Starting /dee2/code/volunteer_pipeline.sh SRR28623309 current disk space = 3049060597760 free memory = 1418996144 SRR28623309 SRAfilesize 79b14f8e26ef899dbe16fd9b7a13ea63 SRR28623309.sra SRR28623309.sra file validated SRR28623309 is paired end SRR28623309 is conventional basespace SRR28623309 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623309_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.48125 37.0 37.0 37.0 37.0 37.0 2 36.441 37.0 37.0 37.0 37.0 37.0 3 36.658 37.0 37.0 37.0 37.0 37.0 4 36.627 37.0 37.0 37.0 37.0 37.0 5 36.589 37.0 37.0 37.0 37.0 37.0 6 36.7425 37.0 37.0 37.0 37.0 37.0 7 36.5795 37.0 37.0 37.0 37.0 37.0 8 36.488 37.0 37.0 37.0 37.0 37.0 9 36.5905 37.0 37.0 37.0 37.0 37.0 10-14 36.5773 37.0 37.0 37.0 37.0 37.0 15-19 36.5318 37.0 37.0 37.0 37.0 37.0 20-24 36.5501 37.0 37.0 37.0 37.0 37.0 25-29 36.4859 37.0 37.0 37.0 37.0 37.0 30-34 36.4734 37.0 37.0 37.0 37.0 37.0 35-39 36.456 37.0 37.0 37.0 37.0 37.0 40-44 36.4121 37.0 37.0 37.0 37.0 37.0 45-49 36.4265 37.0 37.0 37.0 37.0 37.0 50-54 36.36409999999999 37.0 37.0 37.0 37.0 37.0 55-59 36.3165 37.0 37.0 37.0 37.0 37.0 60-64 36.2658 37.0 37.0 37.0 37.0 37.0 65-69 36.2401 37.0 37.0 37.0 37.0 37.0 70-74 36.2102 37.0 37.0 37.0 37.0 37.0 75-79 36.2075 37.0 37.0 37.0 37.0 37.0 80-84 36.1306 37.0 37.0 37.0 37.0 37.0 85-89 36.1673 37.0 37.0 37.0 37.0 37.0 90-94 36.0175 37.0 37.0 37.0 37.0 37.0 95-99 35.8744 37.0 37.0 37.0 37.0 37.0 100-104 35.9813 37.0 37.0 37.0 37.0 37.0 105-109 35.9689 37.0 37.0 37.0 37.0 37.0 110-114 35.87 37.0 37.0 37.0 37.0 37.0 115-119 35.9018 37.0 37.0 37.0 37.0 37.0 120-124 35.7321 37.0 37.0 37.0 37.0 37.0 125-129 35.591300000000004 37.0 37.0 37.0 37.0 37.0 130-134 35.7408 37.0 37.0 37.0 37.0 37.0 135-139 35.6167 37.0 37.0 37.0 37.0 37.0 140-144 35.3516 37.0 37.0 37.0 34.6 37.0 145-149 35.394499999999994 37.0 37.0 37.0 34.6 37.0 150-151 35.168 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 1.0 21 0.0 22 1.0 23 1.0 24 2.0 25 4.0 26 5.0 27 3.0 28 21.0 29 21.0 30 29.0 31 50.0 32 60.0 33 88.0 34 141.0 35 372.0 36 2915.0 37 285.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.081182660987224 13.580556251566023 10.573791029817087 39.76447005762967 2 17.974999999999998 14.899999999999999 37.05 30.075000000000003 3 16.650000000000002 20.325 30.525000000000002 32.5 4 21.425 27.250000000000004 24.375 26.950000000000003 5 23.0 34.575 23.45 18.975 6 20.7 36.425000000000004 22.6 20.275000000000002 7 14.95 28.375 40.9 15.775 8 18.65 26.85 30.85 23.65 9 18.15 23.724999999999998 33.95 24.175 10-14 18.86 31.064999999999998 27.62 22.455 15-19 19.685 29.09 27.245 23.98 20-24 19.400000000000002 29.189999999999998 27.994999999999997 23.415 25-29 19.43 29.505 27.52 23.544999999999998 30-34 19.495 28.92 28.345 23.24 35-39 19.759999999999998 29.220000000000002 27.725 23.294999999999998 40-44 20.025000000000002 29.18 27.384999999999998 23.41 45-49 19.67 29.220000000000002 27.855 23.255 50-54 19.900000000000002 28.88 27.485 23.735 55-59 19.59 28.895 27.810000000000002 23.705000000000002 60-64 19.43 28.78 27.595 24.195 65-69 19.695 28.49 28.035 23.78 70-74 20.16 28.735 27.229999999999997 23.875 75-79 19.46 29.270000000000003 27.860000000000003 23.41 80-84 19.25 28.895 28.27 23.585 85-89 19.86 28.95 27.825 23.365 90-94 19.785 29.56 26.915 23.74 95-99 20.195 29.659999999999997 26.87 23.275000000000002 100-104 20.71 28.815 26.810000000000002 23.665 105-109 20.48 28.935 26.995 23.59 110-114 20.380000000000003 28.975 26.995 23.65 115-119 20.835 28.575 26.935 23.655 120-124 20.645 29.360000000000003 26.5 23.494999999999997 125-129 20.605 28.854999999999997 26.674999999999997 23.865 130-134 20.625 28.875 26.490000000000002 24.01 135-139 20.57 28.49 26.740000000000002 24.2 140-144 20.575 28.199999999999996 26.534999999999997 24.69 145-149 21.435000000000002 28.585 26.015 23.965 150-151 20.6875 29.349999999999998 26.237500000000004 23.724999999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.5 20 0.5 21 1.5 22 3.5 23 3.5 24 4.5 25 4.0 26 8.0 27 11.0 28 14.0 29 18.5 30 27.0 31 45.0 32 47.0 33 41.0 34 56.5 35 83.0 36 100.0 37 118.5 38 148.0 39 168.0 40 201.5 41 244.0 42 251.5 43 253.0 44 237.5 45 227.0 46 252.0 47 271.0 48 232.0 49 198.5 50 171.5 51 116.5 52 92.5 53 82.5 54 65.0 55 55.0 56 38.5 57 23.5 58 24.0 59 15.5 60 8.0 61 8.0 62 9.0 63 6.0 64 3.5 65 1.5 66 1.0 67 0.5 68 0.5 69 0.0 70 1.5 71 1.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.22499999999999998 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 84.7644603458557 71.075 2 12.224209898628503 20.5 3 2.265951103160406 5.7 4 0.5366726296958855 1.7999999999999998 5 0.1490757304710793 0.625 6 0.05963029218843172 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGGATAGATAAAAACCAACATAAAACTTAGTCAAACAGACTGAAACCCA 6 0.15 No Hit GTCTGGCTTGGAGTCCCGGATGCAAAAAGTAAACAGATTCAAGATGACTC 6 0.15 No Hit GCTGACTTCAGACTGGGAGCTACATCTGCAGTTATTCCCAACCTCTGCAA 5 0.125 No Hit GCTTCATTCACGGTGATGTTACGCCCATCAAGGTCTTGGCCGTTCATTCC 5 0.125 No Hit GTGTTCATCATCAAGGCGCTTCCATGTTTTGATAGACTTGACAGCTCCCC 5 0.125 No Hit GTCCTTTCAACCCACTGCAGCAAGCTGCAGGCACAGCCCCACCCTTCTGG 5 0.125 No Hit GGTCTGTTTAAGAAGCAGCAGATTCCTTGGAAATCTTCTCAGCCTTGGCA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.07500000000000001 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.16249999999999998 0.0 0.0 0.0 0.0 76-77 0.21250000000000002 0.0 0.0 0.0 0.0 78-79 0.2875 0.0 0.0 0.0 0.0 80-81 0.35 0.0 0.0 0.0 0.0 82-83 0.4375 0.0 0.0 0.0 0.0 84-85 0.5875 0.0 0.0 0.0 0.0 86-87 0.725 0.0 0.0 0.0 0.0 88-89 0.775 0.0 0.0 0.0 0.0 90-91 0.9 0.0 0.0 0.0 0.0 92-93 1.0625 0.0 0.0 0.0 0.0 94-95 1.1625 0.0 0.0 0.0 0.0 96-97 1.6749999999999998 0.0 0.0 0.0 0.0 98-99 1.975 0.0 0.0 0.0 0.0 100-101 2.25 0.0 0.0 0.0 0.0 102-103 2.4875 0.0 0.0 0.0 0.0 104-105 2.7875 0.0 0.0 0.0 0.0 106-107 3.2249999999999996 0.0 0.0 0.0 0.0 108-109 3.95 0.0 0.0 0.0 0.0 110-111 4.675 0.0 0.0 0.0 0.0 112-113 5.2625 0.0 0.0 0.0 0.0 114-115 5.8625 0.0 0.0 0.0 0.0 116-117 6.3125 0.0 0.0 0.0 0.0 118-119 6.887499999999999 0.0 0.0 0.0 0.0 120-121 7.5375 0.0 0.0 0.0 0.0 122-123 8.375 0.0 0.0 0.0 0.0 124-125 8.975 0.0 0.0 0.0 0.0 126-127 9.649999999999999 0.0 0.0 0.0 0.0 128-129 10.3 0.0 0.0 0.0 0.0 130-131 10.9875 0.0 0.0 0.0 0.0 132-133 11.5875 0.0 0.0 0.0 0.0 134-135 12.399999999999999 0.0 0.0 0.0 0.0 136-137 13.149999999999999 0.0 0.0 0.0 0.0 138-139 13.7875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGATAGA 10 0.006830828 145.0 3 CTGGATA 10 0.006830828 145.0 1 ATAAAAA 10 0.006830828 145.0 9 ATAGATA 10 0.006830828 145.0 5 TGGATAG 10 0.006830828 145.0 2 TAGATAA 10 0.006830828 145.0 6 GATAGAT 10 0.006830828 145.0 4 >>END_MODULE SRR28623309 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623309_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.8295 37.0 37.0 37.0 37.0 37.0 2 36.303 37.0 37.0 37.0 37.0 37.0 3 36.3505 37.0 37.0 37.0 37.0 37.0 4 36.258 37.0 37.0 37.0 37.0 37.0 5 36.322 37.0 37.0 37.0 37.0 37.0 6 36.2765 37.0 37.0 37.0 37.0 37.0 7 36.278 37.0 37.0 37.0 37.0 37.0 8 36.2745 37.0 37.0 37.0 37.0 37.0 9 36.1445 37.0 37.0 37.0 37.0 37.0 10-14 36.13870000000001 37.0 37.0 37.0 37.0 37.0 15-19 36.1263 37.0 37.0 37.0 37.0 37.0 20-24 36.1381 37.0 37.0 37.0 37.0 37.0 25-29 36.106 37.0 37.0 37.0 37.0 37.0 30-34 35.9901 37.0 37.0 37.0 37.0 37.0 35-39 36.0093 37.0 37.0 37.0 37.0 37.0 40-44 35.9807 37.0 37.0 37.0 37.0 37.0 45-49 35.96130000000001 37.0 37.0 37.0 37.0 37.0 50-54 35.916700000000006 37.0 37.0 37.0 37.0 37.0 55-59 35.8007 37.0 37.0 37.0 37.0 37.0 60-64 35.7798 37.0 37.0 37.0 37.0 37.0 65-69 35.826100000000004 37.0 37.0 37.0 37.0 37.0 70-74 35.8107 37.0 37.0 37.0 37.0 37.0 75-79 35.782 37.0 37.0 37.0 37.0 37.0 80-84 35.7149 37.0 37.0 37.0 37.0 37.0 85-89 35.674400000000006 37.0 37.0 37.0 37.0 37.0 90-94 35.63119999999999 37.0 37.0 37.0 37.0 37.0 95-99 35.640100000000004 37.0 37.0 37.0 37.0 37.0 100-104 35.5211 37.0 37.0 37.0 37.0 37.0 105-109 35.5207 37.0 37.0 37.0 37.0 37.0 110-114 35.427 37.0 37.0 37.0 37.0 37.0 115-119 35.485800000000005 37.0 37.0 37.0 37.0 37.0 120-124 35.4522 37.0 37.0 37.0 37.0 37.0 125-129 34.9997 37.0 37.0 37.0 27.4 37.0 130-134 35.2718 37.0 37.0 37.0 34.6 37.0 135-139 35.005900000000004 37.0 37.0 37.0 27.4 37.0 140-144 35.031699999999994 37.0 37.0 37.0 25.0 37.0 145-149 34.9993 37.0 37.0 37.0 25.0 37.0 150-151 34.5835 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 4.0 14 5.0 15 6.0 16 6.0 17 2.0 18 6.0 19 4.0 20 4.0 21 3.0 22 9.0 23 12.0 24 8.0 25 9.0 26 8.0 27 22.0 28 14.0 29 24.0 30 18.0 31 31.0 32 64.0 33 103.0 34 199.0 35 600.0 36 2579.0 37 260.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.0 21.0 14.124999999999998 23.875 2 28.925 25.974999999999998 27.800000000000004 17.299999999999997 3 22.7 27.800000000000004 29.525000000000002 19.975 4 25.174999999999997 34.050000000000004 24.2 16.575 5 26.05 35.65 21.025 17.275 6 20.875 40.2 21.875 17.05 7 21.3 22.3 37.75 18.65 8 21.725 25.374999999999996 28.275 24.625 9 23.375 25.525 28.675 22.425 10-14 24.375 28.945 26.305 20.375 15-19 24.0 28.470000000000002 27.689999999999998 19.84 20-24 23.465 28.110000000000003 28.515 19.91 25-29 23.56 28.560000000000002 27.85 20.03 30-34 23.745 27.384999999999998 28.389999999999997 20.48 35-39 23.294999999999998 27.839999999999996 28.275 20.59 40-44 23.34 28.655 27.965 20.04 45-49 23.445 27.650000000000002 28.985 19.919999999999998 50-54 22.905 28.52 28.225 20.349999999999998 55-59 23.775 28.665000000000003 27.575 19.985 60-64 23.585 28.515 27.505000000000003 20.395 65-69 22.939999999999998 28.48 28.12 20.46 70-74 23.47 27.985 28.349999999999998 20.195 75-79 23.825 27.839999999999996 28.59 19.744999999999997 80-84 23.525 27.38 28.71 20.385 85-89 23.544999999999998 27.88 28.58 19.994999999999997 90-94 24.34 28.115000000000002 28.055000000000003 19.49 95-99 24.115000000000002 27.534999999999997 28.7 19.650000000000002 100-104 24.705 28.515 27.189999999999998 19.59 105-109 24.41 28.035 27.58 19.975 110-114 24.310000000000002 27.744999999999997 28.13 19.814999999999998 115-119 25.025 27.965 27.74 19.27 120-124 25.174999999999997 28.49 27.245 19.09 125-129 25.990000000000002 28.050000000000004 27.605 18.355 130-134 26.015 28.12 27.045 18.82 135-139 25.805 28.405 27.22 18.57 140-144 25.919999999999998 28.48 27.435 18.165 145-149 26.195 28.13 26.755000000000003 18.92 150-151 27.200000000000003 26.875 27.287499999999998 18.637500000000003 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.5 8 0.5 9 0.0 10 0.5 11 1.5 12 1.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 1.5 19 2.0 20 1.5 21 3.5 22 4.0 23 4.0 24 7.0 25 6.5 26 4.5 27 11.5 28 17.5 29 18.0 30 23.5 31 25.5 32 35.5 33 43.0 34 48.0 35 73.5 36 95.5 37 111.5 38 138.0 39 158.5 40 178.0 41 222.0 42 248.5 43 256.0 44 277.0 45 293.5 46 285.5 47 237.0 48 204.0 49 182.0 50 152.5 51 138.5 52 111.5 53 89.5 54 71.0 55 50.5 56 35.0 57 27.5 58 21.5 59 11.5 60 8.5 61 8.0 62 7.5 63 7.0 64 6.0 65 2.0 66 2.0 67 4.5 68 2.5 69 0.0 70 0.5 71 2.0 72 1.5 73 0.0 74 0.5 75 1.0 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.5 91 1.0 92 0.5 93 1.0 94 1.0 95 0.0 96 0.0 97 0.5 98 0.5 99 1.5 100 3.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.375 #Duplication Level Percentage of deduplicated Percentage of total 1 85.48148148148148 72.125 2 11.614814814814816 19.6 3 2.2222222222222223 5.625 4 0.5037037037037037 1.7000000000000002 5 0.11851851851851852 0.5 6 0.02962962962962963 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02962962962962963 0.3 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 12 0.3 No Hit CGGTGAGCAGTGAGGTGTTGAAGAAATACCTGGAGGAGAAAATATATCCA 6 0.15 No Hit CCTGAAATGATTAGACTACTAGTTACAGTTGAGGATACAGGAGTGGGAAT 5 0.125 No Hit CTGACGGTTGCCCGTGCTCGTAAAATTCAGAGGTTCTTGAGCCAGCCCTT 5 0.125 No Hit GAGTGAGACAAGAAGGCATTAGCTCTGCTTCTGTGAACTCGGGCTTCTTC 5 0.125 No Hit GCCGCACCACACATGTTCATCAATGCCTACAAGAATGTTCTGGCTGTTGC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.07500000000000001 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.16249999999999998 0.0 0.0 0.0 0.0 76-77 0.21250000000000002 0.0 0.0 0.0 0.0 78-79 0.2875 0.0 0.0 0.0 0.0 80-81 0.35 0.0 0.0 0.0 0.0 82-83 0.4375 0.0 0.0 0.0 0.0 84-85 0.5875 0.0 0.0 0.0 0.0 86-87 0.725 0.0 0.0 0.0 0.0 88-89 0.775 0.0 0.0 0.0 0.0 90-91 0.9 0.0 0.0 0.0 0.0 92-93 1.0625 0.0 0.0 0.0 0.0 94-95 1.1625 0.0 0.0 0.0 0.0 96-97 1.6875 0.0 0.0 0.0 0.0 98-99 1.975 0.0 0.0 0.0 0.0 100-101 2.3 0.0 0.0 0.0 0.0 102-103 2.5375 0.0 0.0 0.0 0.0 104-105 2.8125 0.0 0.0 0.0 0.0 106-107 3.2625 0.0 0.0 0.0 0.0 108-109 3.95 0.0 0.0 0.0 0.0 110-111 4.6875 0.0 0.0 0.0 0.0 112-113 5.2875 0.0 0.0 0.0 0.0 114-115 5.9125 0.0 0.0 0.0 0.0 116-117 6.35 0.0 0.0 0.0 0.0 118-119 6.9375 0.0 0.0 0.0 0.0 120-121 7.6125 0.0 0.0 0.0 0.0 122-123 8.45 0.0 0.0 0.0 0.0 124-125 9.05 0.0 0.0 0.0 0.0 126-127 9.7 0.0 0.0 0.0 0.0 128-129 10.350000000000001 0.0 0.0 0.0 0.0 130-131 11.0625 0.0 0.0 0.0 0.0 132-133 11.6625 0.0 0.0 0.0 0.0 134-135 12.45 0.0 0.0 0.0 0.0 136-137 13.175 0.0 0.0 0.0 0.0 138-139 13.8375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTTCCT 10 0.006830828 145.0 6 ACCACAC 10 0.006830828 145.0 6 CCGCACC 10 0.006830828 145.0 2 ACACATG 10 0.006830828 145.0 9 ACTTTCC 10 0.006830828 145.0 5 CCACACA 10 0.006830828 145.0 7 CACCACA 10 0.006830828 145.0 5 GCCGCAC 10 0.006830828 145.0 1 GCTGCTG 35 0.0033124194 62.14286 145 >>END_MODULE Read 1517961 spots for SRR28623309.sra Written 1517961 spots for SRR28623309.sra Read 1517961 spots for SRR28623309.sra Written 1517961 spots for SRR28623309.sra Read 1517961 spots for SRR28623309.sra Written 1517961 spots for SRR28623309.sra Read 1517961 spots for SRR28623309.sra Written 1517961 spots for SRR28623309.sra Read 1517961 spots for SRR28623309.sra Written 1517961 spots for SRR28623309.sra Read 1517961 spots for SRR28623309.sra Written 1517961 spots for SRR28623309.sra Read 1517976 spots for SRR28623309.sra Written 1517976 spots for SRR28623309.sra Read 1517961 spots for SRR28623309.sra Written 1517961 spots for SRR28623309.sra Read 1517961 spots for SRR28623309.sra Written 1517961 spots for SRR28623309.sra Read 1517961 spots for SRR28623309.sra Written 1517961 spots for SRR28623309.sra Read 1517961 spots for SRR28623309.sra Written 1517961 spots for SRR28623309.sra Read 1517961 spots for SRR28623309.sra Written 1517961 spots for SRR28623309.sra Read 1517961 spots for SRR28623309.sra Written 1517961 spots for SRR28623309.sra Read 1517961 spots for SRR28623309.sra Written 1517961 spots for SRR28623309.sra Read 1517961 spots for SRR28623309.sra Written 1517961 spots for SRR28623309.sra Read 1517961 spots for SRR28623309.sra Written 1517961 spots for SRR28623309.sra Read 1517961 spots for SRR28623309.sra Written 1517961 spots for SRR28623309.sra Read 1517961 spots for SRR28623309.sra Written 1517961 spots for SRR28623309.sra Read 1517961 spots for SRR28623309.sra Written 1517961 spots for SRR28623309.sra Read 1517961 spots for SRR28623309.sra Written 1517961 spots for SRR28623309.sra SRR ids: ['SRR28623309.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_sfy0utxk SRR28623309.sra spots: 30359235 blocks: [[1, 1517961], [1517962, 3035922], [3035923, 4553883], [4553884, 6071844], [6071845, 7589805], [7589806, 9107766], [9107767, 10625727], [10625728, 12143688], [12143689, 13661649], [13661650, 15179610], [15179611, 16697571], [16697572, 18215532], [18215533, 19733493], [19733494, 21251454], [21251455, 22769415], [22769416, 24287376], [24287377, 25805337], [25805338, 27323298], [27323299, 28841259], [28841260, 30359235]] SRR28623309 file size 11209763 SRR28623309 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR28623309 SRR28623309_1.fastq SRR28623309_2.fastq Input file: SRR28623309_1.fastq Paired file: SRR28623309_2.fastq trimmed: SRR28623309-trimmed-pair1.fastq, SRR28623309-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 16:19:11 2025 >> started Tue Feb 11 16:19:47 2025 >> done (35.932s) 30359235 read pairs processed; of these: 28 ( 0.00%) short read pairs filtered out after trimming by size control 34432 ( 0.11%) empty read pairs filtered out after trimming by size control 30324775 (99.89%) read pairs available; of these: 5518244 (18.20%) trimmed read pairs available after processing 24806531 (81.80%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 3 0.00% 20 4 0.00% 21 7 0.00% 22 2 0.00% 23 3 0.00% 24 6 0.00% 25 7 0.00% 26 4 0.00% 27 2 0.00% 28 6 0.00% 29 17 0.00% 30 15 0.00% 31 14 0.00% 32 17 0.00% 33 18 0.00% 34 24 0.00% 35 11 0.00% 36 23 0.00% 37 30 0.00% 38 45 0.00% 39 43 0.00% 40 35 0.00% 41 41 0.00% 42 62 0.00% 43 71 0.00% 44 63 0.00% 45 88 0.00% 46 89 0.00% 47 115 0.00% 48 136 0.00% 49 165 0.00% 50 191 0.00% 51 247 0.00% 52 240 0.00% 53 253 0.00% 54 318 0.00% 55 364 0.00% 56 391 0.00% 57 426 0.00% 58 513 0.00% 59 658 0.00% 60 723 0.00% 61 844 0.00% 62 1015 0.00% 63 1217 0.00% 64 1332 0.00% 65 1404 0.00% 66 1576 0.01% 67 1792 0.01% 68 2068 0.01% 69 2321 0.01% 70 2804 0.01% 71 3179 0.01% 72 3949 0.01% 73 4392 0.01% 74 4950 0.02% 75 5592 0.02% 76 6064 0.02% 77 6766 0.02% 78 7516 0.02% 79 8264 0.03% 80 9707 0.03% 81 11085 0.04% 82 12385 0.04% 83 13804 0.05% 84 15784 0.05% 85 17142 0.06% 86 18289 0.06% 87 19853 0.07% 88 21534 0.07% 89 23375 0.08% 90 24919 0.08% 91 27167 0.09% 92 29798 0.10% 93 32895 0.11% 94 35306 0.12% 95 37599 0.12% 96 39176 0.13% 97 41255 0.14% 98 43243 0.14% 99 45717 0.15% 100 47909 0.16% 101 50094 0.17% 102 53122 0.18% 103 56360 0.19% 104 58981 0.19% 105 61510 0.20% 106 64029 0.21% 107 65151 0.21% 108 67128 0.22% 109 68452 0.23% 110 70491 0.23% 111 73222 0.24% 112 75771 0.25% 113 77530 0.26% 114 80600 0.27% 115 84248 0.28% 116 85804 0.28% 117 87232 0.29% 118 89148 0.29% 119 89562 0.30% 120 91897 0.30% 121 93055 0.31% 122 94676 0.31% 123 97784 0.32% 124 100577 0.33% 125 102345 0.34% 126 104710 0.35% 127 105627 0.35% 128 105305 0.35% 129 107290 0.35% 130 108203 0.36% 131 108509 0.36% 132 110890 0.37% 133 112623 0.37% 134 114193 0.38% 135 116185 0.38% 136 117188 0.39% 137 118246 0.39% 138 119487 0.39% 139 119517 0.39% 140 119112 0.39% 141 121120 0.40% 142 122135 0.40% 143 122547 0.40% 144 125498 0.41% 145 125049 0.41% 146 125621 0.41% 147 126704 0.42% 148 127984 0.42% 149 127374 0.42% 150 127879 0.42% 151 24806531 81.80% 30324775 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=16.39 fanout-score-rank=10 prefix-density=0.15 prefix-fanout=16.4 sequence=GGATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACTGACATCTCGTATGCCGTCTTCTGCTTGAA criterion=fanout-score sequence-density=0.07 sequence-density-rank=14 fanout-score=87.23 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=18.7 sequence=TCAGCAACAACAACAGGC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=2.48 fanout-score-rank=36 prefix-density=0.15 prefix-fanout=2.3 sequence=TGACATCGTTGA criterion=fanout-score sequence-density=0.05 sequence-density-rank=30 fanout-score=121.65 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=19.3 sequence=TGAGAAGAAGGAT SRR28623309 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 16:20:29 Started mapping on | Feb 11 16:20:30 Finished on | Feb 11 16:23:22 Mapping speed, Million of reads per hour | 634.70 Number of input reads | 30324775 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 28391946 Uniquely mapped reads % | 93.63% Average mapped length | 290.69 Number of splices: Total | 25044459 Number of splices: Annotated (sjdb) | 24472870 Number of splices: GT/AG | 24610422 Number of splices: GC/AG | 334622 Number of splices: AT/AC | 25592 Number of splices: Non-canonical | 73823 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.04% Deletion average length | 2.88 Insertion rate per base | 0.03% Insertion average length | 2.42 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 676605 % of reads mapped to multiple loci | 2.23% Number of reads mapped to too many loci | 183061 % of reads mapped to too many loci | 0.60% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.25% % of reads unmapped: other | 0.29% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1256224 1256224 1256224 N_multimapping 676605 676605 676605 N_noFeature 1256588 28022009 1425335 N_ambiguous 378157 2545 175169 UnstrandedReadsAssigned:26757201 PositiveStrandReadsAssigned:367392 NegativeStrandReadsAssigned:26791442 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR28623309 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR28623309-trimmed-pair1.fastq SRR28623309-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 30,324,775 reads, 27,198,651 reads pseudoaligned [quant] estimated average fragment length: 218.243 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,118 rounds 52401 SRR28623309.ke.tsv 34699 SRR28623309.se.tsv 87100 total ==> SRR28623309.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1800.76 1112 22.606 Potri.005G024800.1.v4.1 1035 817.757 1090 48.7951 Potri.004G059700.1.v4.1 961 743.757 64 3.15009 Potri.007G009000.2.v4.1 1416 1198.76 0 0 Potri.003G141000.2.v4.1 2943 2725.76 885.622 11.8942 Potri.016G087400.1.v4.1 270 96.4953 1778.25 674.622 Potri.015G069301.1.v4.1 564 350.321 0 0 Potri.010G195200.1.v4.1 1773 1555.76 104 2.44718 Potri.012G127500.1.v4.1 977 759.757 7177 345.814 ==> SRR28623309.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 814 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 620 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 10 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 17 SRR28623309 completed mapping pipeline successfully