Starting /dee2/code/volunteer_pipeline.sh SRR28623306 current disk space = 3052715073536 free memory = 1579759652 SRR28623306 SRAfilesize 458e0ac089e431ac411311b33968edfe SRR28623306.sra SRR28623306.sra file validated SRR28623306 is paired end SRR28623306 is conventional basespace SRR28623306 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623306_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.46725 37.0 37.0 37.0 37.0 37.0 2 36.4845 37.0 37.0 37.0 37.0 37.0 3 36.6235 37.0 37.0 37.0 37.0 37.0 4 36.649 37.0 37.0 37.0 37.0 37.0 5 36.664 37.0 37.0 37.0 37.0 37.0 6 36.6575 37.0 37.0 37.0 37.0 37.0 7 36.568 37.0 37.0 37.0 37.0 37.0 8 36.463 37.0 37.0 37.0 37.0 37.0 9 36.5805 37.0 37.0 37.0 37.0 37.0 10-14 36.6217 37.0 37.0 37.0 37.0 37.0 15-19 36.5865 37.0 37.0 37.0 37.0 37.0 20-24 36.5918 37.0 37.0 37.0 37.0 37.0 25-29 36.4929 37.0 37.0 37.0 37.0 37.0 30-34 36.482000000000006 37.0 37.0 37.0 37.0 37.0 35-39 36.4933 37.0 37.0 37.0 37.0 37.0 40-44 36.4072 37.0 37.0 37.0 37.0 37.0 45-49 36.4332 37.0 37.0 37.0 37.0 37.0 50-54 36.3853 37.0 37.0 37.0 37.0 37.0 55-59 36.325 37.0 37.0 37.0 37.0 37.0 60-64 36.386700000000005 37.0 37.0 37.0 37.0 37.0 65-69 36.290800000000004 37.0 37.0 37.0 37.0 37.0 70-74 36.2382 37.0 37.0 37.0 37.0 37.0 75-79 36.206 37.0 37.0 37.0 37.0 37.0 80-84 36.094300000000004 37.0 37.0 37.0 37.0 37.0 85-89 36.0636 37.0 37.0 37.0 37.0 37.0 90-94 36.0452 37.0 37.0 37.0 37.0 37.0 95-99 35.992599999999996 37.0 37.0 37.0 37.0 37.0 100-104 36.032 37.0 37.0 37.0 37.0 37.0 105-109 35.9995 37.0 37.0 37.0 37.0 37.0 110-114 35.9076 37.0 37.0 37.0 37.0 37.0 115-119 35.9601 37.0 37.0 37.0 37.0 37.0 120-124 35.7687 37.0 37.0 37.0 37.0 37.0 125-129 35.69109999999999 37.0 37.0 37.0 37.0 37.0 130-134 35.835300000000004 37.0 37.0 37.0 37.0 37.0 135-139 35.677699999999994 37.0 37.0 37.0 37.0 37.0 140-144 35.418400000000005 37.0 37.0 37.0 37.0 37.0 145-149 35.3955 37.0 37.0 37.0 37.0 37.0 150-151 35.161 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 1.0 24 2.0 25 6.0 26 2.0 27 14.0 28 7.0 29 25.0 30 24.0 31 44.0 32 54.0 33 77.0 34 149.0 35 381.0 36 2960.0 37 253.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.22475570032573 13.254823352543221 9.822099724379854 43.69832122275119 2 17.925 14.35 38.525 29.2 3 17.575 17.8 26.825 37.8 4 21.8 27.200000000000003 23.65 27.35 5 24.125 33.650000000000006 23.200000000000003 19.025 6 20.875 37.55 22.35 19.225 7 14.149999999999999 28.199999999999996 41.0 16.650000000000002 8 18.275 26.5 32.05 23.175 9 16.150000000000002 24.425 35.125 24.3 10-14 19.5 30.925000000000004 27.715 21.86 15-19 19.185 28.599999999999998 28.71 23.505000000000003 20-24 19.45 29.13 28.335 23.085 25-29 19.42 29.54 28.23 22.81 30-34 19.585 29.445 27.055 23.915 35-39 19.54 29.235 27.79 23.435 40-44 19.15 29.17 28.075 23.605 45-49 19.695 29.15 27.055 24.099999999999998 50-54 19.365 29.299999999999997 28.060000000000002 23.275000000000002 55-59 19.88 28.42 27.860000000000003 23.84 60-64 19.744999999999997 28.9 27.79 23.565 65-69 20.255000000000003 28.59 27.779999999999998 23.375 70-74 20.155 28.810000000000002 27.455000000000002 23.580000000000002 75-79 19.715 28.860000000000003 27.845 23.580000000000002 80-84 19.55 29.54 27.515 23.395 85-89 20.22 28.835 27.71 23.235 90-94 20.330000000000002 28.689999999999998 27.27 23.71 95-99 20.04 29.035 27.500000000000004 23.425 100-104 20.150000000000002 28.189999999999998 28.315 23.345 105-109 20.39 28.055000000000003 27.99 23.565 110-114 20.06 29.385 26.855 23.7 115-119 20.515 29.134999999999998 27.16 23.189999999999998 120-124 20.43 28.57 27.29 23.71 125-129 20.595 28.67 26.97 23.765 130-134 20.5 28.82 26.834999999999997 23.845 135-139 20.555 28.720000000000002 26.51 24.215 140-144 20.82 28.65 26.775 23.755000000000003 145-149 20.895 28.139999999999997 26.46 24.505 150-151 20.7 28.499999999999996 26.275 24.525 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 0.5 21 0.0 22 1.5 23 3.0 24 3.0 25 5.0 26 5.5 27 8.0 28 11.5 29 15.0 30 19.5 31 25.5 32 36.5 33 52.5 34 66.0 35 81.0 36 102.5 37 114.5 38 145.5 39 192.0 40 219.0 41 254.0 42 274.5 43 278.5 44 270.0 45 248.0 46 240.5 47 226.0 48 206.5 49 183.0 50 151.5 51 130.0 52 97.0 53 72.0 54 67.5 55 55.5 56 34.5 57 19.5 58 18.0 59 15.0 60 13.0 61 8.5 62 5.0 63 6.0 64 5.5 65 4.0 66 3.5 67 1.5 68 0.5 69 0.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.22499999999999998 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 87.425 #Duplication Level Percentage of deduplicated Percentage of total 1 87.6179582499285 76.6 2 10.809265084358021 18.9 3 1.258221332570775 3.3000000000000003 4 0.20017157563625965 0.7000000000000001 5 0.11438375750643409 0.5 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATCACTGCTAAGGGTGCACGACCTTGGATCAGAACCGTCTATGCTCATCA 5 0.125 No Hit CTGTGCTTGGGTCATGTGAGCATTAATATCTTTGGTTAAATCGACTGCAA 5 0.125 No Hit TAGCACTTGGGATACTCTTGAAAGATCAATAACCGGCAAATCATTTCCAG 5 0.125 No Hit GTCAATTTCCTCTGGCTTCATTCCTTCAGGAGGGGTCCAACAAAAATGGT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0125 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.21250000000000002 0.0 0.0 0.0 0.0 80-81 0.25 0.0 0.0 0.0 0.0 82-83 0.32499999999999996 0.0 0.0 0.0 0.0 84-85 0.35 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88-89 0.475 0.0 0.0 0.0 0.0 90-91 0.675 0.0 0.0 0.0 0.0 92-93 0.8375 0.0 0.0 0.0 0.0 94-95 1.0 0.0 0.0 0.0 0.0 96-97 1.1625 0.0 0.0 0.0 0.0 98-99 1.3375 0.0125 0.0 0.0 0.0 100-101 1.5125 0.025 0.0 0.0 0.0 102-103 1.9 0.025 0.0 0.0 0.0 104-105 2.1875 0.025 0.0 0.0 0.0 106-107 2.7875 0.025 0.0 0.0 0.0 108-109 3.1375 0.025 0.0 0.0 0.0 110-111 3.4625 0.025 0.0 0.0 0.0 112-113 4.0 0.025 0.0 0.0 0.0 114-115 4.362500000000001 0.025 0.0 0.0 0.0 116-117 4.65 0.025 0.0 0.0 0.0 118-119 5.2125 0.025 0.0 0.0 0.0 120-121 5.725 0.025 0.0 0.0 0.0 122-123 6.2625 0.025 0.0 0.0 0.0 124-125 6.85 0.025 0.0 0.0 0.0 126-127 7.475 0.025 0.0 0.0 0.0 128-129 8.0625 0.025 0.0 0.0 0.0 130-131 8.825 0.025 0.0 0.0 0.0 132-133 9.5 0.025 0.0 0.0 0.0 134-135 10.15 0.025 0.0 0.0 0.0 136-137 10.95 0.025 0.0 0.0 0.0 138-139 11.899999999999999 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCCAGA 10 0.006830828 145.0 1 GTTGGCA 10 0.006830828 145.0 8 CAGTGTG 10 0.006830828 145.0 4 TTTTTTT 20 0.00593511 29.0 80-84 >>END_MODULE SRR28623306 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623306_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.9185 37.0 37.0 37.0 37.0 37.0 2 36.249 37.0 37.0 37.0 37.0 37.0 3 36.234 37.0 37.0 37.0 37.0 37.0 4 36.233 37.0 37.0 37.0 37.0 37.0 5 36.321 37.0 37.0 37.0 37.0 37.0 6 36.3305 37.0 37.0 37.0 37.0 37.0 7 36.2055 37.0 37.0 37.0 37.0 37.0 8 36.238 37.0 37.0 37.0 37.0 37.0 9 36.1915 37.0 37.0 37.0 37.0 37.0 10-14 36.1306 37.0 37.0 37.0 37.0 37.0 15-19 36.093399999999995 37.0 37.0 37.0 37.0 37.0 20-24 36.0497 37.0 37.0 37.0 37.0 37.0 25-29 36.027499999999996 37.0 37.0 37.0 37.0 37.0 30-34 35.9162 37.0 37.0 37.0 37.0 37.0 35-39 35.9442 37.0 37.0 37.0 37.0 37.0 40-44 35.882000000000005 37.0 37.0 37.0 37.0 37.0 45-49 35.906000000000006 37.0 37.0 37.0 37.0 37.0 50-54 35.838 37.0 37.0 37.0 37.0 37.0 55-59 35.674099999999996 37.0 37.0 37.0 37.0 37.0 60-64 35.67399999999999 37.0 37.0 37.0 37.0 37.0 65-69 35.7378 37.0 37.0 37.0 37.0 37.0 70-74 35.69799999999999 37.0 37.0 37.0 37.0 37.0 75-79 35.7181 37.0 37.0 37.0 37.0 37.0 80-84 35.6169 37.0 37.0 37.0 37.0 37.0 85-89 35.596 37.0 37.0 37.0 37.0 37.0 90-94 35.529700000000005 37.0 37.0 37.0 37.0 37.0 95-99 35.5206 37.0 37.0 37.0 37.0 37.0 100-104 35.4578 37.0 37.0 37.0 37.0 37.0 105-109 35.4162 37.0 37.0 37.0 37.0 37.0 110-114 35.455200000000005 37.0 37.0 37.0 37.0 37.0 115-119 35.3515 37.0 37.0 37.0 37.0 37.0 120-124 35.3669 37.0 37.0 37.0 34.6 37.0 125-129 34.9659 37.0 37.0 37.0 27.4 37.0 130-134 35.2438 37.0 37.0 37.0 37.0 37.0 135-139 34.9806 37.0 37.0 37.0 25.0 37.0 140-144 35.0923 37.0 37.0 37.0 27.4 37.0 145-149 34.918499999999995 37.0 37.0 37.0 25.0 37.0 150-151 34.59325 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 8.0 14 7.0 15 8.0 16 4.0 17 4.0 18 4.0 19 5.0 20 3.0 21 6.0 22 10.0 23 4.0 24 7.0 25 11.0 26 12.0 27 10.0 28 17.0 29 21.0 30 28.0 31 43.0 32 57.0 33 112.0 34 204.0 35 661.0 36 2536.0 37 218.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.75 18.85 13.675 29.725 2 26.1 25.874999999999996 31.3 16.725 3 20.849999999999998 26.650000000000002 31.474999999999998 21.025 4 25.174999999999997 32.6 24.45 17.775 5 25.3 35.775 23.200000000000003 15.725 6 20.525 39.175 21.925 18.375 7 21.875 23.0 36.375 18.75 8 21.2 25.275 29.375 24.15 9 23.325000000000003 25.775 28.425 22.475 10-14 24.945 28.79 26.040000000000003 20.225 15-19 23.880000000000003 28.09 28.46 19.57 20-24 23.505000000000003 28.685 27.400000000000002 20.41 25-29 23.630000000000003 28.804999999999996 27.134999999999998 20.43 30-34 23.419999999999998 28.43 27.52 20.630000000000003 35-39 23.235 28.57 27.875 20.32 40-44 23.835 28.625 27.845 19.695 45-49 23.13 28.18 28.785 19.905 50-54 23.335 28.92 27.595 20.150000000000002 55-59 23.64 28.775000000000002 27.900000000000002 19.685 60-64 23.1 29.154999999999998 27.82 19.925 65-69 23.865 28.27 28.67 19.195 70-74 23.52 28.675 27.529999999999998 20.275000000000002 75-79 23.855 28.28 27.894999999999996 19.97 80-84 23.28 28.475 28.08 20.165 85-89 23.48 29.189999999999998 28.03 19.3 90-94 23.98 28.15 28.03 19.84 95-99 23.405 28.335 28.16 20.1 100-104 24.025 27.889999999999997 28.155 19.93 105-109 23.77 28.225 27.6 20.405 110-114 23.995 28.735 27.58 19.689999999999998 115-119 24.23 28.849999999999998 27.1 19.82 120-124 24.46 28.689999999999998 27.72 19.13 125-129 25.374999999999996 28.389999999999997 27.37 18.865000000000002 130-134 25.03 28.970000000000002 27.515 18.485 135-139 25.865 28.46 27.105 18.57 140-144 25.990000000000002 28.634999999999998 26.605 18.77 145-149 26.369999999999997 28.63 26.584999999999997 18.415 150-151 27.175 27.5625 26.6125 18.65 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 2.0 9 2.0 10 2.5 11 2.5 12 0.0 13 1.0 14 1.5 15 0.5 16 1.5 17 2.0 18 2.5 19 2.5 20 0.5 21 1.0 22 4.0 23 4.0 24 3.5 25 3.5 26 4.0 27 6.5 28 6.5 29 12.0 30 19.5 31 22.5 32 33.0 33 41.5 34 46.5 35 67.5 36 101.5 37 114.0 38 146.0 39 191.0 40 216.0 41 235.5 42 274.0 43 298.5 44 253.0 45 249.5 46 248.5 47 226.5 48 221.0 49 195.0 50 163.0 51 128.5 52 94.0 53 76.5 54 68.5 55 47.5 56 34.0 57 25.0 58 17.0 59 13.0 60 9.5 61 6.5 62 3.0 63 3.0 64 4.0 65 3.5 66 2.5 67 0.5 68 2.0 69 3.5 70 2.0 71 1.0 72 1.5 73 2.0 74 1.5 75 0.5 76 0.5 77 0.5 78 1.0 79 1.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.5 92 0.5 93 0.5 94 1.5 95 1.0 96 1.0 97 1.5 98 1.0 99 1.0 100 3.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 87.875 #Duplication Level Percentage of deduplicated Percentage of total 1 88.44950213371267 77.725 2 10.04267425320057 17.65 3 1.1379800853485065 3.0 4 0.25604551920341395 0.8999999999999999 5 0.08534850640113799 0.375 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.028449502133712664 0.35000000000000003 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 14 0.35000000000000003 No Hit CTTAGTAGTAGGATGGAGGTTGCTGTAGAAACCAGCGTTCCTGCTGAAAA 5 0.125 No Hit CCTGGAGGAGGATGTTGACATGAAGGGTCATGATTTCAGGCTACTTCCAT 5 0.125 No Hit CAGAGGATAGGACCACAAAAATGCACAACAAGGATTGCCAGCTGATGGGT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0125 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1875 0.0 0.0 0.0 0.0 78-79 0.2375 0.0 0.0 0.0 0.0 80-81 0.275 0.0 0.0 0.0 0.0 82-83 0.35 0.0 0.0 0.0 0.0 84-85 0.375 0.0 0.0 0.0 0.0 86-87 0.425 0.0 0.0 0.0 0.0 88-89 0.5 0.0 0.0 0.0 0.0 90-91 0.7 0.0 0.0 0.0 0.0 92-93 0.8625 0.0 0.0 0.0 0.0 94-95 1.0125 0.0 0.0 0.0 0.0 96-97 1.1749999999999998 0.0 0.0 0.0 0.0 98-99 1.3625 0.0 0.0 0.0 0.0 100-101 1.5375 0.0 0.0 0.0 0.0 102-103 1.9375 0.0 0.0 0.0 0.0 104-105 2.2625 0.0 0.0 0.0 0.0 106-107 2.8375 0.0 0.0 0.0 0.0 108-109 3.1875 0.0 0.0 0.0 0.0 110-111 3.5125 0.0 0.0 0.0 0.0 112-113 4.075 0.0 0.0 0.0 0.0 114-115 4.475 0.0 0.0 0.0 0.0 116-117 4.7875 0.0 0.0 0.0 0.0 118-119 5.375 0.0 0.0 0.0 0.0 120-121 5.925000000000001 0.0 0.0 0.0 0.0 122-123 6.4125 0.0 0.0 0.0 0.0 124-125 7.0 0.0 0.0 0.0 0.0 126-127 7.625 0.0 0.0 0.0 0.0 128-129 8.225000000000001 0.0 0.0 0.0 0.0 130-131 9.0125 0.0 0.0 0.0 0.0 132-133 9.7 0.0 0.0 0.0 0.0 134-135 10.35 0.0 0.0 0.0 0.0 136-137 11.149999999999999 0.0 0.0 0.0 0.0 138-139 12.100000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAATTGA 10 0.006830828 145.0 4 CAACAGG 10 0.006830828 145.0 5 AAAATTG 10 0.006830828 145.0 3 GCATCAA 10 0.006830828 145.0 9 >>END_MODULE Read 1408892 spots for SRR28623306.sra Written 1408892 spots for SRR28623306.sra Read 1408892 spots for SRR28623306.sra Written 1408892 spots for SRR28623306.sra Read 1408892 spots for SRR28623306.sra Written 1408892 spots for SRR28623306.sra Read 1408892 spots for SRR28623306.sra Written 1408892 spots for SRR28623306.sra Read 1408892 spots for SRR28623306.sra Written 1408892 spots for SRR28623306.sra Read 1408892 spots for SRR28623306.sra Written 1408892 spots for SRR28623306.sra Read 1408892 spots for SRR28623306.sra Written 1408892 spots for SRR28623306.sra Read 1408892 spots for SRR28623306.sra Written 1408892 spots for SRR28623306.sra Read 1408892 spots for SRR28623306.sra Written 1408892 spots for SRR28623306.sra Read 1408892 spots for SRR28623306.sra Written 1408892 spots for SRR28623306.sra Read 1408892 spots for SRR28623306.sra Written 1408892 spots for SRR28623306.sra Read 1408892 spots for SRR28623306.sra Written 1408892 spots for SRR28623306.sra Read 1408892 spots for SRR28623306.sra Written 1408892 spots for SRR28623306.sra Read 1408892 spots for SRR28623306.sra Written 1408892 spots for SRR28623306.sra Read 1408895 spots for SRR28623306.sra Written 1408895 spots for SRR28623306.sra Read 1408892 spots for SRR28623306.sra Written 1408892 spots for SRR28623306.sra Read 1408892 spots for SRR28623306.sra Written 1408892 spots for SRR28623306.sra Read 1408892 spots for SRR28623306.sra Written 1408892 spots for SRR28623306.sra Read 1408892 spots for SRR28623306.sra Written 1408892 spots for SRR28623306.sra Read 1408892 spots for SRR28623306.sra Written 1408892 spots for SRR28623306.sra SRR ids: ['SRR28623306.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_w4sccr4r SRR28623306.sra spots: 28177843 blocks: [[1, 1408892], [1408893, 2817784], [2817785, 4226676], [4226677, 5635568], [5635569, 7044460], [7044461, 8453352], [8453353, 9862244], [9862245, 11271136], [11271137, 12680028], [12680029, 14088920], [14088921, 15497812], [15497813, 16906704], [16906705, 18315596], [18315597, 19724488], [19724489, 21133380], [21133381, 22542272], [22542273, 23951164], [23951165, 25360056], [25360057, 26768948], [26768949, 28177843]] SRR28623306 file size 10403546 SRR28623306 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR28623306 SRR28623306_1.fastq SRR28623306_2.fastq Input file: SRR28623306_1.fastq Paired file: SRR28623306_2.fastq trimmed: SRR28623306-trimmed-pair1.fastq, SRR28623306-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 17:58:35 2025 >> started Tue Feb 11 17:59:07 2025 >> done (32.052s) 28177843 read pairs processed; of these: 21 ( 0.00%) short read pairs filtered out after trimming by size control 12430 ( 0.04%) empty read pairs filtered out after trimming by size control 28165392 (99.96%) read pairs available; of these: 4690821 (16.65%) trimmed read pairs available after processing 23474571 (83.35%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 20 8 0.00% 21 1 0.00% 22 6 0.00% 23 6 0.00% 24 2 0.00% 25 7 0.00% 26 8 0.00% 27 4 0.00% 28 8 0.00% 29 11 0.00% 30 15 0.00% 31 12 0.00% 32 18 0.00% 33 14 0.00% 34 15 0.00% 35 18 0.00% 36 20 0.00% 37 20 0.00% 38 18 0.00% 39 33 0.00% 40 46 0.00% 41 42 0.00% 42 53 0.00% 43 59 0.00% 44 74 0.00% 45 80 0.00% 46 93 0.00% 47 96 0.00% 48 95 0.00% 49 130 0.00% 50 186 0.00% 51 186 0.00% 52 197 0.00% 53 209 0.00% 54 263 0.00% 55 320 0.00% 56 341 0.00% 57 358 0.00% 58 408 0.00% 59 460 0.00% 60 627 0.00% 61 695 0.00% 62 744 0.00% 63 844 0.00% 64 1011 0.00% 65 1131 0.00% 66 1296 0.00% 67 1480 0.01% 68 1687 0.01% 69 1882 0.01% 70 2284 0.01% 71 2520 0.01% 72 2856 0.01% 73 3274 0.01% 74 3814 0.01% 75 4366 0.02% 76 4909 0.02% 77 5228 0.02% 78 6010 0.02% 79 6787 0.02% 80 7509 0.03% 81 8484 0.03% 82 9788 0.03% 83 10838 0.04% 84 12177 0.04% 85 13290 0.05% 86 14709 0.05% 87 16044 0.06% 88 17398 0.06% 89 18700 0.07% 90 20411 0.07% 91 21914 0.08% 92 23830 0.08% 93 25982 0.09% 94 28185 0.10% 95 30350 0.11% 96 32384 0.11% 97 34286 0.12% 98 35806 0.13% 99 37464 0.13% 100 39820 0.14% 101 41340 0.15% 102 43219 0.15% 103 46223 0.16% 104 47543 0.17% 105 49981 0.18% 106 52576 0.19% 107 54896 0.19% 108 56416 0.20% 109 58248 0.21% 110 59209 0.21% 111 61416 0.22% 112 63233 0.22% 113 65268 0.23% 114 66736 0.24% 115 69492 0.25% 116 71021 0.25% 117 74003 0.26% 118 75907 0.27% 119 77128 0.27% 120 78578 0.28% 121 79603 0.28% 122 80642 0.29% 123 82112 0.29% 124 84614 0.30% 125 85776 0.30% 126 87514 0.31% 127 89843 0.32% 128 91271 0.32% 129 92679 0.33% 130 94383 0.34% 131 94520 0.34% 132 95787 0.34% 133 96309 0.34% 134 97555 0.35% 135 99561 0.35% 136 100528 0.36% 137 102273 0.36% 138 103308 0.37% 139 104775 0.37% 140 104868 0.37% 141 106232 0.38% 142 107101 0.38% 143 106976 0.38% 144 108898 0.39% 145 108985 0.39% 146 109764 0.39% 147 109975 0.39% 148 111876 0.40% 149 111513 0.40% 150 112393 0.40% 151 23474571 83.35% 28165392 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=11.44 fanout-score-rank=18 prefix-density=0.09 prefix-fanout=11.4 sequence=GGATCGGAAGAGCACACGTCTGAACTCCAGTCACATTGAGCCATCTCGTATGCCGTCTTCTGCTTG criterion=fanout-score sequence-density=0.07 sequence-density-rank=15 fanout-score=465.52 fanout-score-rank=1 prefix-density=0.94 prefix-fanout=33.5 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=14.35 fanout-score-rank=19 prefix-density=0.13 prefix-fanout=13.7 sequence=GAGAGAGAGAGTTAAGACAATGGCCTCGAAGAAATCTGCAATCGTATTACCTGGTTCAAAGGTGTTGAAGCACATAGTTTTTGTACGGTTTAATGATGGGATCACTGATGAACAAATTGAGAA criterion=fanout-score sequence-density=0.02 sequence-density-rank=34 fanout-score=415.28 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=26.8 sequence=ACAAGAAGATCAACTGTCTCTCTGCCTGGTTTGTATTCCAAGAAATGGAGAAAGTCCAAAAGCTCTTTTGTGTGGCTCTATTGCTTGCAGTACTAGCCATAGCAAGCAATATTGCGAATGCCCAGAGTACCATATGCAAAATGCCTGTTGCTGGCCTAATGTCATGCAAGCCTTCTGTAACTCCTCCTAACCCTACCGCACCCTCGGCAGACTGCTGCTCGGCACTTTCGCATGCTGACATAAACTGCCTTTGCTCCTACAAAAATTCCAACCTGCTCCCTTCCCTTGGAATCGACCCAAAACTTGCCATGCAGCTCCCTGGCAAGTGCA SRR28623306 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 17:59:51 Started mapping on | Feb 11 17:59:51 Finished on | Feb 11 18:02:56 Mapping speed, Million of reads per hour | 548.08 Number of input reads | 28165392 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 26314402 Uniquely mapped reads % | 93.43% Average mapped length | 291.77 Number of splices: Total | 24355435 Number of splices: Annotated (sjdb) | 23760278 Number of splices: GT/AG | 23922609 Number of splices: GC/AG | 335758 Number of splices: AT/AC | 24728 Number of splices: Non-canonical | 72340 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 2.96 Insertion rate per base | 0.03% Insertion average length | 2.42 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 655556 % of reads mapped to multiple loci | 2.33% Number of reads mapped to too many loci | 165157 % of reads mapped to too many loci | 0.59% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.43% % of reads unmapped: other | 0.23% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1195434 1195434 1195434 N_multimapping 655556 655556 655556 N_noFeature 1182938 25994190 1336810 N_ambiguous 312114 2060 144461 UnstrandedReadsAssigned:24819350 PositiveStrandReadsAssigned:318152 NegativeStrandReadsAssigned:24833131 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR28623306 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR28623306-trimmed-pair1.fastq SRR28623306-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 28,165,392 reads, 25,138,587 reads pseudoaligned [quant] estimated average fragment length: 226.438 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,177 rounds 52401 SRR28623306.ke.tsv 34699 SRR28623306.se.tsv 87100 total ==> SRR28623306.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1792.56 1111 23.6341 Potri.005G024800.1.v4.1 1035 809.562 535 25.2001 Potri.004G059700.1.v4.1 961 735.583 190 9.84966 Potri.007G009000.2.v4.1 1416 1190.56 0 0 Potri.003G141000.2.v4.1 2943 2717.56 888.201 12.4632 Potri.016G087400.1.v4.1 270 94.6254 2404.9 969.146 Potri.015G069301.1.v4.1 564 343.815 0 0 Potri.010G195200.1.v4.1 1773 1547.56 99 2.43942 Potri.012G127500.1.v4.1 977 751.578 11562 586.622 ==> SRR28623306.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1178 Potri.001G233950.v4.1 4 Potri.001G122700.v4.1 567 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 26 Potri.001G452600.v4.1 4 SRR28623306 completed mapping pipeline successfully