Starting /dee2/code/volunteer_pipeline.sh SRR28623305 current disk space = 3048474836992 free memory = 1484008056 SRR28623305 SRAfilesize c09bfaef20be0271e1afef18ecdddea0 SRR28623305.sra SRR28623305.sra file validated SRR28623305 is paired end SRR28623305 is conventional basespace SRR28623305 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623305_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.36425 37.0 37.0 37.0 37.0 37.0 2 36.5235 37.0 37.0 37.0 37.0 37.0 3 36.653 37.0 37.0 37.0 37.0 37.0 4 36.6215 37.0 37.0 37.0 37.0 37.0 5 36.715 37.0 37.0 37.0 37.0 37.0 6 36.711 37.0 37.0 37.0 37.0 37.0 7 36.603 37.0 37.0 37.0 37.0 37.0 8 36.399 37.0 37.0 37.0 37.0 37.0 9 36.624 37.0 37.0 37.0 37.0 37.0 10-14 36.60850000000001 37.0 37.0 37.0 37.0 37.0 15-19 36.5939 37.0 37.0 37.0 37.0 37.0 20-24 36.5706 37.0 37.0 37.0 37.0 37.0 25-29 36.5514 37.0 37.0 37.0 37.0 37.0 30-34 36.4882 37.0 37.0 37.0 37.0 37.0 35-39 36.4434 37.0 37.0 37.0 37.0 37.0 40-44 36.4238 37.0 37.0 37.0 37.0 37.0 45-49 36.367 37.0 37.0 37.0 37.0 37.0 50-54 36.3658 37.0 37.0 37.0 37.0 37.0 55-59 36.328 37.0 37.0 37.0 37.0 37.0 60-64 36.327600000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.2332 37.0 37.0 37.0 37.0 37.0 70-74 36.1833 37.0 37.0 37.0 37.0 37.0 75-79 36.182900000000004 37.0 37.0 37.0 37.0 37.0 80-84 36.1466 37.0 37.0 37.0 37.0 37.0 85-89 36.123900000000006 37.0 37.0 37.0 37.0 37.0 90-94 36.1549 37.0 37.0 37.0 37.0 37.0 95-99 35.954899999999995 37.0 37.0 37.0 37.0 37.0 100-104 36.0028 37.0 37.0 37.0 37.0 37.0 105-109 36.0013 37.0 37.0 37.0 37.0 37.0 110-114 35.8872 37.0 37.0 37.0 37.0 37.0 115-119 35.929500000000004 37.0 37.0 37.0 37.0 37.0 120-124 35.718900000000005 37.0 37.0 37.0 37.0 37.0 125-129 35.7351 37.0 37.0 37.0 37.0 37.0 130-134 35.8371 37.0 37.0 37.0 37.0 37.0 135-139 35.6699 37.0 37.0 37.0 37.0 37.0 140-144 35.394600000000004 37.0 37.0 37.0 37.0 37.0 145-149 35.3676 37.0 37.0 37.0 37.0 37.0 150-151 35.182500000000005 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 1.0 23 3.0 24 2.0 25 2.0 26 9.0 27 13.0 28 11.0 29 15.0 30 27.0 31 45.0 32 42.0 33 80.0 34 148.0 35 427.0 36 2892.0 37 282.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.29264004019091 13.815624215021352 9.16855061542326 41.72318512936448 2 19.425 15.075 35.425000000000004 30.075000000000003 3 17.7 18.6 27.325 36.375 4 21.0 25.35 24.05 29.599999999999998 5 23.825 31.95 24.825 19.400000000000002 6 22.0 35.425000000000004 21.85 20.724999999999998 7 14.799999999999999 31.525 37.775 15.9 8 18.425 28.299999999999997 30.15 23.125 9 17.275 25.6 33.35 23.775 10-14 19.295 31.740000000000002 26.645000000000003 22.32 15-19 19.045 28.735 28.165000000000003 24.055 20-24 19.57 28.98 27.0 24.45 25-29 19.345000000000002 29.759999999999998 26.91 23.985 30-34 19.794999999999998 29.755 26.96 23.49 35-39 19.650000000000002 29.775000000000002 27.075 23.5 40-44 19.91 29.12 27.76 23.21 45-49 19.41 29.04 27.565 23.985 50-54 19.79 29.385 27.544999999999998 23.28 55-59 19.73 28.775000000000002 27.384999999999998 24.11 60-64 19.91 28.965000000000003 27.325 23.799999999999997 65-69 20.105 28.965000000000003 27.800000000000004 23.13 70-74 19.955000000000002 28.720000000000002 27.644999999999996 23.68 75-79 20.4 29.049999999999997 26.995 23.555 80-84 19.61 28.655 28.37 23.365 85-89 20.085 28.88 27.474999999999998 23.56 90-94 20.18 28.895 27.07 23.855 95-99 20.735 29.69 26.295 23.28 100-104 20.375 29.160000000000004 26.97 23.494999999999997 105-109 20.724999999999998 29.110000000000003 25.8 24.365000000000002 110-114 20.93 29.425 26.275 23.369999999999997 115-119 20.78 28.735 26.55 23.935000000000002 120-124 20.855 28.875 26.575 23.695 125-129 21.625 29.099999999999998 25.779999999999998 23.494999999999997 130-134 21.025 28.95 25.465 24.560000000000002 135-139 21.07 28.88 25.845000000000002 24.205 140-144 21.295 28.175 25.405 25.124999999999996 145-149 21.529999999999998 28.13 25.69 24.65 150-151 20.5375 28.4125 26.1625 24.887500000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.5 18 0.5 19 1.0 20 1.0 21 0.0 22 0.5 23 2.5 24 6.5 25 6.5 26 6.5 27 8.0 28 9.5 29 14.5 30 23.5 31 30.0 32 40.5 33 51.0 34 62.0 35 93.0 36 115.0 37 130.0 38 157.0 39 166.5 40 191.5 41 220.5 42 231.0 43 242.5 44 257.5 45 251.0 46 219.0 47 227.5 48 231.0 49 205.5 50 158.5 51 122.0 52 103.5 53 78.5 54 75.5 55 64.0 56 39.0 57 24.0 58 21.0 59 21.0 60 20.5 61 16.5 62 9.5 63 7.0 64 5.5 65 5.5 66 4.5 67 3.0 68 4.0 69 3.0 70 2.5 71 1.5 72 1.5 73 2.5 74 1.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.475 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.1 #Duplication Level Percentage of deduplicated Percentage of total 1 85.01783590963139 71.5 2 11.890606420927467 20.0 3 2.348394768133175 5.925 4 0.6539833531510106 2.1999999999999997 5 0.089179548156956 0.375 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTATGTTCACCGAGTTTGGATAACTTGTCACGTTAAGTGGTAACCTACT 5 0.125 No Hit CATCTTAAAAACCACCACGGAGACGAAGGACAAGGTGAAGTGTGGACTCC 5 0.125 No Hit CGGAGATTGGGAGCGTTTGGTATAACGGCCTGGAGGACGTTACGGAACAT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.0875 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.1875 0.0 0.0 0.0 0.0 74-75 0.275 0.0 0.0 0.0 0.0 76-77 0.3375 0.0 0.0 0.0 0.0 78-79 0.48750000000000004 0.0 0.0 0.0 0.0 80-81 0.625 0.0 0.0 0.0 0.0 82-83 0.7124999999999999 0.0 0.0 0.0 0.0 84-85 0.875 0.0 0.0 0.0 0.0 86-87 1.1625 0.0 0.0 0.0 0.0 88-89 1.25 0.0 0.0 0.0 0.0 90-91 1.3875 0.0 0.0 0.0 0.0 92-93 1.65 0.0 0.0 0.0 0.0 94-95 1.9874999999999998 0.0 0.0 0.0 0.0 96-97 2.2375 0.0 0.0 0.0 0.0 98-99 2.6375 0.0 0.0 0.0 0.0 100-101 2.9749999999999996 0.0 0.0 0.0 0.0 102-103 3.2125 0.0 0.0 0.0 0.0 104-105 3.7874999999999996 0.0 0.0 0.0 0.0 106-107 4.324999999999999 0.0 0.0 0.0 0.0 108-109 4.8375 0.0 0.0 0.0 0.0 110-111 5.425 0.0 0.0 0.0 0.0 112-113 6.075 0.0 0.0 0.0 0.0 114-115 7.1 0.0 0.0 0.0 0.0 116-117 8.100000000000001 0.0 0.0 0.0 0.0 118-119 8.8375 0.0 0.0 0.0 0.0 120-121 9.575 0.0 0.0 0.0 0.0 122-123 10.350000000000001 0.0 0.0 0.0 0.0 124-125 11.175 0.0 0.0 0.0 0.0 126-127 12.0125 0.0 0.0 0.0 0.0 128-129 13.024999999999999 0.0 0.0 0.0 0.0 130-131 13.85 0.0 0.0 0.0 0.0 132-133 14.7125 0.0 0.0 0.0 0.0 134-135 15.5125 0.0 0.0 0.0 0.0 136-137 16.5625 0.0 0.0 0.0 0.0 138-139 17.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR28623305 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623305_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.0525 37.0 37.0 37.0 37.0 37.0 2 36.414 37.0 37.0 37.0 37.0 37.0 3 36.4895 37.0 37.0 37.0 37.0 37.0 4 36.339 37.0 37.0 37.0 37.0 37.0 5 36.4145 37.0 37.0 37.0 37.0 37.0 6 36.2635 37.0 37.0 37.0 37.0 37.0 7 36.393 37.0 37.0 37.0 37.0 37.0 8 36.213 37.0 37.0 37.0 37.0 37.0 9 36.3585 37.0 37.0 37.0 37.0 37.0 10-14 36.20360000000001 37.0 37.0 37.0 37.0 37.0 15-19 36.1511 37.0 37.0 37.0 37.0 37.0 20-24 36.209199999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.0907 37.0 37.0 37.0 37.0 37.0 30-34 35.9891 37.0 37.0 37.0 37.0 37.0 35-39 36.0307 37.0 37.0 37.0 37.0 37.0 40-44 35.9933 37.0 37.0 37.0 37.0 37.0 45-49 36.0189 37.0 37.0 37.0 37.0 37.0 50-54 35.9655 37.0 37.0 37.0 37.0 37.0 55-59 35.8732 37.0 37.0 37.0 37.0 37.0 60-64 35.795899999999996 37.0 37.0 37.0 37.0 37.0 65-69 35.8652 37.0 37.0 37.0 37.0 37.0 70-74 35.80159999999999 37.0 37.0 37.0 37.0 37.0 75-79 35.8113 37.0 37.0 37.0 37.0 37.0 80-84 35.7523 37.0 37.0 37.0 37.0 37.0 85-89 35.66 37.0 37.0 37.0 37.0 37.0 90-94 35.6464 37.0 37.0 37.0 37.0 37.0 95-99 35.6644 37.0 37.0 37.0 37.0 37.0 100-104 35.555099999999996 37.0 37.0 37.0 37.0 37.0 105-109 35.5324 37.0 37.0 37.0 37.0 37.0 110-114 35.6026 37.0 37.0 37.0 37.0 37.0 115-119 35.511900000000004 37.0 37.0 37.0 37.0 37.0 120-124 35.5636 37.0 37.0 37.0 37.0 37.0 125-129 35.0918 37.0 37.0 37.0 29.8 37.0 130-134 35.3952 37.0 37.0 37.0 37.0 37.0 135-139 35.185199999999995 37.0 37.0 37.0 32.2 37.0 140-144 35.202099999999994 37.0 37.0 37.0 32.2 37.0 145-149 35.1707 37.0 37.0 37.0 29.8 37.0 150-151 34.78725 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 3.0 13 5.0 14 8.0 15 8.0 16 7.0 17 5.0 18 5.0 19 4.0 20 2.0 21 4.0 22 7.0 23 9.0 24 8.0 25 2.0 26 10.0 27 11.0 28 16.0 29 18.0 30 23.0 31 32.0 32 44.0 33 80.0 34 182.0 35 553.0 36 2636.0 37 318.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.875 20.925 14.75 25.45 2 29.275000000000002 25.174999999999997 28.725 16.825000000000003 3 22.425 27.750000000000004 30.125 19.7 4 26.1 31.65 23.799999999999997 18.45 5 28.375 34.599999999999994 20.8 16.225 6 21.475 38.75 23.875 15.9 7 22.1 22.525000000000002 36.625 18.75 8 23.974999999999998 26.825 27.125 22.075 9 23.375 24.975 29.425 22.225 10-14 24.805 28.249999999999996 26.075 20.87 15-19 24.915000000000003 27.765 27.83 19.49 20-24 24.535 28.165000000000003 27.495000000000005 19.805 25-29 23.919999999999998 27.99 27.155 20.935000000000002 30-34 24.45 27.935 27.575 20.04 35-39 24.545 28.395 26.939999999999998 20.119999999999997 40-44 24.18 28.62 26.795 20.405 45-49 24.605 27.650000000000002 28.33 19.415 50-54 23.66 27.700000000000003 28.505000000000003 20.135 55-59 24.085 27.775 27.779999999999998 20.36 60-64 23.75 27.905 27.96 20.385 65-69 24.345 27.68 27.750000000000004 20.225 70-74 23.990000000000002 27.500000000000004 28.205000000000002 20.305 75-79 23.61 27.384999999999998 28.595 20.41 80-84 23.974999999999998 27.705000000000002 28.71 19.61 85-89 23.669999999999998 28.26 28.194999999999997 19.875 90-94 24.395 27.805000000000003 27.705000000000002 20.095 95-99 25.009999999999998 27.74 27.29 19.96 100-104 24.465 27.900000000000002 27.834999999999997 19.8 105-109 24.625 28.375 27.955000000000002 19.045 110-114 24.985 28.860000000000003 27.065 19.09 115-119 25.650000000000002 28.035 26.790000000000003 19.525000000000002 120-124 25.61 28.000000000000004 27.05 19.34 125-129 26.52 28.08 26.56 18.84 130-134 26.505000000000003 28.215 27.13 18.15 135-139 26.889999999999997 28.29 26.669999999999998 18.15 140-144 27.235 27.825 26.51 18.43 145-149 27.22 27.675 26.75 18.355 150-151 28.325 26.6625 26.337500000000002 18.675 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 1.0 9 0.0 10 0.5 11 2.0 12 2.0 13 0.5 14 1.0 15 1.5 16 1.0 17 1.5 18 2.5 19 2.5 20 2.5 21 3.0 22 3.0 23 2.5 24 1.0 25 3.5 26 4.5 27 2.5 28 6.0 29 10.0 30 15.0 31 26.0 32 32.5 33 38.0 34 44.0 35 60.0 36 96.5 37 121.5 38 126.0 39 153.5 40 198.5 41 210.5 42 218.5 43 246.5 44 264.0 45 283.5 46 287.0 47 256.0 48 217.5 49 184.5 50 170.0 51 145.5 52 119.0 53 97.5 54 76.5 55 53.0 56 33.5 57 24.5 58 20.0 59 18.0 60 13.0 61 12.0 62 11.5 63 12.5 64 7.5 65 3.5 66 2.0 67 3.5 68 4.0 69 1.0 70 0.0 71 0.0 72 1.0 73 3.0 74 3.0 75 2.5 76 1.5 77 0.5 78 1.5 79 1.0 80 0.5 81 1.0 82 1.0 83 0.5 84 0.5 85 1.0 86 1.5 87 1.5 88 0.5 89 0.5 90 1.0 91 2.0 92 1.5 93 0.5 94 1.0 95 0.5 96 0.0 97 0.0 98 0.5 99 0.5 100 3.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.2 #Duplication Level Percentage of deduplicated Percentage of total 1 85.39192399049881 71.89999999999999 2 11.579572446555819 19.5 3 2.286223277909739 5.775 4 0.6235154394299287 2.1 5 0.08907363420427554 0.375 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02969121140142518 0.35000000000000003 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 14 0.35000000000000003 No Hit GCAAGTTAACATGAGCTGGTGGTGGTCTGGTGCTATTGGCGCTGCCAAGA 5 0.125 No Hit GGAATGCAGATTTTTGTCAAGACTTTGACCGGAAAGACCATCACTCTGGA 5 0.125 No Hit GCATCACCTCCAGCTGCAACCCCAACACAGGCAGCTGCACCGCATGGCAT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.0875 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.1875 0.0 0.0 0.0 0.0 74-75 0.275 0.0 0.0 0.0 0.0 76-77 0.3375 0.0 0.0 0.0 0.0 78-79 0.5 0.0 0.0 0.0 0.0 80-81 0.65 0.0 0.0 0.0 0.0 82-83 0.7124999999999999 0.0 0.0 0.0 0.0 84-85 0.875 0.0 0.0 0.0 0.0 86-87 1.1625 0.0 0.0 0.0 0.0 88-89 1.25 0.0 0.0 0.0 0.0 90-91 1.4 0.0 0.0 0.0 0.0 92-93 1.675 0.0 0.0 0.0 0.0 94-95 2.0125 0.0 0.0 0.0 0.0 96-97 2.2750000000000004 0.0 0.0 0.0 0.0 98-99 2.6875 0.0 0.0 0.0 0.0 100-101 3.0375 0.0 0.0 0.0 0.0 102-103 3.2875 0.0 0.0 0.0 0.0 104-105 3.8625 0.0 0.0 0.0 0.0 106-107 4.4 0.0 0.0 0.0 0.0 108-109 4.925 0.0 0.0 0.0 0.0 110-111 5.4875 0.0 0.0 0.0 0.0 112-113 6.112500000000001 0.0 0.0 0.0 0.0 114-115 7.125 0.0 0.0 0.0 0.0 116-117 8.125 0.0 0.0 0.0 0.0 118-119 8.8625 0.0 0.0 0.0 0.0 120-121 9.6125 0.0 0.0 0.0 0.0 122-123 10.4625 0.0 0.0 0.0 0.0 124-125 11.3 0.0 0.0 0.0 0.0 126-127 12.1375 0.0 0.0 0.0 0.0 128-129 13.1625 0.0 0.0 0.0 0.0 130-131 13.9875 0.0 0.0 0.0 0.0 132-133 14.8375 0.0 0.0 0.0 0.0 134-135 15.6625 0.0 0.0 0.0 0.0 136-137 16.7875 0.0 0.0 0.0 0.0 138-139 17.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AATCTAA 10 0.006830828 145.0 5 >>END_MODULE Read 1805435 spots for SRR28623305.sra Written 1805435 spots for SRR28623305.sra Read 1805435 spots for SRR28623305.sra Written 1805435 spots for SRR28623305.sra Read 1805435 spots for SRR28623305.sra Written 1805435 spots for SRR28623305.sra Read 1805435 spots for SRR28623305.sra Written 1805435 spots for SRR28623305.sra Read 1805435 spots for SRR28623305.sra Written 1805435 spots for SRR28623305.sra Read 1805435 spots for SRR28623305.sra Written 1805435 spots for SRR28623305.sra Read 1805435 spots for SRR28623305.sra Written 1805435 spots for SRR28623305.sra Read 1805435 spots for SRR28623305.sra Written 1805435 spots for SRR28623305.sra Read 1805435 spots for SRR28623305.sra Written 1805435 spots for SRR28623305.sra Read 1805435 spots for SRR28623305.sra Written 1805435 spots for SRR28623305.sra Read 1805435 spots for SRR28623305.sra Written 1805435 spots for SRR28623305.sra Read 1805435 spots for SRR28623305.sra Written 1805435 spots for SRR28623305.sra Read 1805435 spots for SRR28623305.sra Written 1805435 spots for SRR28623305.sra Read 1805435 spots for SRR28623305.sra Written 1805435 spots for SRR28623305.sra Read 1805435 spots for SRR28623305.sra Written 1805435 spots for SRR28623305.sra Read 1805435 spots for SRR28623305.sra Written 1805435 spots for SRR28623305.sra Read 1805435 spots for SRR28623305.sra Written 1805435 spots for SRR28623305.sra Read 1805435 spots for SRR28623305.sra Written 1805435 spots for SRR28623305.sra Read 1805435 spots for SRR28623305.sra Written 1805435 spots for SRR28623305.sra Read 1805435 spots for SRR28623305.sra Written 1805435 spots for SRR28623305.sra SRR ids: ['SRR28623305.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1hx0y8ai SRR28623305.sra spots: 36108700 blocks: [[1, 1805435], [1805436, 3610870], [3610871, 5416305], [5416306, 7221740], [7221741, 9027175], [9027176, 10832610], [10832611, 12638045], [12638046, 14443480], [14443481, 16248915], [16248916, 18054350], [18054351, 19859785], [19859786, 21665220], [21665221, 23470655], [23470656, 25276090], [25276091, 27081525], [27081526, 28886960], [28886961, 30692395], [30692396, 32497830], [32497831, 34303265], [34303266, 36108700]] SRR28623305 file size 13334743 SRR28623305 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR28623305 SRR28623305_1.fastq SRR28623305_2.fastq Input file: SRR28623305_1.fastq Paired file: SRR28623305_2.fastq trimmed: SRR28623305-trimmed-pair1.fastq, SRR28623305-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 17:03:24 2025 >> started Tue Feb 11 17:04:06 2025 >> done (42.407s) 36108700 read pairs processed; of these: 27 ( 0.00%) short read pairs filtered out after trimming by size control 102323 ( 0.28%) empty read pairs filtered out after trimming by size control 36006350 (99.72%) read pairs available; of these: 8037233 (22.32%) trimmed read pairs available after processing 27969117 (77.68%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 2 0.00% 20 2 0.00% 21 7 0.00% 22 3 0.00% 23 14 0.00% 24 2 0.00% 25 9 0.00% 26 4 0.00% 27 14 0.00% 28 13 0.00% 29 13 0.00% 30 18 0.00% 31 13 0.00% 32 20 0.00% 33 16 0.00% 34 20 0.00% 35 29 0.00% 36 36 0.00% 37 46 0.00% 38 45 0.00% 39 50 0.00% 40 78 0.00% 41 72 0.00% 42 97 0.00% 43 93 0.00% 44 110 0.00% 45 131 0.00% 46 154 0.00% 47 193 0.00% 48 251 0.00% 49 283 0.00% 50 358 0.00% 51 382 0.00% 52 489 0.00% 53 512 0.00% 54 563 0.00% 55 642 0.00% 56 733 0.00% 57 775 0.00% 58 1025 0.00% 59 1157 0.00% 60 1395 0.00% 61 1695 0.00% 62 1984 0.01% 63 2225 0.01% 64 2578 0.01% 65 2694 0.01% 66 3153 0.01% 67 3535 0.01% 68 3961 0.01% 69 4763 0.01% 70 5414 0.02% 71 6383 0.02% 72 7138 0.02% 73 8377 0.02% 74 9542 0.03% 75 10580 0.03% 76 11825 0.03% 77 12910 0.04% 78 14530 0.04% 79 16184 0.04% 80 17665 0.05% 81 20168 0.06% 82 22961 0.06% 83 25292 0.07% 84 28918 0.08% 85 31853 0.09% 86 34161 0.09% 87 36239 0.10% 88 38560 0.11% 89 40695 0.11% 90 44383 0.12% 91 47356 0.13% 92 51105 0.14% 93 55530 0.15% 94 60153 0.17% 95 63282 0.18% 96 68156 0.19% 97 70901 0.20% 98 73000 0.20% 99 76055 0.21% 100 78907 0.22% 101 81739 0.23% 102 84955 0.24% 103 89446 0.25% 104 93237 0.26% 105 97011 0.27% 106 101200 0.28% 107 104073 0.29% 108 106063 0.29% 109 107823 0.30% 110 108883 0.30% 111 111956 0.31% 112 114633 0.32% 113 116443 0.32% 114 120708 0.34% 115 124953 0.35% 116 127274 0.35% 117 130814 0.36% 118 132173 0.37% 119 133248 0.37% 120 134687 0.37% 121 136228 0.38% 122 137563 0.38% 123 139804 0.39% 124 141690 0.39% 125 144075 0.40% 126 147492 0.41% 127 149865 0.42% 128 150609 0.42% 129 153022 0.42% 130 154073 0.43% 131 153035 0.43% 132 153984 0.43% 133 154648 0.43% 134 154194 0.43% 135 156896 0.44% 136 159703 0.44% 137 159761 0.44% 138 162019 0.45% 139 162836 0.45% 140 163140 0.45% 141 164469 0.46% 142 164201 0.46% 143 162732 0.45% 144 165351 0.46% 145 163985 0.46% 146 165428 0.46% 147 166470 0.46% 148 168590 0.47% 149 168030 0.47% 150 167339 0.46% 151 27969117 77.68% 36006350 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=15.65 fanout-score-rank=8 prefix-density=0.17 prefix-fanout=15.7 sequence=GGATCGGAAGAGCACACGTCTGAACTCCAGTCACGAACGCTTATCTCGTATGCCGTCTTCTGCTTGAAA criterion=fanout-score sequence-density=0.03 sequence-density-rank=33 fanout-score=287.75 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=22.4 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTTGTCCCAGTAACTG criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=3.03 fanout-score-rank=32 prefix-density=0.14 prefix-fanout=3.0 sequence=TAACCATCTTTGCACC criterion=fanout-score sequence-density=0.08 sequence-density-rank=22 fanout-score=38.86 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=10.0 sequence=TGCTGAGATCATTG SRR28623305 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 17:04:46 Started mapping on | Feb 11 17:04:46 Finished on | Feb 11 17:08:01 Mapping speed, Million of reads per hour | 664.73 Number of input reads | 36006350 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 33068185 Uniquely mapped reads % | 91.84% Average mapped length | 287.78 Number of splices: Total | 24519609 Number of splices: Annotated (sjdb) | 23913088 Number of splices: GT/AG | 24110855 Number of splices: GC/AG | 306653 Number of splices: AT/AC | 22528 Number of splices: Non-canonical | 79573 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.04% Deletion average length | 2.90 Insertion rate per base | 0.03% Insertion average length | 2.21 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 766482 % of reads mapped to multiple loci | 2.13% Number of reads mapped to too many loci | 953252 % of reads mapped to too many loci | 2.65% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.82% % of reads unmapped: other | 0.57% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2171683 2171683 2171683 N_multimapping 766482 766482 766482 N_noFeature 1362862 32515826 1608050 N_ambiguous 461045 4050 150758 UnstrandedReadsAssigned:31244278 PositiveStrandReadsAssigned:548309 NegativeStrandReadsAssigned:31309377 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=145 echo kmer=141 SRR28623305 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR28623305-trimmed-pair1.fastq SRR28623305-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 36,006,350 reads, 32,444,245 reads pseudoaligned [quant] estimated average fragment length: 207.445 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,131 rounds 52401 SRR28623305.ke.tsv 34699 SRR28623305.se.tsv 87100 total ==> SRR28623305.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1811.55 1317 24.2002 Potri.005G024800.1.v4.1 1035 828.555 263 10.5662 Potri.004G059700.1.v4.1 961 754.585 48 2.11747 Potri.007G009000.2.v4.1 1416 1209.55 0 0 Potri.003G141000.2.v4.1 2943 2736.55 572.105 6.95916 Potri.016G087400.1.v4.1 270 101.759 2200.16 719.727 Potri.015G069301.1.v4.1 564 361.029 0 0 Potri.010G195200.1.v4.1 1773 1566.55 98.8047 2.09951 Potri.012G127500.1.v4.1 977 770.575 1553 67.0875 ==> SRR28623305.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 4066 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 732 Potri.001G212900.v4.1 9 Potri.001G182400.v4.1 18 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 31 SRR28623305 completed mapping pipeline successfully