Starting /dee2/code/volunteer_pipeline.sh SRR28623303 current disk space = 3088849145856 free memory = 1487640896 SRR28623303 SRAfilesize 3abd116572ecb3d292923d37f483ac86 SRR28623303.sra SRR28623303.sra file validated SRR28623303 is paired end SRR28623303 is conventional basespace SRR28623303 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623303_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4525 37.0 37.0 37.0 37.0 37.0 2 36.506 37.0 37.0 37.0 37.0 37.0 3 36.643 37.0 37.0 37.0 37.0 37.0 4 36.62 37.0 37.0 37.0 37.0 37.0 5 36.6555 37.0 37.0 37.0 37.0 37.0 6 36.7195 37.0 37.0 37.0 37.0 37.0 7 36.605 37.0 37.0 37.0 37.0 37.0 8 36.5515 37.0 37.0 37.0 37.0 37.0 9 36.6365 37.0 37.0 37.0 37.0 37.0 10-14 36.6418 37.0 37.0 37.0 37.0 37.0 15-19 36.6301 37.0 37.0 37.0 37.0 37.0 20-24 36.5728 37.0 37.0 37.0 37.0 37.0 25-29 36.4912 37.0 37.0 37.0 37.0 37.0 30-34 36.47879999999999 37.0 37.0 37.0 37.0 37.0 35-39 36.4619 37.0 37.0 37.0 37.0 37.0 40-44 36.435900000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.3839 37.0 37.0 37.0 37.0 37.0 50-54 36.38290000000001 37.0 37.0 37.0 37.0 37.0 55-59 36.3784 37.0 37.0 37.0 37.0 37.0 60-64 36.37179999999999 37.0 37.0 37.0 37.0 37.0 65-69 36.3282 37.0 37.0 37.0 37.0 37.0 70-74 36.241 37.0 37.0 37.0 37.0 37.0 75-79 36.21319999999999 37.0 37.0 37.0 37.0 37.0 80-84 36.1413 37.0 37.0 37.0 37.0 37.0 85-89 36.201499999999996 37.0 37.0 37.0 37.0 37.0 90-94 36.143299999999996 37.0 37.0 37.0 37.0 37.0 95-99 35.979499999999994 37.0 37.0 37.0 37.0 37.0 100-104 36.0048 37.0 37.0 37.0 37.0 37.0 105-109 36.02329999999999 37.0 37.0 37.0 37.0 37.0 110-114 35.9741 37.0 37.0 37.0 37.0 37.0 115-119 35.94970000000001 37.0 37.0 37.0 37.0 37.0 120-124 35.804700000000004 37.0 37.0 37.0 37.0 37.0 125-129 35.7584 37.0 37.0 37.0 37.0 37.0 130-134 35.8869 37.0 37.0 37.0 37.0 37.0 135-139 35.658300000000004 37.0 37.0 37.0 37.0 37.0 140-144 35.3977 37.0 37.0 37.0 34.6 37.0 145-149 35.4034 37.0 37.0 37.0 34.6 37.0 150-151 35.2225 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 2.0 24 1.0 25 8.0 26 5.0 27 9.0 28 17.0 29 20.0 30 20.0 31 39.0 32 52.0 33 81.0 34 131.0 35 382.0 36 2936.0 37 296.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.10341365461847 13.303212851405622 11.094377510040161 43.49899598393574 2 17.2 15.775 37.925 29.099999999999998 3 17.9 18.224999999999998 28.599999999999998 35.275 4 22.95 25.324999999999996 23.225 28.499999999999996 5 24.5 32.300000000000004 23.724999999999998 19.475 6 22.35 35.6 23.125 18.925 7 15.65 30.049999999999997 37.125 17.175 8 17.75 27.575 32.1 22.575 9 18.325 24.05 34.9 22.725 10-14 19.685 30.575000000000003 27.33 22.41 15-19 19.8 29.134999999999998 27.565 23.5 20-24 19.08 29.294999999999998 27.389999999999997 24.235 25-29 20.150000000000002 29.45 27.215 23.185 30-34 20.135 28.64 27.889999999999997 23.335 35-39 19.395 29.43 27.169999999999998 24.005000000000003 40-44 19.580000000000002 30.240000000000002 26.83 23.35 45-49 20.06 29.044999999999998 26.715 24.18 50-54 20.005 29.445 27.034999999999997 23.515 55-59 19.725 28.349999999999998 28.275 23.65 60-64 20.294999999999998 28.725 27.295 23.685000000000002 65-69 19.75 28.165000000000003 28.22 23.865 70-74 20.064999999999998 29.04 26.87 24.025 75-79 20.215 28.28 27.66 23.845 80-84 20.355 28.63 27.525 23.49 85-89 19.8 29.115000000000002 27.474999999999998 23.61 90-94 20.62 28.244999999999997 27.47 23.665 95-99 20.945 28.075 27.634999999999998 23.345 100-104 20.755000000000003 29.005 26.625 23.615 105-109 20.555 29.104999999999997 26.99 23.35 110-114 20.53 28.975 26.83 23.665 115-119 21.165 28.794999999999998 26.334999999999997 23.705000000000002 120-124 21.525 27.99 26.534999999999997 23.95 125-129 21.205 28.285 25.924999999999997 24.585 130-134 20.665 28.005000000000003 26.955000000000002 24.375 135-139 20.945 27.785 27.265 24.005000000000003 140-144 21.38 27.685 25.88 25.055 145-149 21.21 27.47 26.14 25.180000000000003 150-151 21.4125 28.050000000000004 25.112499999999997 25.424999999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 2.0 21 2.5 22 2.0 23 1.5 24 2.5 25 3.5 26 6.5 27 12.0 28 12.0 29 16.0 30 27.5 31 35.5 32 47.0 33 55.0 34 62.0 35 79.5 36 104.5 37 131.5 38 153.0 39 158.5 40 176.5 41 194.0 42 202.5 43 226.5 44 249.5 45 244.5 46 247.0 47 254.0 48 223.0 49 206.5 50 190.5 51 141.5 52 106.0 53 89.5 54 64.5 55 53.5 56 47.5 57 46.5 58 39.5 59 25.0 60 20.0 61 10.5 62 6.5 63 7.0 64 3.5 65 1.0 66 1.0 67 2.5 68 2.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.4 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.89999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 84.74374255065554 71.1 2 12.216924910607867 20.5 3 2.264600715137068 5.7 4 0.6853396901072706 2.3 5 0.05959475566150178 0.25 6 0.02979737783075089 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TAAAGGAGACAGCAACCGCCGCAAAGGAGACATTACTGGTCACATGGCCT 6 0.15 No Hit CTAGGAACTGTTATCTGCACACCTGAAATTGAACCTCTGGAACAGCTCGC 5 0.125 No Hit AGGCAAACAAATTGACAGACAACCATCCCACTGACACAAATCTTTCCATG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.2625 0.0 0.0 0.0 0.0 82-83 0.4 0.0 0.0 0.0 0.0 84-85 0.5125 0.0 0.0 0.0 0.0 86-87 0.625 0.0 0.0 0.0 0.0 88-89 0.6875 0.0 0.0 0.0 0.0 90-91 0.9125 0.0 0.0 0.0 0.0 92-93 1.275 0.0 0.0 0.0 0.0 94-95 1.55 0.0 0.0 0.0 0.0 96-97 2.15 0.0 0.0 0.0 0.0 98-99 2.5625 0.0 0.0 0.0 0.0 100-101 2.9000000000000004 0.0 0.0 0.0 0.0 102-103 3.2750000000000004 0.0 0.0 0.0 0.0 104-105 3.5875000000000004 0.0 0.0 0.0 0.0 106-107 3.9375 0.0 0.0 0.0 0.0 108-109 4.325 0.0 0.0 0.0 0.0 110-111 4.8125 0.0 0.0 0.0 0.0 112-113 5.387499999999999 0.0 0.0 0.0 0.0 114-115 5.949999999999999 0.0 0.0 0.0 0.0 116-117 6.75 0.0 0.0 0.0 0.0 118-119 7.512499999999999 0.0 0.0 0.0 0.0 120-121 8.0125 0.0 0.0 0.0 0.0 122-123 8.7 0.0 0.0 0.0 0.0 124-125 9.3625 0.0 0.0 0.0 0.0 126-127 10.100000000000001 0.0 0.0 0.0 0.0 128-129 10.75 0.0 0.0 0.0 0.0 130-131 11.55 0.0 0.0 0.0 0.0 132-133 12.2625 0.0 0.0 0.0 0.0 134-135 13.337499999999999 0.0 0.0 0.0 0.0 136-137 14.45 0.0 0.0 0.0 0.0 138-139 15.2875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACAATC 10 0.006830828 145.0 2 CCACAAT 10 0.006830828 145.0 1 GAGCACA 50 1.7769479E-4 58.0 145 CGGAAGA 60 0.004491891 14.500001 140-144 AGATCGG 60 0.004491891 14.500001 135-139 GGAAGAG 65 0.0076375785 13.384615 140-144 >>END_MODULE SRR28623303 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623303_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.717 37.0 37.0 37.0 37.0 37.0 2 36.3705 37.0 37.0 37.0 37.0 37.0 3 36.307 37.0 37.0 37.0 37.0 37.0 4 36.281 37.0 37.0 37.0 37.0 37.0 5 36.358 37.0 37.0 37.0 37.0 37.0 6 36.3915 37.0 37.0 37.0 37.0 37.0 7 36.3725 37.0 37.0 37.0 37.0 37.0 8 36.3055 37.0 37.0 37.0 37.0 37.0 9 36.281 37.0 37.0 37.0 37.0 37.0 10-14 36.2455 37.0 37.0 37.0 37.0 37.0 15-19 36.2271 37.0 37.0 37.0 37.0 37.0 20-24 36.2173 37.0 37.0 37.0 37.0 37.0 25-29 36.2359 37.0 37.0 37.0 37.0 37.0 30-34 36.1416 37.0 37.0 37.0 37.0 37.0 35-39 36.0889 37.0 37.0 37.0 37.0 37.0 40-44 36.1157 37.0 37.0 37.0 37.0 37.0 45-49 36.0933 37.0 37.0 37.0 37.0 37.0 50-54 36.0527 37.0 37.0 37.0 37.0 37.0 55-59 35.9513 37.0 37.0 37.0 37.0 37.0 60-64 35.8435 37.0 37.0 37.0 37.0 37.0 65-69 35.9475 37.0 37.0 37.0 37.0 37.0 70-74 36.003800000000005 37.0 37.0 37.0 37.0 37.0 75-79 36.0172 37.0 37.0 37.0 37.0 37.0 80-84 35.835499999999996 37.0 37.0 37.0 37.0 37.0 85-89 35.7895 37.0 37.0 37.0 37.0 37.0 90-94 35.79559999999999 37.0 37.0 37.0 37.0 37.0 95-99 35.7611 37.0 37.0 37.0 37.0 37.0 100-104 35.6755 37.0 37.0 37.0 37.0 37.0 105-109 35.679899999999996 37.0 37.0 37.0 37.0 37.0 110-114 35.7039 37.0 37.0 37.0 37.0 37.0 115-119 35.58669999999999 37.0 37.0 37.0 37.0 37.0 120-124 35.5826 37.0 37.0 37.0 37.0 37.0 125-129 35.1786 37.0 37.0 37.0 32.2 37.0 130-134 35.425799999999995 37.0 37.0 37.0 37.0 37.0 135-139 35.1775 37.0 37.0 37.0 27.4 37.0 140-144 35.242999999999995 37.0 37.0 37.0 32.2 37.0 145-149 35.2236 37.0 37.0 37.0 29.8 37.0 150-151 34.8835 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 1.0 14 2.0 15 4.0 16 3.0 17 1.0 18 1.0 19 0.0 20 2.0 21 2.0 22 2.0 23 1.0 24 8.0 25 10.0 26 9.0 27 10.0 28 16.0 29 20.0 30 26.0 31 36.0 32 64.0 33 106.0 34 240.0 35 645.0 36 2505.0 37 284.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.6 19.525000000000002 14.499999999999998 29.375 2 28.925 26.125 28.275 16.675 3 21.75 28.725 29.275000000000002 20.25 4 25.650000000000002 34.225 21.875 18.25 5 27.35 35.925000000000004 20.825 15.9 6 21.45 39.85 21.75 16.950000000000003 7 22.400000000000002 22.875 36.199999999999996 18.525 8 23.025000000000002 26.5 26.55 23.925 9 21.725 25.6 30.25 22.425 10-14 24.16 28.925 26.365 20.549999999999997 15-19 23.585 27.405 27.815 21.195 20-24 23.28 28.410000000000004 27.445000000000004 20.865000000000002 25-29 24.455 27.66 27.400000000000002 20.485 30-34 23.080000000000002 28.815 26.919999999999998 21.185000000000002 35-39 23.165 28.095 27.605 21.135 40-44 23.599999999999998 27.18 27.839999999999996 21.38 45-49 23.044999999999998 27.560000000000002 28.23 21.165 50-54 24.2 27.439999999999998 27.98 20.380000000000003 55-59 23.73 27.125 28.03 21.115000000000002 60-64 23.31 27.63 28.315 20.745 65-69 23.365 28.09 28.015 20.53 70-74 24.385 27.74 27.534999999999997 20.34 75-79 23.494999999999997 27.794999999999998 27.775 20.935000000000002 80-84 23.255 28.24 27.589999999999996 20.915 85-89 23.285 27.860000000000003 27.87 20.985 90-94 23.885 27.560000000000002 27.834999999999997 20.72 95-99 24.04 27.72 27.944999999999997 20.294999999999998 100-104 24.905 27.71 27.295 20.09 105-109 24.805 27.584999999999997 27.18 20.43 110-114 25.145 27.715 27.42 19.72 115-119 25.169999999999998 27.525 27.495000000000005 19.81 120-124 25.455 28.134999999999998 27.29 19.12 125-129 25.130000000000003 28.095 26.855 19.919999999999998 130-134 25.64 27.21 28.13 19.02 135-139 25.869999999999997 27.22 27.560000000000002 19.35 140-144 26.38 27.68 26.700000000000003 19.24 145-149 26.784999999999997 26.900000000000002 27.275 19.040000000000003 150-151 27.1125 26.887499999999996 25.75 20.25 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.5 11 1.5 12 1.0 13 0.0 14 0.0 15 0.5 16 1.0 17 1.0 18 0.5 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 2.0 25 4.0 26 4.5 27 6.0 28 10.0 29 15.0 30 17.0 31 22.5 32 33.0 33 42.0 34 58.5 35 63.5 36 68.5 37 99.5 38 133.0 39 170.5 40 177.5 41 185.0 42 227.0 43 231.5 44 266.5 45 295.5 46 274.5 47 256.5 48 224.5 49 195.5 50 174.0 51 145.0 52 118.5 53 90.5 54 78.5 55 74.5 56 50.5 57 40.0 58 40.0 59 28.0 60 15.5 61 14.0 62 9.0 63 5.5 64 3.5 65 2.0 66 1.5 67 0.5 68 0.0 69 1.5 70 2.0 71 1.5 72 1.5 73 1.0 74 0.5 75 0.0 76 0.5 77 1.0 78 1.5 79 1.0 80 0.0 81 0.5 82 1.0 83 0.5 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.275 #Duplication Level Percentage of deduplicated Percentage of total 1 85.1082764758232 71.72500000000001 2 11.98457431029368 20.200000000000003 3 2.1951943043607236 5.55 4 0.5932957579353307 2.0 5 0.08899436369029962 0.375 6 0.02966478789676654 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTCAAGGCTGGAGCCCAGATCTTCAGCGAGGGTGGACTTGACTACTTGG 6 0.15 No Hit GGTTTTTCGAAAAGAATCCGGCTCTTGTAACCGGTTTTTTCTTCTTCATG 5 0.125 No Hit CACGAAACGGCTGACATTAATACCTTCAAATGGGGTGTGGCTGATCGTGG 5 0.125 No Hit ATGGAAAACAAGGGCTAGGGGCGTCCATTCCAACTGTTTCTTTGTCACAG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.2875 0.0 0.0 0.0 0.0 82-83 0.42500000000000004 0.0 0.0 0.0 0.0 84-85 0.5375000000000001 0.0 0.0 0.0 0.0 86-87 0.625 0.0 0.0 0.0 0.0 88-89 0.6875 0.0 0.0 0.0 0.0 90-91 0.9125 0.0 0.0 0.0 0.0 92-93 1.275 0.0 0.0 0.0 0.0 94-95 1.55 0.0 0.0 0.0 0.0 96-97 2.175 0.0 0.0 0.0 0.0 98-99 2.5875000000000004 0.0 0.0 0.0 0.0 100-101 2.95 0.0 0.0 0.0 0.0 102-103 3.325 0.0 0.0 0.0 0.0 104-105 3.6375 0.0 0.0 0.0 0.0 106-107 3.9749999999999996 0.0 0.0 0.0 0.0 108-109 4.375 0.0 0.0 0.0 0.0 110-111 4.8625 0.0 0.0 0.0 0.0 112-113 5.4375 0.0 0.0 0.0 0.0 114-115 6.0 0.0 0.0 0.0 0.0 116-117 6.7875 0.0 0.0 0.0 0.0 118-119 7.5875 0.0 0.0 0.0 0.0 120-121 8.1 0.0 0.0 0.0 0.0 122-123 8.75 0.0 0.0 0.0 0.0 124-125 9.4125 0.0 0.0 0.0 0.0 126-127 10.1625 0.0 0.0 0.0 0.0 128-129 10.825 0.0 0.0 0.0 0.0 130-131 11.6625 0.0 0.0 0.0 0.0 132-133 12.4 0.0 0.0 0.0 0.0 134-135 13.4875 0.0 0.0 0.0 0.0 136-137 14.600000000000001 0.0 0.0 0.0 0.0 138-139 15.4375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTACTTC 10 0.006830828 145.0 2 TCCTATC 10 0.006830828 145.0 7 ACTTCCT 10 0.006830828 145.0 4 TTCCTAT 10 0.006830828 145.0 6 CTTACTT 10 0.006830828 145.0 1 TACTTCC 10 0.006830828 145.0 3 CTTCCTA 10 0.006830828 145.0 5 CTATCTT 10 0.006830828 145.0 9 GAGCGTC 50 1.7769479E-4 58.0 145 CGGAAGA 60 0.004491891 14.500001 140-144 AGATCGG 60 0.004491891 14.500001 135-139 >>END_MODULE Read 1557978 spots for SRR28623303.sra Written 1557978 spots for SRR28623303.sra Read 1557978 spots for SRR28623303.sra Written 1557978 spots for SRR28623303.sra Read 1557978 spots for SRR28623303.sra Written 1557978 spots for SRR28623303.sra Read 1557978 spots for SRR28623303.sra Written 1557978 spots for SRR28623303.sra Read 1557978 spots for SRR28623303.sra Written 1557978 spots for SRR28623303.sra Read 1557978 spots for SRR28623303.sra Written 1557978 spots for SRR28623303.sra Read 1557978 spots for SRR28623303.sra Written 1557978 spots for SRR28623303.sra Read 1557995 spots for SRR28623303.sra Written 1557995 spots for SRR28623303.sra Read 1557978 spots for SRR28623303.sra Written 1557978 spots for SRR28623303.sra Read 1557978 spots for SRR28623303.sra Written 1557978 spots for SRR28623303.sra Read 1557978 spots for SRR28623303.sra Written 1557978 spots for SRR28623303.sra Read 1557978 spots for SRR28623303.sra Written 1557978 spots for SRR28623303.sra Read 1557978 spots for SRR28623303.sra Written 1557978 spots for SRR28623303.sra Read 1557978 spots for SRR28623303.sra Written 1557978 spots for SRR28623303.sra Read 1557978 spots for SRR28623303.sra Written 1557978 spots for SRR28623303.sra Read 1557978 spots for SRR28623303.sra Written 1557978 spots for SRR28623303.sra Read 1557978 spots for SRR28623303.sra Written 1557978 spots for SRR28623303.sra Read 1557978 spots for SRR28623303.sra Written 1557978 spots for SRR28623303.sra Read 1557978 spots for SRR28623303.sra Written 1557978 spots for SRR28623303.sra Read 1557978 spots for SRR28623303.sra Written 1557978 spots for SRR28623303.sra SRR ids: ['SRR28623303.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_h4sk7mgk SRR28623303.sra spots: 31159577 blocks: [[1, 1557978], [1557979, 3115956], [3115957, 4673934], [4673935, 6231912], [6231913, 7789890], [7789891, 9347868], [9347869, 10905846], [10905847, 12463824], [12463825, 14021802], [14021803, 15579780], [15579781, 17137758], [17137759, 18695736], [18695737, 20253714], [20253715, 21811692], [21811693, 23369670], [23369671, 24927648], [24927649, 26485626], [26485627, 28043604], [28043605, 29601582], [29601583, 31159577]] SRR28623303 file size 11505584 SRR28623303 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR28623303 SRR28623303_1.fastq SRR28623303_2.fastq Input file: SRR28623303_1.fastq Paired file: SRR28623303_2.fastq trimmed: SRR28623303-trimmed-pair1.fastq, SRR28623303-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 16:40:59 2025 >> started Thu Feb 13 16:41:34 2025 >> done (35.176s) 31159577 read pairs processed; of these: 22 ( 0.00%) short read pairs filtered out after trimming by size control 22774 ( 0.07%) empty read pairs filtered out after trimming by size control 31136781 (99.93%) read pairs available; of these: 6587156 (21.16%) trimmed read pairs available after processing 24549625 (78.84%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 4 0.00% 21 2 0.00% 22 6 0.00% 23 4 0.00% 24 11 0.00% 25 7 0.00% 26 3 0.00% 27 9 0.00% 28 8 0.00% 29 11 0.00% 30 9 0.00% 31 23 0.00% 32 22 0.00% 33 21 0.00% 34 26 0.00% 35 25 0.00% 36 34 0.00% 37 42 0.00% 38 55 0.00% 39 55 0.00% 40 82 0.00% 41 89 0.00% 42 113 0.00% 43 104 0.00% 44 124 0.00% 45 164 0.00% 46 135 0.00% 47 175 0.00% 48 211 0.00% 49 255 0.00% 50 337 0.00% 51 386 0.00% 52 409 0.00% 53 503 0.00% 54 519 0.00% 55 553 0.00% 56 691 0.00% 57 719 0.00% 58 876 0.00% 59 1040 0.00% 60 1268 0.00% 61 1520 0.00% 62 1637 0.01% 63 1825 0.01% 64 2080 0.01% 65 2351 0.01% 66 2787 0.01% 67 2936 0.01% 68 3619 0.01% 69 4014 0.01% 70 4572 0.01% 71 5298 0.02% 72 6201 0.02% 73 7167 0.02% 74 8221 0.03% 75 9014 0.03% 76 9799 0.03% 77 11028 0.04% 78 12353 0.04% 79 13871 0.04% 80 15419 0.05% 81 16974 0.05% 82 19334 0.06% 83 21473 0.07% 84 23337 0.07% 85 25573 0.08% 86 27906 0.09% 87 29985 0.10% 88 32121 0.10% 89 34835 0.11% 90 36922 0.12% 91 39166 0.13% 92 42304 0.14% 93 45282 0.15% 94 48853 0.16% 95 52332 0.17% 96 54763 0.18% 97 58079 0.19% 98 59926 0.19% 99 61584 0.20% 100 64091 0.21% 101 66414 0.21% 102 69096 0.22% 103 72822 0.23% 104 75151 0.24% 105 78193 0.25% 106 80743 0.26% 107 83452 0.27% 108 84505 0.27% 109 87817 0.28% 110 89292 0.29% 111 91130 0.29% 112 93666 0.30% 113 94998 0.31% 114 97286 0.31% 115 100986 0.32% 116 102977 0.33% 117 106091 0.34% 118 107720 0.35% 119 108425 0.35% 120 110096 0.35% 121 111548 0.36% 122 111403 0.36% 123 113779 0.37% 124 116115 0.37% 125 115850 0.37% 126 119459 0.38% 127 121711 0.39% 128 122870 0.39% 129 124104 0.40% 130 125894 0.40% 131 125625 0.40% 132 126126 0.41% 133 128559 0.41% 134 128459 0.41% 135 129050 0.41% 136 130519 0.42% 137 131774 0.42% 138 133313 0.43% 139 135215 0.43% 140 134588 0.43% 141 135272 0.43% 142 134949 0.43% 143 135656 0.44% 144 136546 0.44% 145 136187 0.44% 146 136608 0.44% 147 135489 0.44% 148 139943 0.45% 149 139536 0.45% 150 140464 0.45% 151 24549625 78.84% 31136781 reads passed initial QC criterion=sequence-density sequence-density=0.71 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=25 prefix-density=0.69 prefix-fanout=2.0 sequence=GTTAGGGTAAGCTTTCTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=26 fanout-score=46.08 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=2.2 sequence=TGAATGGTGCACATTACGGGTCCATGGCACAAAATCAGAGGATAACAATATCCATTCAAGACTATGCAACAATATAATTTGATTATCCTTAGAAAGTGCTTCTCCTTACACACCCACAAGCCTAGAAAAGGAATTAGAATTTGTAAGTGCAGCTTCCATCATCACTCCTTGCAGTTGGATCAAAGTTTGCTGCATTTGGATCAGTACAGCCTTCAGCGACAGGCACCTTTACTTGCTGTGCCGCTTGGCC criterion=sequence-density sequence-density=0.65 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=20 prefix-density=0.65 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.28 sequence-density-rank=17 fanout-score=8.11 fanout-score-rank=1 prefix-density=0.44 prefix-fanout=5.3 sequence=AACAACAACGCCTGGGCATATGCCACAAACTTCGTTCCCGGAAAGTG SRR28623303 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 16:42:51 Started mapping on | Feb 13 16:42:51 Finished on | Feb 13 16:45:11 Mapping speed, Million of reads per hour | 800.66 Number of input reads | 31136781 Average input read length | 286 UNIQUE READS: Uniquely mapped reads number | 25132485 Uniquely mapped reads % | 80.72% Average mapped length | 289.28 Number of splices: Total | 22960966 Number of splices: Annotated (sjdb) | 22437891 Number of splices: GT/AG | 22488002 Number of splices: GC/AG | 375321 Number of splices: AT/AC | 20129 Number of splices: Non-canonical | 77514 Mismatch rate per base, % | 0.45% Deletion rate per base | 0.03% Deletion average length | 2.60 Insertion rate per base | 0.03% Insertion average length | 2.29 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 743044 % of reads mapped to multiple loci | 2.39% Number of reads mapped to too many loci | 210817 % of reads mapped to too many loci | 0.68% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 16.05% % of reads unmapped: other | 0.17% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 5261252 5261252 5261252 N_multimapping 743044 743044 743044 N_noFeature 922425 24796151 1044432 N_ambiguous 543618 4629 325865 UnstrandedReadsAssigned:23666442 PositiveStrandReadsAssigned:331705 NegativeStrandReadsAssigned:23762188 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR28623303 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR28623303-trimmed-pair1.fastq SRR28623303-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 31,136,781 reads, 28,444,795 reads pseudoaligned [quant] estimated average fragment length: 209.176 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,116 rounds 52401 SRR28623303.ke.tsv 34699 SRR28623303.se.tsv 87100 total ==> SRR28623303.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1809.82 1649 31.5549 Potri.005G024800.1.v4.1 1035 826.824 497 20.8174 Potri.004G059700.1.v4.1 961 752.849 180 8.28033 Potri.007G009000.2.v4.1 1416 1207.82 0 0 Potri.003G141000.2.v4.1 2943 2734.82 910.316 11.5278 Potri.016G087400.1.v4.1 270 103.387 1547.4 518.35 Potri.015G069301.1.v4.1 564 360.084 0 0 Potri.010G195200.1.v4.1 1773 1564.82 8 0.177055 Potri.012G127500.1.v4.1 977 768.834 812 36.5769 ==> SRR28623303.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 12 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 340 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 8 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 0 SRR28623303 completed mapping pipeline successfully