Starting /dee2/code/volunteer_pipeline.sh SRR28623302 current disk space = 3088745975808 free memory = 1493305344 SRR28623302 SRAfilesize 41b8b6692f5fec2dac601cb914d81e15 SRR28623302.sra SRR28623302.sra file validated SRR28623302 is paired end SRR28623302 is conventional basespace SRR28623302 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623302_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3825 37.0 37.0 37.0 37.0 37.0 2 36.3625 37.0 37.0 37.0 37.0 37.0 3 36.5885 37.0 37.0 37.0 37.0 37.0 4 36.6605 37.0 37.0 37.0 37.0 37.0 5 36.6225 37.0 37.0 37.0 37.0 37.0 6 36.5875 37.0 37.0 37.0 37.0 37.0 7 36.6135 37.0 37.0 37.0 37.0 37.0 8 36.4405 37.0 37.0 37.0 37.0 37.0 9 36.5525 37.0 37.0 37.0 37.0 37.0 10-14 36.55159999999999 37.0 37.0 37.0 37.0 37.0 15-19 36.520300000000006 37.0 37.0 37.0 37.0 37.0 20-24 36.493700000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.494299999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.461 37.0 37.0 37.0 37.0 37.0 35-39 36.3898 37.0 37.0 37.0 37.0 37.0 40-44 36.3937 37.0 37.0 37.0 37.0 37.0 45-49 36.3648 37.0 37.0 37.0 37.0 37.0 50-54 36.3293 37.0 37.0 37.0 37.0 37.0 55-59 36.308499999999995 37.0 37.0 37.0 37.0 37.0 60-64 36.31940000000001 37.0 37.0 37.0 37.0 37.0 65-69 36.32860000000001 37.0 37.0 37.0 37.0 37.0 70-74 36.204600000000006 37.0 37.0 37.0 37.0 37.0 75-79 36.1333 37.0 37.0 37.0 37.0 37.0 80-84 36.112199999999994 37.0 37.0 37.0 37.0 37.0 85-89 36.1326 37.0 37.0 37.0 37.0 37.0 90-94 36.05 37.0 37.0 37.0 37.0 37.0 95-99 35.8827 37.0 37.0 37.0 37.0 37.0 100-104 35.9904 37.0 37.0 37.0 37.0 37.0 105-109 35.9688 37.0 37.0 37.0 37.0 37.0 110-114 35.835499999999996 37.0 37.0 37.0 37.0 37.0 115-119 35.900999999999996 37.0 37.0 37.0 37.0 37.0 120-124 35.7539 37.0 37.0 37.0 37.0 37.0 125-129 35.6238 37.0 37.0 37.0 37.0 37.0 130-134 35.8344 37.0 37.0 37.0 37.0 37.0 135-139 35.6732 37.0 37.0 37.0 37.0 37.0 140-144 35.4477 37.0 37.0 37.0 37.0 37.0 145-149 35.4 37.0 37.0 37.0 34.6 37.0 150-151 35.30575 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 1.0 22 1.0 23 1.0 24 3.0 25 4.0 26 9.0 27 15.0 28 8.0 29 24.0 30 24.0 31 44.0 32 42.0 33 84.0 34 163.0 35 402.0 36 2909.0 37 265.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.43452082288008 13.020572002007025 8.805820371299548 39.73908680381334 2 18.875 15.975 36.725 28.425 3 17.4 19.5 28.025 35.075 4 22.6 25.900000000000002 25.45 26.05 5 23.025000000000002 33.975 23.225 19.775000000000002 6 19.6 35.975 23.425 21.0 7 14.475 28.449999999999996 40.300000000000004 16.775000000000002 8 17.1 26.674999999999997 30.975 25.25 9 17.299999999999997 24.575 35.85 22.275 10-14 19.415 31.0 26.085 23.5 15-19 19.255 28.71 28.499999999999996 23.535 20-24 19.255 28.665000000000003 28.33 23.75 25-29 19.625 29.15 28.345 22.88 30-34 19.725 28.73 27.98 23.565 35-39 20.150000000000002 28.63 27.584999999999997 23.635 40-44 19.59 29.37 28.04 23.0 45-49 19.535 29.13 28.175 23.16 50-54 19.634999999999998 28.425 28.04 23.9 55-59 18.93 28.775000000000002 28.475 23.82 60-64 20.405 28.51 27.275 23.810000000000002 65-69 19.81 29.255 27.365000000000002 23.57 70-74 19.634999999999998 28.439999999999998 27.76 24.165 75-79 19.89 28.08 28.139999999999997 23.89 80-84 19.955000000000002 28.945 27.750000000000004 23.35 85-89 19.485 30.130000000000003 27.485 22.900000000000002 90-94 19.89 29.354999999999997 27.084999999999997 23.669999999999998 95-99 19.67 28.59 28.01 23.73 100-104 20.1 28.305000000000003 28.595 23.0 105-109 20.39 28.075 27.860000000000003 23.674999999999997 110-114 20.31 29.07 27.034999999999997 23.585 115-119 19.830000000000002 28.585 27.655 23.93 120-124 20.495 28.58 27.725 23.200000000000003 125-129 20.79 28.449999999999996 26.805 23.955000000000002 130-134 20.225 29.25 27.029999999999998 23.494999999999997 135-139 20.62 28.825 26.400000000000002 24.154999999999998 140-144 20.4 28.21 26.915 24.474999999999998 145-149 20.365 27.82 27.634999999999998 24.18 150-151 20.3375 28.6625 26.650000000000002 24.349999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 1.0 21 1.5 22 2.5 23 3.5 24 3.0 25 5.0 26 6.5 27 9.5 28 17.5 29 18.0 30 19.0 31 23.0 32 37.5 33 55.5 34 60.5 35 88.0 36 118.5 37 133.5 38 143.0 39 149.0 40 183.5 41 224.0 42 243.5 43 255.5 44 273.5 45 265.0 46 256.5 47 251.5 48 220.0 49 183.0 50 157.0 51 143.0 52 109.0 53 88.0 54 75.0 55 43.5 56 27.5 57 28.0 58 20.5 59 11.0 60 12.5 61 12.0 62 6.5 63 4.5 64 3.0 65 2.0 66 1.0 67 0.5 68 0.0 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.35000000000000003 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.275 #Duplication Level Percentage of deduplicated Percentage of total 1 86.0451480504251 73.375 2 11.316329522134271 19.3 3 2.1108179419525066 5.4 4 0.4104368220463207 1.4000000000000001 5 0.08795074758135445 0.375 6 0.02931691586045148 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATTGCCAAAACCGCTGCTCATTCCATCTCTATTGCCAAAACCTCTTGCTC 6 0.15 No Hit GAAAACAATCAGACACCAAATAATAACAAACGAAGCAGAACGAGTTTGGC 5 0.125 No Hit GGTATTTCTACCAGAAGACGAATGCTTCTGCTCTGAAGATAAAGCAGCTG 5 0.125 No Hit CTATCGTTTTCATTTGCCCTTTCTTCTCTTTGGTTAATAATTCTTTGACT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.32499999999999996 0.0 0.0 0.0 0.0 82-83 0.4 0.0 0.0 0.0 0.0 84-85 0.475 0.0 0.0 0.0 0.0 86-87 0.5874999999999999 0.0 0.0 0.0 0.0 88-89 0.8 0.0 0.0 0.0 0.0 90-91 0.925 0.0 0.0 0.0 0.0 92-93 1.25 0.0 0.0 0.0 0.0 94-95 1.3625 0.0 0.0 0.0 0.0 96-97 1.4500000000000002 0.0 0.0 0.0 0.0 98-99 1.65 0.0 0.0 0.0 0.0 100-101 1.95 0.0 0.0 0.0 0.0 102-103 2.2375 0.0 0.0 0.0 0.0 104-105 2.6625 0.0 0.0 0.0 0.0 106-107 3.0625 0.0 0.0 0.0 0.0 108-109 3.2875 0.0 0.0 0.0 0.0 110-111 3.575 0.0 0.0 0.0 0.0 112-113 4.0 0.0 0.0 0.0 0.0 114-115 4.55 0.0 0.0 0.0 0.0 116-117 5.0625 0.0 0.0 0.0 0.0 118-119 5.525 0.0 0.0 0.0 0.0 120-121 5.8625 0.0 0.0 0.0 0.0 122-123 6.275 0.0 0.0 0.0 0.0 124-125 6.875 0.0 0.0 0.0 0.0 126-127 7.3375 0.0 0.0 0.0 0.0 128-129 8.075 0.0 0.0 0.0 0.0 130-131 8.7625 0.0 0.0 0.0 0.0 132-133 9.225 0.0 0.0 0.0 0.0 134-135 9.975000000000001 0.0 0.0 0.0 0.0 136-137 10.6375 0.0 0.0 0.0 0.0 138-139 11.1875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR28623302 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623302_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.739 37.0 37.0 37.0 37.0 37.0 2 36.247 37.0 37.0 37.0 37.0 37.0 3 36.297 37.0 37.0 37.0 37.0 37.0 4 36.271 37.0 37.0 37.0 37.0 37.0 5 36.3825 37.0 37.0 37.0 37.0 37.0 6 36.2665 37.0 37.0 37.0 37.0 37.0 7 36.2525 37.0 37.0 37.0 37.0 37.0 8 36.2555 37.0 37.0 37.0 37.0 37.0 9 36.25 37.0 37.0 37.0 37.0 37.0 10-14 36.189299999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.1491 37.0 37.0 37.0 37.0 37.0 20-24 36.16930000000001 37.0 37.0 37.0 37.0 37.0 25-29 36.1134 37.0 37.0 37.0 37.0 37.0 30-34 35.9956 37.0 37.0 37.0 37.0 37.0 35-39 36.0048 37.0 37.0 37.0 37.0 37.0 40-44 35.983399999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.0326 37.0 37.0 37.0 37.0 37.0 50-54 35.9655 37.0 37.0 37.0 37.0 37.0 55-59 35.822500000000005 37.0 37.0 37.0 37.0 37.0 60-64 35.816700000000004 37.0 37.0 37.0 37.0 37.0 65-69 35.8321 37.0 37.0 37.0 37.0 37.0 70-74 35.836 37.0 37.0 37.0 37.0 37.0 75-79 35.8748 37.0 37.0 37.0 37.0 37.0 80-84 35.7974 37.0 37.0 37.0 37.0 37.0 85-89 35.7008 37.0 37.0 37.0 37.0 37.0 90-94 35.6877 37.0 37.0 37.0 37.0 37.0 95-99 35.6254 37.0 37.0 37.0 37.0 37.0 100-104 35.5597 37.0 37.0 37.0 37.0 37.0 105-109 35.5019 37.0 37.0 37.0 37.0 37.0 110-114 35.5766 37.0 37.0 37.0 37.0 37.0 115-119 35.488200000000006 37.0 37.0 37.0 37.0 37.0 120-124 35.46810000000001 37.0 37.0 37.0 37.0 37.0 125-129 35.0642 37.0 37.0 37.0 32.2 37.0 130-134 35.357600000000005 37.0 37.0 37.0 34.6 37.0 135-139 35.1454 37.0 37.0 37.0 29.8 37.0 140-144 35.1401 37.0 37.0 37.0 32.2 37.0 145-149 35.122699999999995 37.0 37.0 37.0 27.4 37.0 150-151 34.76075 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 11.0 15 4.0 16 7.0 17 1.0 18 1.0 19 2.0 20 2.0 21 4.0 22 4.0 23 3.0 24 8.0 25 8.0 26 4.0 27 15.0 28 17.0 29 21.0 30 25.0 31 36.0 32 62.0 33 98.0 34 244.0 35 656.0 36 2499.0 37 266.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.475 21.375 11.725 25.424999999999997 2 27.575 25.75 30.075000000000003 16.6 3 21.45 26.400000000000002 32.45 19.7 4 25.174999999999997 33.75 23.95 17.125 5 26.900000000000002 34.925 22.625 15.55 6 20.549999999999997 39.425 21.8 18.224999999999998 7 21.7 20.95 39.324999999999996 18.025 8 21.075 26.275 29.325000000000003 23.325000000000003 9 22.225 24.25 30.45 23.075000000000003 10-14 23.580000000000002 29.64 26.200000000000003 20.580000000000002 15-19 23.400000000000002 28.935 27.67 19.994999999999997 20-24 23.52 28.53 27.750000000000004 20.200000000000003 25-29 23.57 29.020000000000003 26.915 20.495 30-34 23.325000000000003 28.754999999999995 27.48 20.44 35-39 23.055 28.87 27.92 20.155 40-44 22.770000000000003 28.275 28.689999999999998 20.265 45-49 22.994999999999997 28.875 27.6 20.53 50-54 22.79 29.64 27.750000000000004 19.82 55-59 23.53 28.105000000000004 28.13 20.235 60-64 23.1 28.43 28.7 19.77 65-69 23.035 29.435 27.634999999999998 19.895 70-74 23.74 28.335 28.294999999999998 19.63 75-79 23.244999999999997 28.585 28.544999999999998 19.625 80-84 22.655 28.660000000000004 28.455000000000002 20.23 85-89 23.895 28.4 27.825 19.88 90-94 23.580000000000002 28.74 27.694999999999997 19.985 95-99 23.93 27.900000000000002 28.435 19.735 100-104 24.015 28.605000000000004 27.900000000000002 19.48 105-109 23.22 28.095 28.95 19.735 110-114 23.674999999999997 28.945 27.474999999999998 19.905 115-119 24.154999999999998 28.675 27.35 19.82 120-124 24.725 27.72 27.925 19.63 125-129 24.92 28.7 27.250000000000004 19.13 130-134 24.865000000000002 28.410000000000004 27.6 19.125 135-139 25.39 28.035 27.034999999999997 19.54 140-144 24.675 28.7 27.355 19.27 145-149 25.88 28.825 27.075 18.22 150-151 25.5375 29.225 26.5 18.7375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 1.0 9 0.0 10 0.0 11 1.5 12 1.5 13 1.0 14 1.0 15 0.0 16 1.0 17 1.5 18 0.5 19 0.5 20 1.5 21 1.5 22 2.0 23 4.0 24 5.0 25 4.5 26 6.0 27 7.0 28 9.0 29 11.5 30 15.5 31 20.5 32 43.0 33 54.5 34 61.0 35 77.5 36 90.5 37 133.0 38 170.0 39 180.0 40 202.5 41 239.0 42 255.0 43 261.0 44 270.5 45 268.5 46 257.5 47 228.5 48 206.0 49 186.0 50 159.0 51 124.5 52 88.0 53 73.0 54 61.0 55 52.5 56 37.5 57 28.0 58 21.5 59 14.0 60 13.0 61 12.0 62 10.0 63 5.5 64 3.5 65 2.5 66 1.5 67 0.5 68 0.0 69 0.5 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.5 79 0.5 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.5 100 2.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.575 #Duplication Level Percentage of deduplicated Percentage of total 1 86.26935436751387 73.825 2 11.247443762781186 19.25 3 1.98656149576395 5.1 4 0.35056967572305 1.2 5 0.1460706982179375 0.625 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGAAGAGAAGAGGAAGGCCCTGCAGGCACTTAAGACAGAAGGAAGAAAGG 5 0.125 No Hit AATTTATCAAAACAAAAGAGCCCTGTTACAAATGATCTATCTTTATCAAA 5 0.125 No Hit AGAGAAGTCTCTGGAGGTAGAGGCGAAATTGCGTGCTGCTGATGCCAAGC 5 0.125 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit GCAGCTCTCGAGGAAGAAGCCGAGATGGTTTCCCTCAAACTCCAAAAGCG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.32499999999999996 0.0 0.0 0.0 0.0 82-83 0.4 0.0 0.0 0.0 0.0 84-85 0.475 0.0 0.0 0.0 0.0 86-87 0.5874999999999999 0.0 0.0 0.0 0.0 88-89 0.8 0.0 0.0 0.0 0.0 90-91 0.925 0.0 0.0 0.0 0.0 92-93 1.25 0.0 0.0 0.0 0.0 94-95 1.3625 0.0 0.0 0.0 0.0 96-97 1.4500000000000002 0.0 0.0 0.0 0.0 98-99 1.675 0.0 0.0 0.0 0.0 100-101 1.95 0.0 0.0 0.0 0.0 102-103 2.2375 0.0 0.0 0.0 0.0 104-105 2.6875 0.0 0.0 0.0 0.0 106-107 3.075 0.0 0.0 0.0 0.0 108-109 3.3 0.0 0.0 0.0 0.0 110-111 3.625 0.0 0.0 0.0 0.0 112-113 4.0625 0.0 0.0 0.0 0.0 114-115 4.625 0.0 0.0 0.0 0.0 116-117 5.137499999999999 0.0 0.0 0.0 0.0 118-119 5.6125 0.0 0.0 0.0 0.0 120-121 5.9625 0.0 0.0 0.0 0.0 122-123 6.325 0.0 0.0 0.0 0.0 124-125 6.949999999999999 0.0 0.0 0.0 0.0 126-127 7.375 0.0 0.0 0.0 0.0 128-129 8.125 0.0 0.0 0.0 0.0 130-131 8.825 0.0 0.0 0.0 0.0 132-133 9.325 0.0 0.0 0.0 0.0 134-135 10.0875 0.0 0.0 0.0 0.0 136-137 10.7625 0.0 0.0 0.0 0.0 138-139 11.35 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTGGAT 10 0.006830828 145.0 8 >>END_MODULE Read 1539279 spots for SRR28623302.sra Written 1539279 spots for SRR28623302.sra Read 1539279 spots for SRR28623302.sra Written 1539279 spots for SRR28623302.sra Read 1539279 spots for SRR28623302.sra Written 1539279 spots for SRR28623302.sra Read 1539279 spots for SRR28623302.sra Written 1539279 spots for SRR28623302.sra Read 1539279 spots for SRR28623302.sra Written 1539279 spots for SRR28623302.sra Read 1539279 spots for SRR28623302.sra Written 1539279 spots for SRR28623302.sra Read 1539279 spots for SRR28623302.sra Written 1539279 spots for SRR28623302.sra Read 1539279 spots for SRR28623302.sra Written 1539279 spots for SRR28623302.sra Read 1539279 spots for SRR28623302.sra Written 1539279 spots for SRR28623302.sra Read 1539279 spots for SRR28623302.sra Written 1539279 spots for SRR28623302.sra Read 1539279 spots for SRR28623302.sra Written 1539279 spots for SRR28623302.sra Read 1539279 spots for SRR28623302.sra Written 1539279 spots for SRR28623302.sra Read 1539279 spots for SRR28623302.sra Written 1539279 spots for SRR28623302.sra Read 1539279 spots for SRR28623302.sra Written 1539279 spots for SRR28623302.sra Read 1539279 spots for SRR28623302.sra Written 1539279 spots for SRR28623302.sra Read 1539279 spots for SRR28623302.sra Written 1539279 spots for SRR28623302.sra Read 1539279 spots for SRR28623302.sra Written 1539279 spots for SRR28623302.sra Read 1539279 spots for SRR28623302.sra Written 1539279 spots for SRR28623302.sra Read 1539294 spots for SRR28623302.sra Written 1539294 spots for SRR28623302.sra Read 1539279 spots for SRR28623302.sra Written 1539279 spots for SRR28623302.sra SRR ids: ['SRR28623302.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vo3ocph4 SRR28623302.sra spots: 30785595 blocks: [[1, 1539279], [1539280, 3078558], [3078559, 4617837], [4617838, 6157116], [6157117, 7696395], [7696396, 9235674], [9235675, 10774953], [10774954, 12314232], [12314233, 13853511], [13853512, 15392790], [15392791, 16932069], [16932070, 18471348], [18471349, 20010627], [20010628, 21549906], [21549907, 23089185], [23089186, 24628464], [24628465, 26167743], [26167744, 27707022], [27707023, 29246301], [29246302, 30785595]] SRR28623302 file size 11367348 SRR28623302 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR28623302 SRR28623302_1.fastq SRR28623302_2.fastq Input file: SRR28623302_1.fastq Paired file: SRR28623302_2.fastq trimmed: SRR28623302-trimmed-pair1.fastq, SRR28623302-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 16:30:22 2025 >> started Thu Feb 13 16:30:57 2025 >> done (34.842s) 30785595 read pairs processed; of these: 24 ( 0.00%) short read pairs filtered out after trimming by size control 8447 ( 0.03%) empty read pairs filtered out after trimming by size control 30777124 (99.97%) read pairs available; of these: 4785872 (15.55%) trimmed read pairs available after processing 25991252 (84.45%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 1 0.00% 20 6 0.00% 21 2 0.00% 22 9 0.00% 23 7 0.00% 24 10 0.00% 25 6 0.00% 26 8 0.00% 27 12 0.00% 28 10 0.00% 29 11 0.00% 30 12 0.00% 31 14 0.00% 32 16 0.00% 33 20 0.00% 34 14 0.00% 35 27 0.00% 36 23 0.00% 37 37 0.00% 38 36 0.00% 39 46 0.00% 40 42 0.00% 41 64 0.00% 42 60 0.00% 43 59 0.00% 44 75 0.00% 45 70 0.00% 46 89 0.00% 47 89 0.00% 48 134 0.00% 49 129 0.00% 50 150 0.00% 51 191 0.00% 52 211 0.00% 53 278 0.00% 54 297 0.00% 55 318 0.00% 56 371 0.00% 57 409 0.00% 58 522 0.00% 59 616 0.00% 60 680 0.00% 61 853 0.00% 62 963 0.00% 63 1082 0.00% 64 1330 0.00% 65 1495 0.00% 66 1571 0.01% 67 1822 0.01% 68 2156 0.01% 69 2454 0.01% 70 2704 0.01% 71 3257 0.01% 72 3610 0.01% 73 4400 0.01% 74 4771 0.02% 75 5572 0.02% 76 6143 0.02% 77 6878 0.02% 78 7595 0.02% 79 8500 0.03% 80 9337 0.03% 81 10561 0.03% 82 12047 0.04% 83 13042 0.04% 84 14506 0.05% 85 15909 0.05% 86 17111 0.06% 87 18480 0.06% 88 19966 0.06% 89 20952 0.07% 90 22790 0.07% 91 24511 0.08% 92 25764 0.08% 93 27903 0.09% 94 29850 0.10% 95 32265 0.10% 96 33775 0.11% 97 35629 0.12% 98 37050 0.12% 99 38698 0.13% 100 40815 0.13% 101 41550 0.14% 102 43977 0.14% 103 46361 0.15% 104 48158 0.16% 105 50376 0.16% 106 52319 0.17% 107 54655 0.18% 108 55910 0.18% 109 57940 0.19% 110 58487 0.19% 111 60803 0.20% 112 62409 0.20% 113 63802 0.21% 114 66336 0.22% 115 69064 0.22% 116 70173 0.23% 117 72955 0.24% 118 74470 0.24% 119 75710 0.25% 120 77543 0.25% 121 79013 0.26% 122 79949 0.26% 123 82233 0.27% 124 84448 0.27% 125 85320 0.28% 126 87948 0.29% 127 89971 0.29% 128 90453 0.29% 129 92515 0.30% 130 93895 0.31% 131 94581 0.31% 132 96237 0.31% 133 98319 0.32% 134 98971 0.32% 135 100517 0.33% 136 102622 0.33% 137 103114 0.34% 138 104593 0.34% 139 105981 0.34% 140 107636 0.35% 141 108834 0.35% 142 110171 0.36% 143 110142 0.36% 144 112032 0.36% 145 112686 0.37% 146 113149 0.37% 147 113817 0.37% 148 115589 0.38% 149 116614 0.38% 150 118222 0.38% 151 25991252 84.45% 30777124 reads passed initial QC criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=10.59 fanout-score-rank=21 prefix-density=0.07 prefix-fanout=10.6 sequence=GGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTCTCACATCTCGTATGCCGTCTTCTGCTTG criterion=fanout-score sequence-density=0.06 sequence-density-rank=23 fanout-score=517.17 fanout-score-rank=1 prefix-density=0.84 prefix-fanout=35.9 sequence=TTCTTCTTCTTT criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=24.26 fanout-score-rank=14 prefix-density=0.16 prefix-fanout=17.4 sequence=GAGAGAGAGAGTTAAGACAATGGCCTCGAAGAAATCTGCAATCGTATTACCTGGTTCAAAGGTGTTGAAGCACATAGTTTTTGTACGGTTTAATGATGGGATCACTGATGAACAAATTGAGAA criterion=fanout-score sequence-density=0.09 sequence-density-rank=4 fanout-score=355.54 fanout-score-rank=1 prefix-density=0.94 prefix-fanout=33.2 sequence=AAGAAGAAGAAA SRR28623302 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 16:31:37 Started mapping on | Feb 13 16:31:38 Finished on | Feb 13 16:34:43 Mapping speed, Million of reads per hour | 598.91 Number of input reads | 30777124 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 28883217 Uniquely mapped reads % | 93.85% Average mapped length | 292.19 Number of splices: Total | 26569568 Number of splices: Annotated (sjdb) | 25924381 Number of splices: GT/AG | 26101543 Number of splices: GC/AG | 363561 Number of splices: AT/AC | 26847 Number of splices: Non-canonical | 77617 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.03% Deletion average length | 2.92 Insertion rate per base | 0.03% Insertion average length | 2.41 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 731098 % of reads mapped to multiple loci | 2.38% Number of reads mapped to too many loci | 198012 % of reads mapped to too many loci | 0.64% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.91% % of reads unmapped: other | 0.23% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1162809 1162809 1162809 N_multimapping 731098 731098 731098 N_noFeature 1276710 28529853 1444704 N_ambiguous 348179 2389 161239 UnstrandedReadsAssigned:27258328 PositiveStrandReadsAssigned:350975 NegativeStrandReadsAssigned:27277274 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR28623302 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR28623302-trimmed-pair1.fastq SRR28623302-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 30,777,124 reads, 27,606,161 reads pseudoaligned [quant] estimated average fragment length: 229.886 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,143 rounds 52401 SRR28623302.ke.tsv 34699 SRR28623302.se.tsv 87100 total ==> SRR28623302.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1789.11 1223 24.3289 Potri.005G024800.1.v4.1 1035 806.114 497 21.9429 Potri.004G059700.1.v4.1 961 732.135 282 13.7085 Potri.007G009000.2.v4.1 1416 1187.11 0 0 Potri.003G141000.2.v4.1 2943 2714.11 1039.62 13.6326 Potri.016G087400.1.v4.1 270 93.1861 2426.17 926.624 Potri.015G069301.1.v4.1 564 340.833 0 0 Potri.010G195200.1.v4.1 1773 1544.11 75 1.72868 Potri.012G127500.1.v4.1 977 748.13 7765 369.401 ==> SRR28623302.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1516 Potri.001G233950.v4.1 3 Potri.001G122700.v4.1 557 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 23 Potri.001G452600.v4.1 6 SRR28623302 completed mapping pipeline successfully