 27.139999999999997 23.244999999999997 45-49 20.115 29.720000000000002 26.815 23.35 50-54 19.975 29.56 27.034999999999997 23.43 55-59 19.825 28.825 27.54 23.810000000000002 60-64 19.805 29.080000000000002 27.655 23.46 65-69 19.99 29.43 27.42 23.16 70-74 19.435 28.395 28.08 24.09 75-79 19.965 29.285 27.605 23.145 80-84 19.885 29.14 27.389999999999997 23.585 85-89 20.085 28.675 27.639999999999997 23.599999999999998 90-94 20.665 27.98 28.494999999999997 22.86 95-99 20.549999999999997 29.134999999999998 27.529999999999998 22.785 100-104 19.96 28.655 27.925 23.46 105-109 20.865000000000002 28.355000000000004 27.3 23.48 110-114 20.68 29.04 27.134999999999998 23.145 115-119 19.99 29.035 27.834999999999997 23.14 120-124 20.73 28.560000000000002 26.56 24.15 125-129 20.69 29.455 26.590000000000003 23.265 130-134 21.25 28.365000000000002 26.695 23.69 135-139 21.185000000000002 28.860000000000003 25.929999999999996 24.025 140-144 21.275 28.355000000000004 26.755000000000003 23.615 145-149 21.05 28.585 26.31 24.055 150-151 21.1625 29.212500000000002 26.2875 23.3375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.5 15 0.5 16 0.0 17 1.0 18 1.0 19 0.0 20 0.5 21 0.5 22 0.5 23 1.0 24 2.0 25 3.0 26 3.5 27 8.0 28 13.0 29 16.5 30 22.5 31 33.0 32 46.0 33 64.5 34 80.0 35 86.0 36 105.5 37 126.5 38 154.0 39 177.0 40 187.0 41 207.5 42 229.0 43 245.5 44 262.0 45 265.5 46 254.5 47 240.0 48 211.5 49 195.5 50 176.0 51 132.0 52 95.5 53 79.0 54 70.5 55 49.5 56 34.5 57 30.5 58 18.5 59 13.5 60 14.0 61 9.0 62 6.5 63 5.5 64 3.0 65 3.5 66 3.5 67 2.5 68 2.5 69 2.0 70 1.0 71 0.5 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.44999999999999996 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.175 #Duplication Level Percentage of deduplicated Percentage of total 1 84.76388476388476 71.35000000000001 2 12.533412533412532 21.099999999999998 3 2.197802197802198 5.55 4 0.297000297000297 1.0 5 0.0891000891000891 0.375 6 0.0891000891000891 0.44999999999999996 7 0.029700029700029697 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TCCATGTCTGCACACGCACATGCACATAGAGAGAGGGAGAGAGAAAGAGA 7 0.17500000000000002 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACACGGTCTTATCTCGTAT 6 0.15 TruSeq Adapter, Index 5 (97% over 38bp) GTTGCATAGAGGAAGAGGTACAGTGCTGAGGAACCGGATGTGAGGTATGA 6 0.15 No Hit CAGATAATAGCAAAACAGCCAGCTTGCCATCAGAGATTGCCTTCAATCCC 6 0.15 No Hit ATGGGATCTGAAGTCTACGTGCATGAGTCCTCAGCTGCTCAACAGCTCCT 5 0.125 No Hit CTCCGTCTTTTGTTTCCTCATCAAAGACAGGCAACACTCCAGGAGCAGCC 5 0.125 No Hit CAGCTAATTCATTTGTTCATGCCAGTTGCCTTCTTAACTCCTTCAACAGC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.1125 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.225 0.0 0.0 0.0 0.0 76-77 0.225 0.0 0.0 0.0 0.0 78-79 0.275 0.0 0.0 0.0 0.0 80-81 0.3 0.0 0.0 0.0 0.0 82-83 0.3375 0.0 0.0 0.0 0.0 84-85 0.5125 0.0 0.0 0.0 0.0 86-87 0.6375 0.0 0.0 0.0 0.0 88-89 0.775 0.0 0.0 0.0 0.0 90-91 0.9875 0.0 0.0 0.0 0.0 92-93 1.1875 0.0 0.0 0.0 0.0 94-95 1.45 0.0 0.0 0.0 0.0 96-97 1.7374999999999998 0.0 0.0 0.0 0.0 98-99 1.9375 0.0 0.0 0.0 0.0 100-101 2.175 0.0 0.0 0.0 0.0 102-103 2.425 0.0 0.0 0.0 0.0 104-105 2.8625 0.0 0.0 0.0 0.0 106-107 3.275 0.0 0.0 0.0 0.0 108-109 3.775 0.0 0.0 0.0 0.0 110-111 4.325 0.0 0.0 0.0 0.0 112-113 4.725 0.0 0.0 0.0 0.0 114-115 5.125 0.0 0.0 0.0 0.0 116-117 5.65 0.0 0.0 0.0 0.0 118-119 6.137499999999999 0.0 0.0 0.0 0.0 120-121 6.737500000000001 0.0 0.0 0.0 0.0 122-123 7.375 0.0 0.0 0.0 0.0 124-125 8.1 0.0 0.0 0.0 0.0 126-127 8.7625 0.0 0.0 0.0 0.0 128-129 9.412500000000001 0.0 0.0 0.0 0.0 130-131 10.100000000000001 0.0 0.0 0.0 0.0 132-133 10.899999999999999 0.0 0.0 0.0 0.0 134-135 11.662500000000001 0.0 0.0 0.0 0.0 136-137 12.3375 0.0 0.0 0.0 0.0 138-139 13.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTCTCT 10 0.006830828 145.0 7 GGGGGGG 30 0.0014437955 24.166668 140-144 >>END_MODULE SRR28623301 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623301_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.882 37.0 37.0 37.0 37.0 37.0 2 36.389 37.0 37.0 37.0 37.0 37.0 3 36.342 37.0 37.0 37.0 37.0 37.0 4 36.36 37.0 37.0 37.0 37.0 37.0 5 36.4405 37.0 37.0 37.0 37.0 37.0 6 36.3615 37.0 37.0 37.0 37.0 37.0 7 36.4105 37.0 37.0 37.0 37.0 37.0 8 36.263 37.0 37.0 37.0 37.0 37.0 9 36.316 37.0 37.0 37.0 37.0 37.0 10-14 36.2136 37.0 37.0 37.0 37.0 37.0 15-19 36.19539999999999 37.0 37.0 37.0 37.0 37.0 20-24 36.186099999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.155499999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.0854 37.0 37.0 37.0 37.0 37.0 35-39 36.0964 37.0 37.0 37.0 37.0 37.0 40-44 36.0459 37.0 37.0 37.0 37.0 37.0 45-49 36.0633 37.0 37.0 37.0 37.0 37.0 50-54 36.04299999999999 37.0 37.0 37.0 37.0 37.0 55-59 35.8882 37.0 37.0 37.0 37.0 37.0 60-64 35.8829 37.0 37.0 37.0 37.0 37.0 65-69 35.9014 37.0 37.0 37.0 37.0 37.0 70-74 35.921099999999996 37.0 37.0 37.0 37.0 37.0 75-79 35.8752 37.0 37.0 37.0 37.0 37.0 80-84 35.7675 37.0 37.0 37.0 37.0 37.0 85-89 35.7928 37.0 37.0 37.0 37.0 37.0 90-94 35.7004 37.0 37.0 37.0 37.0 37.0 95-99 35.7487 37.0 37.0 37.0 37.0 37.0 100-104 35.5925 37.0 37.0 37.0 37.0 37.0 105-109 35.6361 37.0 37.0 37.0 37.0 37.0 110-114 35.6309 37.0 37.0 37.0 37.0 37.0 115-119 35.6746 37.0 37.0 37.0 37.0 37.0 120-124 35.6218 37.0 37.0 37.0 37.0 37.0 125-129 35.0828 37.0 37.0 37.0 32.2 37.0 130-134 35.3529 37.0 37.0 37.0 37.0 37.0 135-139 35.263 37.0 37.0 37.0 32.2 37.0 140-144 35.3198 37.0 37.0 37.0 34.6 37.0 145-149 35.113600000000005 37.0 37.0 37.0 29.8 37.0 150-151 34.7445 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 5.0 15 2.0 16 2.0 17 1.0 18 3.0 19 3.0 20 2.0 21 4.0 22 3.0 23 3.0 24 12.0 25 11.0 26 13.0 27 14.0 28 17.0 29 20.0 30 29.0 31 41.0 32 59.0 33 95.0 34 189.0 35 611.0 36 2581.0 37 279.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.7 21.2 14.549999999999999 24.55 2 27.725 25.45 30.3 16.525000000000002 3 21.55 27.750000000000004 30.95 19.75 4 24.575 33.775 23.35 18.3 5 27.05 35.975 21.6 15.375 6 22.975 38.324999999999996 20.95 17.75 7 21.55 20.525 37.875 20.05 8 21.0 27.325 26.974999999999998 24.7 9 22.525000000000002 23.974999999999998 29.45 24.05 10-14 23.84 29.29 26.14 20.73 15-19 23.294999999999998 27.755000000000003 27.589999999999996 21.36 20-24 23.77 27.685 28.03 20.515 25-29 23.535 29.205 26.834999999999997 20.424999999999997 30-34 22.515 28.720000000000002 28.175 20.59 35-39 23.275000000000002 27.500000000000004 28.560000000000002 20.665 40-44 23.419999999999998 28.49 27.83 20.26 45-49 23.39 28.249999999999996 28.694999999999997 19.665 50-54 23.28 27.415 28.965000000000003 20.34 55-59 23.369999999999997 28.384999999999998 27.445000000000004 20.8 60-64 23.425 28.535 28.26 19.78 65-69 23.77 27.400000000000002 28.775000000000002 20.055 70-74 23.505000000000003 27.83 28.9 19.765 75-79 23.369999999999997 27.794999999999998 28.415000000000003 20.419999999999998 80-84 23.505000000000003 27.994999999999997 28.92 19.580000000000002 85-89 24.23 27.915 28.084999999999997 19.77 90-94 23.544999999999998 28.345 28.4 19.71 95-99 24.13 28.625 27.639999999999997 19.605 100-104 23.65 28.605000000000004 27.98 19.765 105-109 24.44 27.925 27.505000000000003 20.13 110-114 24.345 28.01 27.650000000000002 19.994999999999997 115-119 25.21 27.875 27.400000000000002 19.515 120-124 24.715 27.725 28.060000000000002 19.5 125-129 25.915 27.284999999999997 27.894999999999996 18.905 130-134 25.624999999999996 28.22 27.205000000000002 18.95 135-139 26.195 27.92 26.640000000000004 19.245 140-144 26.534999999999997 27.295 27.694999999999997 18.475 145-149 26.245 27.21 27.935 18.61 150-151 27.5875 26.6125 27.925 17.875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 1.0 9 0.5 10 1.0 11 2.0 12 2.0 13 1.0 14 0.5 15 0.5 16 0.5 17 0.5 18 2.0 19 3.0 20 1.5 21 1.0 22 1.5 23 0.5 24 0.5 25 3.0 26 3.5 27 4.5 28 7.5 29 11.0 30 18.0 31 23.5 32 29.5 33 42.5 34 54.5 35 66.5 36 87.0 37 114.0 38 142.0 39 172.5 40 202.0 41 225.0 42 256.5 43 285.0 44 292.0 45 281.0 46 263.5 47 238.0 48 220.5 49 205.5 50 162.0 51 125.5 52 108.5 53 82.5 54 63.0 55 49.5 56 34.0 57 24.0 58 17.5 59 13.0 60 9.0 61 7.5 62 5.5 63 3.5 64 1.0 65 1.0 66 1.5 67 1.0 68 1.5 69 2.0 70 1.0 71 0.5 72 0.5 73 0.0 74 0.5 75 1.0 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 1.0 84 1.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.5 90 1.5 91 1.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 1.0 100 4.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.05 #Duplication Level Percentage of deduplicated Percentage of total 1 85.68489124044679 72.875 2 11.757789535567314 20.0 3 2.1457965902410345 5.475 4 0.29394473838918284 1.0 5 0.029394473838918283 0.125 6 0.029394473838918283 0.15 7 0.029394473838918283 0.17500000000000002 8 0.029394473838918283 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 8 0.2 No Hit GTTGTACAGCTTGGCTCTTCGAATAAAGTTATTGAGGATGTTAATTTGGT 7 0.17500000000000002 No Hit CAAAATTCCGAGACAGATCCCAGAGCAGGCTTGGTACATGAACCCAGCCT 6 0.15 No Hit GTTGAAAGCATGCTGCTCGCTGTTGAACTTAAGGATATAATAAATTATCC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.1125 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.225 0.0 0.0 0.0 0.0 76-77 0.225 0.0 0.0 0.0 0.0 78-79 0.275 0.0 0.0 0.0 0.0 80-81 0.3 0.0 0.0 0.0 0.0 82-83 0.3375 0.0 0.0 0.0 0.0 84-85 0.5125 0.0 0.0 0.0 0.0 86-87 0.6625000000000001 0.0 0.0 0.0 0.0 88-89 0.8 0.0 0.0 0.0 0.0 90-91 1.0125 0.0 0.0 0.0 0.0 92-93 1.2125 0.0 0.0 0.0 0.0 94-95 1.4625 0.0 0.0 0.0 0.0 96-97 1.7374999999999998 0.0 0.0 0.0 0.0 98-99 1.9625 0.0 0.0 0.0 0.0 100-101 2.175 0.0 0.0 0.0 0.0 102-103 2.5 0.0 0.0 0.0 0.0 104-105 2.9625000000000004 0.0 0.0 0.0 0.0 106-107 3.375 0.0 0.0 0.0 0.0 108-109 3.9 0.0 0.0 0.0 0.0 110-111 4.45 0.0 0.0 0.0 0.0 112-113 4.8625 0.0 0.0 0.0 0.0 114-115 5.275 0.0 0.0 0.0 0.0 116-117 5.825 0.0 0.0 0.0 0.0 118-119 6.3125 0.0 0.0 0.0 0.0 120-121 6.925000000000001 0.0 0.0 0.0 0.0 122-123 7.6 0.0 0.0 0.0 0.0 124-125 8.325 0.0 0.0 0.0 0.0 126-127 8.9875 0.0 0.0 0.0 0.0 128-129 9.6375 0.0 0.0 0.0 0.0 130-131 10.375 0.0 0.0 0.0 0.0 132-133 11.2125 0.0 0.0 0.0 0.0 134-135 11.9875 0.0 0.0 0.0 0.0 136-137 12.6625 0.0 0.0 0.0 0.0 138-139 13.525 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTGCACT 10 0.006830828 145.0 9 TTGCCAA 10 0.006830828 145.0 8 >>END_MODULE Read 2230148 spots for SRR28623301.sra Written 2230148 spots for SRR28623301.sra Read 2230148 spots for SRR28623301.sra Written 2230148 spots for SRR28623301.sra Read 2230148 spots for SRR28623301.sra Written 2230148 spots for SRR28623301.sra Read 2230148 spots for SRR28623301.sra Written 2230148 spots for SRR28623301.sra Read 2230148 spots for SRR28623301.sra Written 2230148 spots for SRR28623301.sra Read 2230148 spots for SRR28623301.sra Written 2230148 spots for SRR28623301.sra Read 2230148 spots for SRR28623301.sra Written 2230148 spots for SRR28623301.sra Read 2230148 spots for SRR28623301.sra Written 2230148 spots for SRR28623301.sra Read 2230148 spots for SRR28623301.sra Written 2230148 spots for SRR28623301.sra Read 2230148 spots for SRR28623301.sra Written 2230148 spots for SRR28623301.sra Read 2230148 spots for SRR28623301.sra Written 2230148 spots for SRR28623301.sra Read 2230148 spots for SRR28623301.sra Written 2230148 spots for SRR28623301.sra Read 2230148 spots for SRR28623301.sra Written 2230148 spots for SRR28623301.sra Read 2230148 spots for SRR28623301.sra Written 2230148 spots for SRR28623301.sra Read 2230148 spots for SRR28623301.sra Written 2230148 spots for SRR28623301.sra Read 2230148 spots for SRR28623301.sra Written 2230148 spots for SRR28623301.sra Read 2230167 spots for SRR28623301.sra Written 2230167 spots for SRR28623301.sra Read 2230148 spots for SRR28623301.sra Written 2230148 spots for SRR28623301.sra Read 2230148 spots for SRR28623301.sra Written 2230148 spots for SRR28623301.sra Read 2230148 spots for SRR28623301.sra Written 2230148 spots for SRR28623301.sra SRR ids: ['SRR28623301.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_cgulivqt SRR28623301.sra spots: 44602979 blocks: [[1, 2230148], [2230149, 4460296], [4460297, 6690444], [6690445, 8920592], [8920593, 11150740], [11150741, 13380888], [13380889, 15611036], [15611037, 17841184], [17841185, 20071332], [20071333, 22301480], [22301481, 24531628], [24531629, 26761776], [26761777, 28991924], [28991925, 31222072], [31222073, 33452220], [33452221, 35682368], [35682369, 37912516], [37912517, 40142664], [40142665, 42372812], [42372813, 44602979]] SRR28623301 file size 16474209 SRR28623301 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR28623301 SRR28623301_1.fastq SRR28623301_2.fastq Input file: SRR28623301_1.fastq Paired file: SRR28623301_2.fastq trimmed: SRR28623301-trimmed-pair1.fastq, SRR28623301-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 16:21:32 2025 >> started Thu Feb 13 16:22:30 2025 >> done (57.888s) 44602979 read pairs processed; of these: 34 ( 0.00%) short read pairs filtered out after trimming by size control 33550 ( 0.08%) empty read pairs filtered out after trimming by size control 44569395 (99.92%) read pairs available; of these: 8051792 (18.07%) trimmed read pairs available after processing 36517603 (81.93%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 6 0.00% 20 6 0.00% 21 6 0.00% 22 9 0.00% 23 12 0.00% 24 17 0.00% 25 13 0.00% 26 14 0.00% 27 12 0.00% 28 17 0.00% 29 16 0.00% 30 21 0.00% 31 24 0.00% 32 26 0.00% 33 25 0.00% 34 37 0.00% 35 48 0.00% 36 45 0.00% 37 53 0.00% 38 47 0.00% 39 68 0.00% 40 72 0.00% 41 93 0.00% 42 96 0.00% 43 130 0.00% 44 124 0.00% 45 154 0.00% 46 178 0.00% 47 159 0.00% 48 230 0.00% 49 244 0.00% 50 332 0.00% 51 352 0.00% 52 432 0.00% 53 419 0.00% 54 502 0.00% 55 533 0.00% 56 636 0.00% 57 760 0.00% 58 884 0.00% 59 1023 0.00% 60 1178 0.00% 61 1315 0.00% 62 1483 0.00% 63 1790 0.00% 64 1996 0.00% 65 2272 0.01% 66 2523 0.01% 67 2747 0.01% 68 3291 0.01% 69 3680 0.01% 70 4342 0.01% 71 5101 0.01% 72 5833 0.01% 73 6798 0.02% 74 7682 0.02% 75 8747 0.02% 76 9716 0.02% 77 10416 0.02% 78 11969 0.03% 79 13363 0.03% 80 14817 0.03% 81 16865 0.04% 82 19010 0.04% 83 21479 0.05% 84 23392 0.05% 85 26069 0.06% 86 28122 0.06% 87 30355 0.07% 88 32748 0.07% 89 34861 0.08% 90 38268 0.09% 91 41201 0.09% 92 44528 0.10% 93 48494 0.11% 94 52106 0.12% 95 55463 0.12% 96 58389 0.13% 97 62110 0.14% 98 64816 0.15% 99 67716 0.15% 100 71123 0.16% 101 74440 0.17% 102 78322 0.18% 103 83096 0.19% 104 86269 0.19% 105 90700 0.20% 106 94055 0.21% 107 96937 0.22% 108 99046 0.22% 109 101635 0.23% 110 104092 0.23% 111 107708 0.24% 112 111569 0.25% 113 114063 0.26% 114 117314 0.26% 115 122021 0.27% 116 125067 0.28% 117 127119 0.29% 118 130571 0.29% 119 131238 0.29% 120 134111 0.30% 121 137142 0.31% 122 138341 0.31% 123 141064 0.32% 124 145470 0.33% 125 148549 0.33% 126 151342 0.34% 127 153108 0.34% 128 154190 0.35% 129 155186 0.35% 130 158599 0.36% 131 159010 0.36% 132 160693 0.36% 133 163856 0.37% 134 162700 0.37% 135 165279 0.37% 136 168196 0.38% 137 170093 0.38% 138 172138 0.39% 139 173603 0.39% 140 174238 0.39% 141 175226 0.39% 142 176872 0.40% 143 176461 0.40% 144 178488 0.40% 145 179906 0.40% 146 180983 0.41% 147 181950 0.41% 148 185112 0.42% 149 183213 0.41% 150 185358 0.42% 151 36517603 81.93% 44569395 reads passed initial QC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=2.13 fanout-score-rank=38 prefix-density=0.14 prefix-fanout=2.1 sequence=ACTGATTCCTTTGCA criterion=fanout-score sequence-density=0.07 sequence-density-rank=15 fanout-score=425.09 fanout-score-rank=1 prefix-density=0.96 prefix-fanout=33.1 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=3.45 fanout-score-rank=34 prefix-density=0.30 prefix-fanout=2.9 sequence=ATAGAGAGAAAGA criterion=fanout-score sequence-density=0.07 sequence-density-rank=12 fanout-score=385.76 fanout-score-rank=1 prefix-density=0.89 prefix-fanout=31.6 sequence=GAAGAAGAAGAAA SRR28623301 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 16:23:27 Started mapping on | Feb 13 16:23:27 Finished on | Feb 13 16:27:33 Mapping speed, Million of reads per hour | 652.24 Number of input reads | 44569395 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 41873425 Uniquely mapped reads % | 93.95% Average mapped length | 290.69 Number of splices: Total | 37538053 Number of splices: Annotated (sjdb) | 36682365 Number of splices: GT/AG | 36902168 Number of splices: GC/AG | 482459 Number of splices: AT/AC | 32968 Number of splices: Non-canonical | 120458 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.03% Deletion average length | 2.86 Insertion rate per base | 0.03% Insertion average length | 2.39 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1144220 % of reads mapped to multiple loci | 2.57% Number of reads mapped to too many loci | 290902 % of reads mapped to too many loci | 0.65% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.62% % of reads unmapped: other | 0.21% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1551750 1551750 1551750 N_multimapping 1144220 1144220 1144220 N_noFeature 1558965 41374366 1815214 N_ambiguous 474989 3280 229910 UnstrandedReadsAssigned:39839471 PositiveStrandReadsAssigned:495779 NegativeStrandReadsAssigned:39828301 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR28623301 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR28623301-trimmed-pair1.fastq SRR28623301-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 44,569,395 reads, 40,324,071 reads pseudoaligned [quant] estimated average fragment length: 221.544 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,039 rounds 52401 SRR28623301.ke.tsv 34699 SRR28623301.se.tsv 87100 total ==> SRR28623301.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1797.46 1167 15.5379 Potri.005G024800.1.v4.1 1035 814.456 815 23.948 Potri.004G059700.1.v4.1 961 740.483 147 4.75096 Potri.007G009000.2.v4.1 1416 1195.46 0 0 Potri.003G141000.2.v4.1 2943 2722.46 1178.78 10.3622 Potri.016G087400.1.v4.1 270 96.5584 3455.73 856.502 Potri.015G069301.1.v4.1 564 348.391 0 0 Potri.010G195200.1.v4.1 1773 1552.46 202 3.11395 Potri.012G127500.1.v4.1 977 756.461 36587 1157.49 ==> SRR28623301.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 528 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 553 Potri.001G212900.v4.1 162 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 4 Potri.001G452600.v4.1 3 SRR28623301 completed mapping pipeline successfully