Starting /dee2/code/volunteer_pipeline.sh SRR28623308 current disk space = 3053434490880 free memory = 1578313148 SRR28623308 SRAfilesize 78cc3e40932f78026eacb47b23bdc378 SRR28623308.sra SRR28623308.sra file validated SRR28623308 is paired end SRR28623308 is conventional basespace SRR28623308 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623308_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.26275 37.0 37.0 37.0 37.0 37.0 2 36.4895 37.0 37.0 37.0 37.0 37.0 3 36.5915 37.0 37.0 37.0 37.0 37.0 4 36.6485 37.0 37.0 37.0 37.0 37.0 5 36.625 37.0 37.0 37.0 37.0 37.0 6 36.605 37.0 37.0 37.0 37.0 37.0 7 36.618 37.0 37.0 37.0 37.0 37.0 8 36.377 37.0 37.0 37.0 37.0 37.0 9 36.669 37.0 37.0 37.0 37.0 37.0 10-14 36.5966 37.0 37.0 37.0 37.0 37.0 15-19 36.5819 37.0 37.0 37.0 37.0 37.0 20-24 36.5603 37.0 37.0 37.0 37.0 37.0 25-29 36.488800000000005 37.0 37.0 37.0 37.0 37.0 30-34 36.4512 37.0 37.0 37.0 37.0 37.0 35-39 36.454499999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.3903 37.0 37.0 37.0 37.0 37.0 45-49 36.3337 37.0 37.0 37.0 37.0 37.0 50-54 36.321600000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.2997 37.0 37.0 37.0 37.0 37.0 60-64 36.307900000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.2479 37.0 37.0 37.0 37.0 37.0 70-74 36.138000000000005 37.0 37.0 37.0 37.0 37.0 75-79 36.131899999999995 37.0 37.0 37.0 37.0 37.0 80-84 36.0625 37.0 37.0 37.0 37.0 37.0 85-89 36.043899999999994 37.0 37.0 37.0 37.0 37.0 90-94 36.0127 37.0 37.0 37.0 37.0 37.0 95-99 35.9097 37.0 37.0 37.0 37.0 37.0 100-104 35.9077 37.0 37.0 37.0 37.0 37.0 105-109 35.9342 37.0 37.0 37.0 37.0 37.0 110-114 35.776500000000006 37.0 37.0 37.0 37.0 37.0 115-119 35.782999999999994 37.0 37.0 37.0 37.0 37.0 120-124 35.6654 37.0 37.0 37.0 37.0 37.0 125-129 35.610099999999996 37.0 37.0 37.0 37.0 37.0 130-134 35.747299999999996 37.0 37.0 37.0 37.0 37.0 135-139 35.6345 37.0 37.0 37.0 37.0 37.0 140-144 35.3505 37.0 37.0 37.0 34.6 37.0 145-149 35.388999999999996 37.0 37.0 37.0 37.0 37.0 150-151 35.03875 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 0.0 24 2.0 25 6.0 26 10.0 27 10.0 28 17.0 29 25.0 30 39.0 31 37.0 32 60.0 33 74.0 34 138.0 35 410.0 36 2927.0 37 244.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.858184561227056 14.08096555192356 10.384712094543627 43.67613779230576 2 18.725 15.225 37.325 28.725 3 17.95 18.5 25.674999999999997 37.875 4 21.625 26.400000000000002 22.7 29.275000000000002 5 22.625 33.975 23.225 20.175 6 22.275 35.4 21.7 20.625 7 14.899999999999999 27.400000000000002 38.625 19.075 8 19.35 27.200000000000003 31.674999999999997 21.775 9 19.15 23.7 35.05 22.1 10-14 18.955 30.69 27.200000000000003 23.155 15-19 19.335 28.965000000000003 27.779999999999998 23.919999999999998 20-24 18.67 29.675 27.689999999999998 23.965 25-29 19.45 29.395 27.439999999999998 23.715 30-34 19.75 29.409999999999997 26.91 23.93 35-39 19.66 29.54 27.675 23.125 40-44 19.580000000000002 29.235 27.839999999999996 23.345 45-49 20.080000000000002 28.78 27.07 24.07 50-54 20.09 27.985 28.395 23.53 55-59 19.81 28.449999999999996 27.985 23.755000000000003 60-64 19.575 29.354999999999997 27.395000000000003 23.674999999999997 65-69 19.43 28.444999999999997 28.189999999999998 23.935000000000002 70-74 19.35 29.4 27.250000000000004 24.0 75-79 19.81 28.444999999999997 27.72 24.025 80-84 19.665 28.96 27.605 23.77 85-89 20.825 28.715000000000003 27.16 23.3 90-94 20.080000000000002 28.694999999999997 27.400000000000002 23.825 95-99 20.61 27.935 27.750000000000004 23.705000000000002 100-104 20.064999999999998 28.449999999999996 27.665 23.82 105-109 20.09 28.15 27.61 24.15 110-114 20.51 28.24 27.465 23.785 115-119 20.369999999999997 28.925 26.845000000000002 23.86 120-124 20.97 28.375 26.755000000000003 23.9 125-129 20.724999999999998 28.194999999999997 26.87 24.21 130-134 21.04 28.715000000000003 26.55 23.695 135-139 19.945 28.439999999999998 27.185 24.43 140-144 21.445 28.794999999999998 25.380000000000003 24.38 145-149 20.93 28.360000000000003 26.424999999999997 24.285 150-151 20.549999999999997 27.375 26.6 25.474999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.5 12 0.5 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 1.5 23 2.5 24 2.0 25 4.5 26 7.0 27 6.5 28 9.5 29 14.0 30 27.5 31 36.5 32 40.5 33 64.5 34 66.0 35 65.0 36 89.0 37 111.5 38 132.5 39 166.0 40 192.5 41 208.5 42 245.5 43 265.0 44 252.0 45 264.0 46 271.5 47 241.5 48 218.5 49 200.0 50 172.5 51 133.5 52 108.5 53 85.0 54 68.5 55 55.5 56 37.5 57 30.0 58 20.5 59 17.5 60 18.5 61 12.0 62 6.0 63 6.0 64 3.5 65 3.5 66 4.0 67 2.0 68 0.5 69 0.5 70 1.0 71 1.0 72 1.5 73 1.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.575 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.6 #Duplication Level Percentage of deduplicated Percentage of total 1 84.061004784689 70.275 2 12.97846889952153 21.7 3 2.302631578947368 5.775 4 0.5980861244019139 2.0 5 0.05980861244019139 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCATAATGAATCAACAGCGACGGGCTACTACTGTCCTTTAACTGCCTTCC 5 0.125 No Hit GTTACTCCTGTATTACACACCTTTCTTGTGCTACAATAATTTAATCAAAG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.2625 0.0 0.0 0.0 0.0 84-85 0.3 0.0 0.0 0.0 0.0 86-87 0.3375 0.0 0.0 0.0 0.0 88-89 0.4 0.0 0.0 0.0 0.0 90-91 0.48750000000000004 0.0 0.0 0.0 0.0 92-93 0.7125 0.0 0.0 0.0 0.0 94-95 0.9875 0.0 0.0 0.0 0.0 96-97 1.2374999999999998 0.0 0.0 0.0 0.0 98-99 1.4500000000000002 0.0 0.0 0.0 0.0 100-101 1.65 0.0 0.0 0.0 0.0 102-103 1.975 0.0 0.0 0.0 0.0 104-105 2.3375 0.0 0.0 0.0 0.0 106-107 2.575 0.0 0.0 0.0 0.0 108-109 3.125 0.0 0.0 0.0 0.0 110-111 3.4875 0.0 0.0 0.0 0.0 112-113 3.85 0.0 0.0 0.0 0.0 114-115 4.387499999999999 0.0 0.0 0.0 0.0 116-117 5.0 0.0 0.0 0.0 0.0 118-119 5.4625 0.0 0.0 0.0 0.0 120-121 5.8375 0.0 0.0 0.0 0.0 122-123 6.275 0.0 0.0 0.0 0.0 124-125 7.05 0.0 0.0 0.0 0.0 126-127 7.762499999999999 0.0 0.0 0.0 0.0 128-129 8.25 0.0 0.0 0.0 0.0 130-131 8.9125 0.0 0.0 0.0 0.0 132-133 9.537500000000001 0.0 0.0 0.0 0.0 134-135 10.337499999999999 0.0 0.0 0.0 0.0 136-137 11.125 0.0 0.0 0.0 0.0 138-139 12.1875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AACAGTG 10 0.006830828 145.0 3 CCCCCCC 20 0.00593511 29.0 125-129 >>END_MODULE SRR28623308 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623308_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.796 37.0 37.0 37.0 37.0 37.0 2 36.341 37.0 37.0 37.0 37.0 37.0 3 36.282 37.0 37.0 37.0 37.0 37.0 4 36.246 37.0 37.0 37.0 37.0 37.0 5 36.3595 37.0 37.0 37.0 37.0 37.0 6 36.273 37.0 37.0 37.0 37.0 37.0 7 36.319 37.0 37.0 37.0 37.0 37.0 8 36.341 37.0 37.0 37.0 37.0 37.0 9 36.14 37.0 37.0 37.0 37.0 37.0 10-14 36.2208 37.0 37.0 37.0 37.0 37.0 15-19 36.2433 37.0 37.0 37.0 37.0 37.0 20-24 36.2904 37.0 37.0 37.0 37.0 37.0 25-29 36.238099999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.0934 37.0 37.0 37.0 37.0 37.0 35-39 36.1476 37.0 37.0 37.0 37.0 37.0 40-44 36.0894 37.0 37.0 37.0 37.0 37.0 45-49 36.0932 37.0 37.0 37.0 37.0 37.0 50-54 36.048 37.0 37.0 37.0 37.0 37.0 55-59 35.930400000000006 37.0 37.0 37.0 37.0 37.0 60-64 35.9486 37.0 37.0 37.0 37.0 37.0 65-69 35.889799999999994 37.0 37.0 37.0 37.0 37.0 70-74 35.9131 37.0 37.0 37.0 37.0 37.0 75-79 35.9651 37.0 37.0 37.0 37.0 37.0 80-84 35.820800000000006 37.0 37.0 37.0 37.0 37.0 85-89 35.8638 37.0 37.0 37.0 37.0 37.0 90-94 35.6879 37.0 37.0 37.0 37.0 37.0 95-99 35.7726 37.0 37.0 37.0 37.0 37.0 100-104 35.6915 37.0 37.0 37.0 37.0 37.0 105-109 35.6257 37.0 37.0 37.0 37.0 37.0 110-114 35.635200000000005 37.0 37.0 37.0 37.0 37.0 115-119 35.6194 37.0 37.0 37.0 37.0 37.0 120-124 35.581399999999995 37.0 37.0 37.0 37.0 37.0 125-129 35.075900000000004 37.0 37.0 37.0 29.8 37.0 130-134 35.44 37.0 37.0 37.0 37.0 37.0 135-139 35.256299999999996 37.0 37.0 37.0 32.2 37.0 140-144 35.3352 37.0 37.0 37.0 34.6 37.0 145-149 35.265 37.0 37.0 37.0 32.2 37.0 150-151 34.73375 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 1.0 15 5.0 16 2.0 17 0.0 18 0.0 19 2.0 20 0.0 21 3.0 22 2.0 23 6.0 24 8.0 25 9.0 26 8.0 27 21.0 28 24.0 29 22.0 30 25.0 31 42.0 32 61.0 33 82.0 34 219.0 35 627.0 36 2577.0 37 253.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.0 19.3 14.95 28.749999999999996 2 27.900000000000002 25.525 30.925000000000004 15.65 3 20.225 28.525 30.925000000000004 20.325 4 24.725 33.800000000000004 23.275000000000002 18.2 5 25.874999999999996 35.475 22.35 16.3 6 20.424999999999997 38.550000000000004 22.55 18.475 7 19.975 22.325 39.025 18.675 8 22.175 24.65 29.375 23.799999999999997 9 20.575 25.424999999999997 31.05 22.95 10-14 23.48 29.595 26.19 20.735 15-19 23.155 27.27 28.384999999999998 21.19 20-24 22.68 29.195 27.355 20.77 25-29 23.365 28.215 27.169999999999998 21.25 30-34 22.74 28.225 28.33 20.705000000000002 35-39 23.28 27.83 28.139999999999997 20.75 40-44 22.865 28.439999999999998 27.735 20.96 45-49 23.380000000000003 28.57 27.74 20.31 50-54 23.325000000000003 28.050000000000004 28.494999999999997 20.13 55-59 23.365 27.37 28.810000000000002 20.455000000000002 60-64 23.04 28.189999999999998 28.345 20.424999999999997 65-69 23.565 28.455000000000002 27.91 20.07 70-74 24.07 28.335 27.534999999999997 20.06 75-79 23.3 27.810000000000002 28.03 20.86 80-84 23.77 27.6 28.544999999999998 20.085 85-89 23.830000000000002 28.199999999999996 28.465 19.505 90-94 23.605 28.125 28.310000000000002 19.96 95-99 23.94 28.310000000000002 27.97 19.78 100-104 23.455000000000002 28.410000000000004 27.66 20.474999999999998 105-109 23.7 27.985 27.99 20.325 110-114 23.655 27.755000000000003 28.34 20.25 115-119 25.1 27.88 27.415 19.605 120-124 24.404999999999998 28.305000000000003 27.74 19.55 125-129 24.654999999999998 28.494999999999997 27.389999999999997 19.46 130-134 25.365 28.38 27.32 18.935 135-139 25.874999999999996 28.27 26.715 19.139999999999997 140-144 25.555 27.744999999999997 27.68 19.02 145-149 26.52 27.439999999999998 26.625 19.415 150-151 25.5625 28.1625 26.5625 19.7125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 1.0 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 0.5 14 0.5 15 2.5 16 3.0 17 2.5 18 3.0 19 1.5 20 0.5 21 2.0 22 2.0 23 1.5 24 3.5 25 4.0 26 5.5 27 5.0 28 5.5 29 14.0 30 22.0 31 28.0 32 37.0 33 48.5 34 56.5 35 65.5 36 75.5 37 117.0 38 156.5 39 170.5 40 195.5 41 221.5 42 223.0 43 252.0 44 276.0 45 262.0 46 267.5 47 255.0 48 239.0 49 207.0 50 150.5 51 121.5 52 115.0 53 93.0 54 61.5 55 50.5 56 39.0 57 28.0 58 22.0 59 12.0 60 12.0 61 15.0 62 14.5 63 9.0 64 3.5 65 1.5 66 2.5 67 3.5 68 2.0 69 0.5 70 1.0 71 1.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.5 95 0.5 96 0.0 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.275 #Duplication Level Percentage of deduplicated Percentage of total 1 84.78196380895878 71.45 2 12.459210916641945 21.0 3 2.1655295164639576 5.475 4 0.5043013942450312 1.7000000000000002 5 0.08899436369029962 0.375 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGTTTCACATGTTGTTGGGGGTAATGGTGCAATAGTTTTATATGAAGGCG 5 0.125 No Hit GCTAAGCACACAAATTAAGGCTTAAAGATATAGAGAGAAAGAAACAACAT 5 0.125 No Hit GAAAAATTCCTGTTTTTGTTGAGAAAAAAGTCTTGATTTTTTTTTGTTAG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.2625 0.0 0.0 0.0 0.0 84-85 0.3 0.0 0.0 0.0 0.0 86-87 0.3375 0.0 0.0 0.0 0.0 88-89 0.4125 0.0 0.0 0.0 0.0 90-91 0.48750000000000004 0.0 0.0 0.0 0.0 92-93 0.7125 0.0 0.0 0.0 0.0 94-95 0.9875 0.0 0.0 0.0 0.0 96-97 1.2374999999999998 0.0 0.0 0.0 0.0 98-99 1.4500000000000002 0.0 0.0 0.0 0.0 100-101 1.65 0.0 0.0 0.0 0.0 102-103 2.0 0.0 0.0 0.0 0.0 104-105 2.3625 0.0 0.0 0.0 0.0 106-107 2.5999999999999996 0.0 0.0 0.0 0.0 108-109 3.15 0.0 0.0 0.0 0.0 110-111 3.5125 0.0 0.0 0.0 0.0 112-113 3.875 0.0 0.0 0.0 0.0 114-115 4.4125 0.0 0.0 0.0 0.0 116-117 5.025 0.0 0.0 0.0 0.0 118-119 5.487500000000001 0.0 0.0 0.0 0.0 120-121 5.8625 0.0 0.0 0.0 0.0 122-123 6.3125 0.0 0.0 0.0 0.0 124-125 7.1 0.0 0.0 0.0 0.0 126-127 7.862500000000001 0.0 0.0 0.0 0.0 128-129 8.375 0.0 0.0 0.0 0.0 130-131 9.0625 0.0 0.0 0.0 0.0 132-133 9.7625 0.0 0.0 0.0 0.0 134-135 10.575 0.0 0.0 0.0 0.0 136-137 11.337499999999999 0.0 0.0 0.0 0.0 138-139 12.412500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACAAAAT 10 0.006830828 145.0 1 AGGACAT 10 0.006830828 145.0 1 CAACACT 10 0.006830828 145.0 3 TACAATT 10 0.006830828 145.0 2 ATTTCAA 10 0.006830828 145.0 5 >>END_MODULE Read 1940982 spots for SRR28623308.sra Written 1940982 spots for SRR28623308.sra Read 1940982 spots for SRR28623308.sra Written 1940982 spots for SRR28623308.sra Read 1940982 spots for SRR28623308.sra Written 1940982 spots for SRR28623308.sra Read 1940982 spots for SRR28623308.sra Written 1940982 spots for SRR28623308.sra Read 1940982 spots for SRR28623308.sra Written 1940982 spots for SRR28623308.sra Read 1940982 spots for SRR28623308.sra Written 1940982 spots for SRR28623308.sra Read 1940982 spots for SRR28623308.sra Written 1940982 spots for SRR28623308.sra Read 1940982 spots for SRR28623308.sra Written 1940982 spots for SRR28623308.sra Read 1940982 spots for SRR28623308.sra Written 1940982 spots for SRR28623308.sra Read 1940982 spots for SRR28623308.sra Written 1940982 spots for SRR28623308.sra Read 1940982 spots for SRR28623308.sra Written 1940982 spots for SRR28623308.sra Read 1940982 spots for SRR28623308.sra Written 1940982 spots for SRR28623308.sra Read 1940982 spots for SRR28623308.sra Written 1940982 spots for SRR28623308.sra Read 1940982 spots for SRR28623308.sra Written 1940982 spots for SRR28623308.sra Read 1940982 spots for SRR28623308.sra Written 1940982 spots for SRR28623308.sra Read 1940982 spots for SRR28623308.sra Written 1940982 spots for SRR28623308.sra Read 1940989 spots for SRR28623308.sra Written 1940989 spots for SRR28623308.sra Read 1940982 spots for SRR28623308.sra Written 1940982 spots for SRR28623308.sra Read 1940982 spots for SRR28623308.sra Written 1940982 spots for SRR28623308.sra Read 1940982 spots for SRR28623308.sra Written 1940982 spots for SRR28623308.sra SRR ids: ['SRR28623308.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qog8tkdt SRR28623308.sra spots: 38819647 blocks: [[1, 1940982], [1940983, 3881964], [3881965, 5822946], [5822947, 7763928], [7763929, 9704910], [9704911, 11645892], [11645893, 13586874], [13586875, 15527856], [15527857, 17468838], [17468839, 19409820], [19409821, 21350802], [21350803, 23291784], [23291785, 25232766], [25232767, 27173748], [27173749, 29114730], [29114731, 31055712], [31055713, 32996694], [32996695, 34937676], [34937677, 36878658], [36878659, 38819647]] SRR28623308 file size 14336715 SRR28623308 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR28623308 SRR28623308_1.fastq SRR28623308_2.fastq Input file: SRR28623308_1.fastq Paired file: SRR28623308_2.fastq trimmed: SRR28623308-trimmed-pair1.fastq, SRR28623308-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 18:33:31 2025 >> started Tue Feb 11 18:34:35 2025 >> done (63.895s) 38819647 read pairs processed; of these: 24 ( 0.00%) short read pairs filtered out after trimming by size control 10494 ( 0.03%) empty read pairs filtered out after trimming by size control 38809129 (99.97%) read pairs available; of these: 6506863 (16.77%) trimmed read pairs available after processing 32302266 (83.23%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 4 0.00% 20 3 0.00% 21 7 0.00% 22 7 0.00% 23 7 0.00% 24 10 0.00% 25 9 0.00% 26 8 0.00% 27 16 0.00% 28 13 0.00% 29 15 0.00% 30 28 0.00% 31 18 0.00% 32 19 0.00% 33 33 0.00% 34 15 0.00% 35 19 0.00% 36 43 0.00% 37 34 0.00% 38 41 0.00% 39 52 0.00% 40 62 0.00% 41 79 0.00% 42 82 0.00% 43 81 0.00% 44 80 0.00% 45 92 0.00% 46 119 0.00% 47 148 0.00% 48 153 0.00% 49 226 0.00% 50 226 0.00% 51 255 0.00% 52 302 0.00% 53 339 0.00% 54 363 0.00% 55 399 0.00% 56 448 0.00% 57 545 0.00% 58 671 0.00% 59 787 0.00% 60 931 0.00% 61 1026 0.00% 62 1209 0.00% 63 1361 0.00% 64 1590 0.00% 65 1820 0.00% 66 2061 0.01% 67 2228 0.01% 68 2611 0.01% 69 2998 0.01% 70 3408 0.01% 71 4049 0.01% 72 4659 0.01% 73 5372 0.01% 74 6119 0.02% 75 6907 0.02% 76 7829 0.02% 77 8399 0.02% 78 9364 0.02% 79 10665 0.03% 80 11942 0.03% 81 13400 0.03% 82 15073 0.04% 83 16820 0.04% 84 18667 0.05% 85 20789 0.05% 86 22480 0.06% 87 24272 0.06% 88 26329 0.07% 89 28211 0.07% 90 30721 0.08% 91 33000 0.09% 92 35515 0.09% 93 37843 0.10% 94 41501 0.11% 95 43502 0.11% 96 46803 0.12% 97 49134 0.13% 98 51272 0.13% 99 53842 0.14% 100 56510 0.15% 101 58616 0.15% 102 61814 0.16% 103 64907 0.17% 104 67569 0.17% 105 70989 0.18% 106 73927 0.19% 107 76641 0.20% 108 78510 0.20% 109 80915 0.21% 110 82358 0.21% 111 85679 0.22% 112 87956 0.23% 113 89604 0.23% 114 92282 0.24% 115 96535 0.25% 116 98709 0.25% 117 101171 0.26% 118 104506 0.27% 119 106372 0.27% 120 107110 0.28% 121 109845 0.28% 122 111776 0.29% 123 113170 0.29% 124 116283 0.30% 125 118435 0.31% 126 120823 0.31% 127 123998 0.32% 128 125432 0.32% 129 126158 0.33% 130 128317 0.33% 131 128575 0.33% 132 130465 0.34% 133 133344 0.34% 134 132902 0.34% 135 134924 0.35% 136 137852 0.36% 137 139502 0.36% 138 140159 0.36% 139 142712 0.37% 140 142657 0.37% 141 144144 0.37% 142 146400 0.38% 143 146873 0.38% 144 148292 0.38% 145 149763 0.39% 146 148984 0.38% 147 150916 0.39% 148 152759 0.39% 149 152461 0.39% 150 154678 0.40% 151 32302266 83.23% 38809129 reads passed initial QC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=40 prefix-density=0.12 prefix-fanout=2.0 sequence=TGCGACATGGTTGGCAAGAATCCTTCTGCGAATTTAGCAACAACCGAAGAATCAAGATACTCCTGCAAGCCCTCCAGATCATCAAAGGTAGTTTCAAAAGCATGAGTATATCCGAAATTGAGGTCGTGAATACCCAGATTAGTGCCCCAGTGTAAGCTCTTCAAGGGTTCAACTTGATTGACCAGATGAGTGAAGTCGTTTATGATTTTCTCAATTT criterion=fanout-score sequence-density=0.07 sequence-density-rank=10 fanout-score=381.99 fanout-score-rank=1 prefix-density=0.99 prefix-fanout=28.1 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=17.32 fanout-score-rank=13 prefix-density=0.17 prefix-fanout=17.3 sequence=GAGAGAGAGAGTTAAGACAATGGCCTCGAAGAAATCTGCAATCGTATTACCTGGTTCAAAGGTGTTGAAGCACATAGTTTTTGTACGGTTTAATGATGGGATCACTGATGAACAAATTGAGAA criterion=fanout-score sequence-density=0.07 sequence-density-rank=12 fanout-score=335.69 fanout-score-rank=1 prefix-density=0.87 prefix-fanout=28.8 sequence=GAAGAAGAAGAAA SRR28623308 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 18:35:23 Started mapping on | Feb 11 18:35:23 Finished on | Feb 11 18:39:22 Mapping speed, Million of reads per hour | 584.57 Number of input reads | 38809129 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 36585576 Uniquely mapped reads % | 94.27% Average mapped length | 291.62 Number of splices: Total | 33571600 Number of splices: Annotated (sjdb) | 32864463 Number of splices: GT/AG | 33001308 Number of splices: GC/AG | 437346 Number of splices: AT/AC | 30086 Number of splices: Non-canonical | 102860 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.03% Deletion average length | 2.91 Insertion rate per base | 0.03% Insertion average length | 2.43 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 990275 % of reads mapped to multiple loci | 2.55% Number of reads mapped to too many loci | 224182 % of reads mapped to too many loci | 0.58% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.44% % of reads unmapped: other | 0.16% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1233278 1233278 1233278 N_multimapping 990275 990275 990275 N_noFeature 1346969 36194106 1536773 N_ambiguous 408262 2955 204417 UnstrandedReadsAssigned:34830345 PositiveStrandReadsAssigned:388515 NegativeStrandReadsAssigned:34844386 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR28623308 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR28623308-trimmed-pair1.fastq SRR28623308-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 38,809,129 reads, 35,216,389 reads pseudoaligned [quant] estimated average fragment length: 226.966 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,166 rounds 52401 SRR28623308.ke.tsv 34699 SRR28623308.se.tsv 87100 total ==> SRR28623308.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1792.03 1103 16.4471 Potri.005G024800.1.v4.1 1035 809.034 638 21.0724 Potri.004G059700.1.v4.1 961 735.061 131 4.7622 Potri.007G009000.2.v4.1 1416 1190.03 1 0.0224543 Potri.003G141000.2.v4.1 2943 2717.03 962.139 9.46241 Potri.016G087400.1.v4.1 270 94.6337 3129.69 883.721 Potri.015G069301.1.v4.1 564 343.797 0 0 Potri.010G195200.1.v4.1 1773 1547.03 114 1.96908 Potri.012G127500.1.v4.1 977 751.048 20459 727.908 ==> SRR28623308.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1416 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 488 Potri.001G212900.v4.1 24 Potri.001G182400.v4.1 9 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 3 Potri.001G452600.v4.1 0 SRR28623308 completed mapping pipeline successfully