Starting /dee2/code/volunteer_pipeline.sh SRR28623310 current disk space = 3088811339776 free memory = 1449701912 SRR28623310 SRAfilesize 2de49714076aa154ab3d8d6a82563c64 SRR28623310.sra SRR28623310.sra file validated SRR28623310 is paired end SRR28623310 is conventional basespace SRR28623310 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623310_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5115 37.0 37.0 37.0 37.0 37.0 2 36.514 37.0 37.0 37.0 37.0 37.0 3 36.675 37.0 37.0 37.0 37.0 37.0 4 36.7275 37.0 37.0 37.0 37.0 37.0 5 36.6025 37.0 37.0 37.0 37.0 37.0 6 36.6385 37.0 37.0 37.0 37.0 37.0 7 36.606 37.0 37.0 37.0 37.0 37.0 8 36.399 37.0 37.0 37.0 37.0 37.0 9 36.5465 37.0 37.0 37.0 37.0 37.0 10-14 36.6109 37.0 37.0 37.0 37.0 37.0 15-19 36.574799999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.5002 37.0 37.0 37.0 37.0 37.0 25-29 36.45 37.0 37.0 37.0 37.0 37.0 30-34 36.4494 37.0 37.0 37.0 37.0 37.0 35-39 36.4043 37.0 37.0 37.0 37.0 37.0 40-44 36.366499999999995 37.0 37.0 37.0 37.0 37.0 45-49 36.3251 37.0 37.0 37.0 37.0 37.0 50-54 36.2292 37.0 37.0 37.0 37.0 37.0 55-59 36.1794 37.0 37.0 37.0 37.0 37.0 60-64 36.212300000000006 37.0 37.0 37.0 37.0 37.0 65-69 36.1999 37.0 37.0 37.0 37.0 37.0 70-74 36.17 37.0 37.0 37.0 37.0 37.0 75-79 36.117599999999996 37.0 37.0 37.0 37.0 37.0 80-84 36.039100000000005 37.0 37.0 37.0 37.0 37.0 85-89 36.0946 37.0 37.0 37.0 37.0 37.0 90-94 35.927499999999995 37.0 37.0 37.0 37.0 37.0 95-99 35.8294 37.0 37.0 37.0 37.0 37.0 100-104 35.903299999999994 37.0 37.0 37.0 37.0 37.0 105-109 35.9419 37.0 37.0 37.0 37.0 37.0 110-114 35.742900000000006 37.0 37.0 37.0 37.0 37.0 115-119 35.7718 37.0 37.0 37.0 37.0 37.0 120-124 35.658699999999996 37.0 37.0 37.0 37.0 37.0 125-129 35.582800000000006 37.0 37.0 37.0 37.0 37.0 130-134 35.686699999999995 37.0 37.0 37.0 37.0 37.0 135-139 35.4774 37.0 37.0 37.0 37.0 37.0 140-144 35.2036 37.0 37.0 37.0 32.2 37.0 145-149 35.1366 37.0 37.0 37.0 27.4 37.0 150-151 34.797250000000005 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 1.0 21 1.0 22 1.0 23 3.0 24 6.0 25 3.0 26 7.0 27 16.0 28 14.0 29 22.0 30 34.0 31 46.0 32 66.0 33 88.0 34 178.0 35 409.0 36 2842.0 37 262.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.64626191670848 14.30005017561465 10.612142498745609 40.44154540893126 2 18.6 15.625 37.15 28.625 3 19.3 17.775 27.200000000000003 35.725 4 21.45 25.900000000000002 24.0 28.65 5 23.225 31.900000000000002 24.15 20.724999999999998 6 22.0 34.699999999999996 22.925 20.375 7 15.15 30.375000000000004 38.4 16.075 8 18.15 27.55 31.525 22.775000000000002 9 17.525 25.724999999999998 33.425 23.325000000000003 10-14 18.645 31.615 27.665 22.075 15-19 18.525 30.11 27.884999999999998 23.48 20-24 18.93 30.580000000000002 27.200000000000003 23.29 25-29 19.055 30.709999999999997 26.805 23.43 30-34 18.685 30.375000000000004 27.525 23.415 35-39 19.205 30.06 27.51 23.225 40-44 19.470000000000002 29.725 27.250000000000004 23.555 45-49 19.23 30.37 26.995 23.405 50-54 19.205 29.695 27.525 23.575 55-59 19.759999999999998 29.65 27.265 23.325000000000003 60-64 19.445 30.56 27.08 22.915 65-69 19.365 30.475 26.8 23.36 70-74 20.715 29.080000000000002 27.150000000000002 23.055 75-79 19.395 29.23 27.855 23.52 80-84 20.044999999999998 29.110000000000003 26.979999999999997 23.865 85-89 19.759999999999998 31.009999999999998 26.41 22.82 90-94 20.205000000000002 29.770000000000003 26.650000000000002 23.375 95-99 20.244999999999997 29.580000000000002 26.595000000000002 23.580000000000002 100-104 20.78 29.59 26.695 22.935 105-109 19.805 29.825000000000003 26.674999999999997 23.695 110-114 20.075000000000003 29.485 26.08 24.36 115-119 20.61 29.26 26.5 23.630000000000003 120-124 20.72 29.89 25.25 24.14 125-129 20.53 29.160000000000004 25.91 24.4 130-134 20.935000000000002 28.42 26.490000000000002 24.154999999999998 135-139 20.605 28.58 25.795 25.019999999999996 140-144 20.985 27.52 25.95 25.545 145-149 20.735 27.779999999999998 25.979999999999997 25.505 150-151 21.725 27.800000000000004 25.3 25.174999999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.5 15 1.0 16 0.5 17 0.0 18 1.0 19 1.5 20 1.0 21 2.0 22 2.0 23 1.0 24 2.0 25 6.5 26 10.0 27 11.5 28 18.5 29 26.0 30 28.0 31 47.0 32 67.5 33 85.5 34 94.0 35 111.0 36 129.0 37 130.5 38 156.0 39 194.5 40 204.0 41 194.0 42 219.5 43 248.0 44 222.0 45 199.0 46 223.0 47 225.0 48 190.5 49 162.5 50 140.0 51 123.0 52 116.5 53 94.0 54 72.5 55 50.0 56 31.0 57 31.5 58 23.0 59 12.5 60 11.5 61 8.5 62 7.0 63 12.0 64 9.5 65 6.0 66 8.5 67 6.5 68 5.0 69 5.0 70 2.5 71 1.5 72 1.0 73 0.0 74 0.0 75 2.0 76 2.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.35000000000000003 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 82.65 #Duplication Level Percentage of deduplicated Percentage of total 1 83.09134906231095 68.675 2 13.853599516031458 22.900000000000002 3 2.3290986085904417 5.775 4 0.48396854204476714 1.6 5 0.21173623714458562 0.8750000000000001 6 0.0 0.0 7 0.030248033877797946 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGTCTCCTTATCTCGTAT 7 0.17500000000000002 TruSeq Adapter, Index 21 (97% over 38bp) CTCCAGTCCTGACTTCATCAATAACAGTGGGCTCAAGATCAACAAAGATA 5 0.125 No Hit CTGTGTCACGGGCATTCAATGTTTGGATAAATAGCACTGGCATCGTAATT 5 0.125 No Hit CTGCAAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGCGGC 5 0.125 No Hit CTGTAATGGTTTGCAGACAACAATTAAACCAAAATAGGACGCGCAAATCC 5 0.125 No Hit CGCACGGATGTTTGGTTAAAGAACAGTCGCAGTTTTCCTCAAATCCCGCC 5 0.125 No Hit CCAACACCACTACCATTTTCTCAACACGTTGAAAGCAAAAGTGCGATTTC 5 0.125 No Hit CTTAGTTCTTGCGGAATTCAATGACATGTGTGTTGAATGCACAGCACATT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.16249999999999998 0.0 0.0 0.0 0.0 76-77 0.225 0.0 0.0 0.0 0.0 78-79 0.2375 0.0 0.0 0.0 0.0 80-81 0.3375 0.0 0.0 0.0 0.0 82-83 0.47500000000000003 0.0 0.0 0.0 0.0 84-85 0.7875 0.0 0.0 0.0 0.0 86-87 0.95 0.0 0.0 0.0 0.0 88-89 1.1375 0.0 0.0 0.0 0.0 90-91 1.4249999999999998 0.0 0.0 0.0 0.0 92-93 1.8125 0.0 0.0 0.0 0.0 94-95 2.0875 0.0 0.0 0.0 0.0 96-97 2.425 0.0 0.0 0.0 0.0 98-99 2.8125 0.0 0.0 0.0 0.0 100-101 3.0999999999999996 0.0 0.0 0.0 0.0 102-103 3.5125 0.0 0.0 0.0 0.0 104-105 3.8875 0.0 0.0 0.0 0.0 106-107 4.6375 0.0 0.0 0.0 0.0 108-109 5.1625 0.0 0.0 0.0 0.0 110-111 5.800000000000001 0.0 0.0 0.0 0.0 112-113 6.525 0.0 0.0 0.0 0.0 114-115 7.4375 0.0 0.0 0.0 0.0 116-117 8.45 0.0 0.0 0.0 0.0 118-119 9.162500000000001 0.0 0.0 0.0 0.0 120-121 9.875 0.0 0.0 0.0 0.0 122-123 10.7625 0.0 0.0 0.0 0.0 124-125 11.7125 0.0 0.0 0.0 0.0 126-127 12.912500000000001 0.0 0.0 0.0 0.0 128-129 13.6125 0.0 0.0 0.0 0.0 130-131 14.2875 0.0 0.0 0.0 0.0 132-133 15.0625 0.0 0.0 0.0 0.0 134-135 16.049999999999997 0.0 0.0 0.0 0.0 136-137 17.0625 0.0125 0.0 0.0 0.0 138-139 18.3125 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCTGCG 10 0.006830828 145.0 145 GGGCACA 10 0.006830828 145.0 7 AAATTTG 10 0.006830828 145.0 5 TGGGCAC 10 0.006830828 145.0 6 >>END_MODULE SRR28623310 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623310_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.9725 37.0 37.0 37.0 37.0 37.0 2 36.2625 37.0 37.0 37.0 37.0 37.0 3 36.331 37.0 37.0 37.0 37.0 37.0 4 36.264 37.0 37.0 37.0 37.0 37.0 5 36.352 37.0 37.0 37.0 37.0 37.0 6 36.2485 37.0 37.0 37.0 37.0 37.0 7 36.258 37.0 37.0 37.0 37.0 37.0 8 36.265 37.0 37.0 37.0 37.0 37.0 9 36.2655 37.0 37.0 37.0 37.0 37.0 10-14 36.1474 37.0 37.0 37.0 37.0 37.0 15-19 36.150400000000005 37.0 37.0 37.0 37.0 37.0 20-24 36.0991 37.0 37.0 37.0 37.0 37.0 25-29 36.043400000000005 37.0 37.0 37.0 37.0 37.0 30-34 35.9563 37.0 37.0 37.0 37.0 37.0 35-39 36.0053 37.0 37.0 37.0 37.0 37.0 40-44 35.9072 37.0 37.0 37.0 37.0 37.0 45-49 35.889300000000006 37.0 37.0 37.0 37.0 37.0 50-54 35.8812 37.0 37.0 37.0 37.0 37.0 55-59 35.765499999999996 37.0 37.0 37.0 37.0 37.0 60-64 35.8023 37.0 37.0 37.0 37.0 37.0 65-69 35.7852 37.0 37.0 37.0 37.0 37.0 70-74 35.8309 37.0 37.0 37.0 37.0 37.0 75-79 35.76559999999999 37.0 37.0 37.0 37.0 37.0 80-84 35.6731 37.0 37.0 37.0 37.0 37.0 85-89 35.6329 37.0 37.0 37.0 37.0 37.0 90-94 35.5661 37.0 37.0 37.0 37.0 37.0 95-99 35.622 37.0 37.0 37.0 37.0 37.0 100-104 35.5073 37.0 37.0 37.0 37.0 37.0 105-109 35.4471 37.0 37.0 37.0 37.0 37.0 110-114 35.4733 37.0 37.0 37.0 37.0 37.0 115-119 35.4979 37.0 37.0 37.0 37.0 37.0 120-124 35.44 37.0 37.0 37.0 34.6 37.0 125-129 34.9768 37.0 37.0 37.0 32.2 37.0 130-134 35.306700000000006 37.0 37.0 37.0 34.6 37.0 135-139 35.0829 37.0 37.0 37.0 29.8 37.0 140-144 35.1136 37.0 37.0 37.0 25.0 37.0 145-149 35.0006 37.0 37.0 37.0 25.0 37.0 150-151 34.80925 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 4.0 14 3.0 15 2.0 16 6.0 17 4.0 18 5.0 19 7.0 20 4.0 21 6.0 22 8.0 23 10.0 24 12.0 25 10.0 26 12.0 27 19.0 28 13.0 29 22.0 30 20.0 31 46.0 32 67.0 33 97.0 34 204.0 35 561.0 36 2575.0 37 283.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.9 20.025000000000002 16.025 25.05 2 29.625 22.475 30.55 17.349999999999998 3 22.650000000000002 27.925 30.099999999999998 19.325 4 25.8 30.2 25.474999999999998 18.525 5 27.175 33.324999999999996 22.525000000000002 16.975 6 21.4 37.724999999999994 22.900000000000002 17.974999999999998 7 21.375 22.175 38.15 18.3 8 23.525 24.275 28.599999999999998 23.599999999999998 9 22.325 26.375 30.7 20.599999999999998 10-14 24.935 27.689999999999998 27.12 20.255000000000003 15-19 24.58 27.505000000000003 27.794999999999998 20.119999999999997 20-24 24.990000000000002 26.88 28.16 19.97 25-29 24.865000000000002 27.900000000000002 27.084999999999997 20.150000000000002 30-34 24.474999999999998 28.08 27.325 20.119999999999997 35-39 24.27 27.894999999999996 27.58 20.255000000000003 40-44 24.474999999999998 27.33 28.294999999999998 19.900000000000002 45-49 24.455 27.495000000000005 28.52 19.53 50-54 24.125 28.165000000000003 28.215 19.495 55-59 24.085 26.765 29.315 19.835 60-64 23.145 28.28 28.610000000000003 19.965 65-69 23.465 27.584999999999997 29.099999999999998 19.85 70-74 24.07 27.375 28.835 19.72 75-79 23.205000000000002 28.075 28.43 20.29 80-84 24.27 28.060000000000002 27.975 19.695 85-89 23.755000000000003 27.97 28.655 19.62 90-94 23.97 28.194999999999997 29.25 18.584999999999997 95-99 24.44 27.474999999999998 28.860000000000003 19.225 100-104 25.11 28.34 28.025 18.525 105-109 24.41 28.689999999999998 27.694999999999997 19.205 110-114 24.995 28.78 27.205000000000002 19.02 115-119 26.369999999999997 28.48 26.945000000000004 18.205 120-124 25.905 28.199999999999996 27.779999999999998 18.115000000000002 125-129 25.88 27.445000000000004 27.73 18.945 130-134 26.41 27.765 27.105 18.72 135-139 26.865 27.775 27.55 17.810000000000002 140-144 27.045 27.525 26.75 18.68 145-149 27.13 27.169999999999998 27.57 18.13 150-151 27.8625 25.900000000000002 27.6625 18.575 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.5 3 1.0 4 0.5 5 0.0 6 0.5 7 0.5 8 1.0 9 1.0 10 1.0 11 3.0 12 2.0 13 0.5 14 2.0 15 2.0 16 0.5 17 1.0 18 1.5 19 2.0 20 2.0 21 3.0 22 4.0 23 4.5 24 5.0 25 3.0 26 5.5 27 9.0 28 9.0 29 11.0 30 20.0 31 27.5 32 43.0 33 57.5 34 61.5 35 81.5 36 95.0 37 129.5 38 164.0 39 167.5 40 191.0 41 204.5 42 218.5 43 231.0 44 247.5 45 256.5 46 235.5 47 214.5 48 208.5 49 187.5 50 150.5 51 134.0 52 122.0 53 103.0 54 85.5 55 66.5 56 35.5 57 25.5 58 25.5 59 18.0 60 14.0 61 11.0 62 11.5 63 11.5 64 7.0 65 5.5 66 6.0 67 4.0 68 2.5 69 5.0 70 4.5 71 1.5 72 1.5 73 2.0 74 1.5 75 1.5 76 2.0 77 1.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.5 83 1.0 84 1.0 85 1.0 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.5 92 0.5 93 1.5 94 2.0 95 0.5 96 0.0 97 0.0 98 0.0 99 0.5 100 6.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 82.92500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 83.59963822731383 69.325 2 13.566475731082303 22.5 3 2.1103406692794695 5.25 4 0.482363581549593 1.6 5 0.1507386192342478 0.625 6 0.06029544769369913 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.030147723846849564 0.4 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 16 0.4 No Hit GCATTTCGATTCACATTGGTCAAGCCGGTATTCAGGTCGGCAATGCTTGC 6 0.15 No Hit ATTTGCTTGCGTTGGTTACCACAGTTTTCAAGAGTTACATCTAAAGCAGC 6 0.15 No Hit GGAGTCTGACATGTGTGCGAGTCAACGGGCGAGTAAACCCGTAAGGCGCA 5 0.125 No Hit AGAATTCCTACCTTTCCAAAATAAGCCGTCCACTGAAGGCAAGGGGAAGA 5 0.125 No Hit GATAAGTGAATTGAAAATGTCTGTGAACACACGAGGGAGGCTGGTTGCTA 5 0.125 No Hit CAAAGAAGGTGCTACCGATCCAACATTCTTGTACTTTGCCCCTTCTTTGA 5 0.125 No Hit TTAAGAGCCTCCGCCCGTCTCTGGGACTATGGACGGGCACGCTCATATCA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.16249999999999998 0.0 0.0 0.0 0.0 76-77 0.225 0.0 0.0 0.0 0.0 78-79 0.2375 0.0 0.0 0.0 0.0 80-81 0.3375 0.0 0.0 0.0 0.0 82-83 0.47500000000000003 0.0 0.0 0.0 0.0 84-85 0.7625 0.0 0.0 0.0 0.0 86-87 0.925 0.0 0.0 0.0 0.0 88-89 1.1125 0.0 0.0 0.0 0.0 90-91 1.4 0.0 0.0 0.0 0.0 92-93 1.8125 0.0 0.0 0.0 0.0 94-95 2.0875 0.0 0.0 0.0 0.0 96-97 2.4375 0.0 0.0 0.0 0.0 98-99 2.8125 0.0 0.0 0.0 0.0 100-101 3.125 0.0 0.0 0.0 0.0 102-103 3.5374999999999996 0.0 0.0 0.0 0.0 104-105 3.9125 0.0 0.0 0.0 0.0 106-107 4.7125 0.0 0.0 0.0 0.0 108-109 5.2125 0.0 0.0 0.0 0.0 110-111 5.85 0.0 0.0 0.0 0.0 112-113 6.5375 0.0 0.0 0.0 0.0 114-115 7.425 0.0 0.0 0.0 0.0 116-117 8.45 0.0 0.0 0.0 0.0 118-119 9.175 0.0 0.0 0.0 0.0 120-121 9.875 0.0 0.0 0.0 0.0 122-123 10.7625 0.0 0.0 0.0 0.0 124-125 11.6875 0.0 0.0 0.0 0.0 126-127 12.8875 0.0 0.0 0.0 0.0 128-129 13.5625 0.0 0.0 0.0 0.0 130-131 14.2375 0.0 0.0 0.0 0.0 132-133 15.024999999999999 0.0 0.0 0.0 0.0 134-135 16.025 0.0 0.0 0.0 0.0 136-137 16.9875 0.0 0.0 0.0 0.0 138-139 18.2375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAGTTCA 10 0.006830828 145.0 5 TGACTAT 10 0.006830828 145.0 4 TTGACTA 10 0.006830828 145.0 3 TGAGGCC 10 0.006830828 145.0 145 CTATGGC 10 0.006830828 145.0 7 ATCAAAA 10 0.006830828 145.0 6 GACTATG 10 0.006830828 145.0 5 >>END_MODULE Read 1745456 spots for SRR28623310.sra Written 1745456 spots for SRR28623310.sra Read 1745456 spots for SRR28623310.sra Written 1745456 spots for SRR28623310.sra Read 1745456 spots for SRR28623310.sra Written 1745456 spots for SRR28623310.sra Read 1745456 spots for SRR28623310.sra Written 1745456 spots for SRR28623310.sra Read 1745456 spots for SRR28623310.sra Written 1745456 spots for SRR28623310.sra Read 1745456 spots for SRR28623310.sra Written 1745456 spots for SRR28623310.sra Read 1745456 spots for SRR28623310.sra Written 1745456 spots for SRR28623310.sra Read 1745456 spots for SRR28623310.sra Written 1745456 spots for SRR28623310.sra Read 1745456 spots for SRR28623310.sra Written 1745456 spots for SRR28623310.sra Read 1745456 spots for SRR28623310.sra Written 1745456 spots for SRR28623310.sra Read 1745456 spots for SRR28623310.sra Written 1745456 spots for SRR28623310.sra Read 1745456 spots for SRR28623310.sra Written 1745456 spots for SRR28623310.sra Read 1745456 spots for SRR28623310.sra Written 1745456 spots for SRR28623310.sra Read 1745456 spots for SRR28623310.sra Written 1745456 spots for SRR28623310.sra Read 1745456 spots for SRR28623310.sra Written 1745456 spots for SRR28623310.sra Read 1745456 spots for SRR28623310.sra Written 1745456 spots for SRR28623310.sra Read 1745470 spots for SRR28623310.sra Written 1745470 spots for SRR28623310.sra Read 1745456 spots for SRR28623310.sra Written 1745456 spots for SRR28623310.sra Read 1745456 spots for SRR28623310.sra Written 1745456 spots for SRR28623310.sra Read 1745456 spots for SRR28623310.sra Written 1745456 spots for SRR28623310.sra SRR ids: ['SRR28623310.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_sl5gwlhe SRR28623310.sra spots: 34909134 blocks: [[1, 1745456], [1745457, 3490912], [3490913, 5236368], [5236369, 6981824], [6981825, 8727280], [8727281, 10472736], [10472737, 12218192], [12218193, 13963648], [13963649, 15709104], [15709105, 17454560], [17454561, 19200016], [19200017, 20945472], [20945473, 22690928], [22690929, 24436384], [24436385, 26181840], [26181841, 27927296], [27927297, 29672752], [29672753, 31418208], [31418209, 33163664], [33163665, 34909134]] SRR28623310 file size 12891390 SRR28623310 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR28623310 SRR28623310_1.fastq SRR28623310_2.fastq Input file: SRR28623310_1.fastq Paired file: SRR28623310_2.fastq trimmed: SRR28623310-trimmed-pair1.fastq, SRR28623310-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 16:21:56 2025 >> started Thu Feb 13 16:22:35 2025 >> done (38.804s) 34909134 read pairs processed; of these: 25 ( 0.00%) short read pairs filtered out after trimming by size control 81377 ( 0.23%) empty read pairs filtered out after trimming by size control 34827732 (99.77%) read pairs available; of these: 7909440 (22.71%) trimmed read pairs available after processing 26918292 (77.29%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 2 0.00% 20 3 0.00% 21 4 0.00% 22 6 0.00% 23 4 0.00% 24 1 0.00% 25 9 0.00% 26 4 0.00% 27 7 0.00% 28 15 0.00% 29 11 0.00% 30 16 0.00% 31 15 0.00% 32 12 0.00% 33 13 0.00% 34 21 0.00% 35 17 0.00% 36 29 0.00% 37 21 0.00% 38 35 0.00% 39 50 0.00% 40 58 0.00% 41 51 0.00% 42 77 0.00% 43 81 0.00% 44 80 0.00% 45 101 0.00% 46 123 0.00% 47 114 0.00% 48 150 0.00% 49 219 0.00% 50 221 0.00% 51 279 0.00% 52 331 0.00% 53 391 0.00% 54 391 0.00% 55 474 0.00% 56 564 0.00% 57 610 0.00% 58 736 0.00% 59 970 0.00% 60 1069 0.00% 61 1197 0.00% 62 1615 0.00% 63 1772 0.01% 64 1913 0.01% 65 2168 0.01% 66 2624 0.01% 67 2872 0.01% 68 3247 0.01% 69 3899 0.01% 70 4377 0.01% 71 5110 0.01% 72 5999 0.02% 73 7034 0.02% 74 8097 0.02% 75 8975 0.03% 76 10090 0.03% 77 11000 0.03% 78 12491 0.04% 79 13890 0.04% 80 15655 0.04% 81 17598 0.05% 82 20087 0.06% 83 22248 0.06% 84 25670 0.07% 85 27753 0.08% 86 30938 0.09% 87 32886 0.09% 88 34902 0.10% 89 37340 0.11% 90 40151 0.12% 91 43785 0.13% 92 47364 0.14% 93 51695 0.15% 94 55762 0.16% 95 59766 0.17% 96 64736 0.19% 97 67199 0.19% 98 69707 0.20% 99 72440 0.21% 100 75348 0.22% 101 77535 0.22% 102 82681 0.24% 103 86211 0.25% 104 90629 0.26% 105 96074 0.28% 106 99707 0.29% 107 102096 0.29% 108 103733 0.30% 109 105681 0.30% 110 107540 0.31% 111 109258 0.31% 112 112796 0.32% 113 116538 0.33% 114 120356 0.35% 115 125225 0.36% 116 127303 0.37% 117 129998 0.37% 118 131847 0.38% 119 132803 0.38% 120 134532 0.39% 121 135324 0.39% 122 137492 0.39% 123 138448 0.40% 124 141328 0.41% 125 143842 0.41% 126 147474 0.42% 127 150390 0.43% 128 151555 0.44% 129 151874 0.44% 130 151943 0.44% 131 152024 0.44% 132 153308 0.44% 133 154699 0.44% 134 154924 0.44% 135 157200 0.45% 136 159091 0.46% 137 160141 0.46% 138 162780 0.47% 139 164114 0.47% 140 164065 0.47% 141 163137 0.47% 142 164855 0.47% 143 163900 0.47% 144 164533 0.47% 145 165516 0.48% 146 165084 0.47% 147 166020 0.48% 148 167417 0.48% 149 168254 0.48% 150 167378 0.48% 151 26918292 77.29% 34827732 reads passed initial QC criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=2.62 fanout-score-rank=26 prefix-density=0.34 prefix-fanout=2.3 sequence=GGCTTCTCCCATTTGAGGGGCTTGACAAC criterion=fanout-score sequence-density=0.03 sequence-density-rank=30 fanout-score=255.22 fanout-score-rank=1 prefix-density=0.37 prefix-fanout=22.3 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTTGTCCCAGTAACTGGGATCAGCCTTGCACTTCTCAAAGAAGTCAACAAGGAGTTCAGCAGCCTGTACTCCATGGTAAGGATCAATATGGAATCCGGATTTTCCATGCACAATGATCTCAGCA criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=3.13 fanout-score-rank=21 prefix-density=0.30 prefix-fanout=2.6 sequence=GTTGTCAAGCCCCTCAAATGGGAGAAGCC criterion=fanout-score sequence-density=0.08 sequence-density-rank=21 fanout-score=28.26 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=8.4 sequence=TGCTGAGATCATTGTGCATGGAAAATCCGGATTCCATATTGATCCTTACCATGGAGTACAGGCTGCTGAACTCCTTGTTGACTTCTTTGAGAAGTGCAAGGCTGATCCCAGTTACTGGGACAAAATCTCCCAGGGAGGCCTGCAGCGAATCCAAGAGAAGTATACCTGGAAAATTTACTCTCAAAGGCTCCTGACTCTCACAGGAGTTTATGGCTTCTGGAAGCATGTTTCCAACCTTGATCATCGTGAGAGCCGTCGCTATCTGGAAATGTTCTATGCACTCAAATATCGCAAATTGGCTGATTCTGTTCCTTTGACTATCGAGTAAATGGAGCTGGAGAAATCAAGGAAACATGGGTTGGTTTGAGTCGGGTTCCGGGTCCAGAATAATGGTGTCATTTCACGATAGTGATTGGACAAGAAAGGCTTTGATCTTCTTT SRR28623310 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 16:23:42 Started mapping on | Feb 13 16:23:42 Finished on | Feb 13 16:29:57 Mapping speed, Million of reads per hour | 334.35 Number of input reads | 34827732 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 30447654 Uniquely mapped reads % | 87.42% Average mapped length | 287.57 Number of splices: Total | 20459217 Number of splices: Annotated (sjdb) | 19936594 Number of splices: GT/AG | 20113244 Number of splices: GC/AG | 247208 Number of splices: AT/AC | 22140 Number of splices: Non-canonical | 76625 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.04% Deletion average length | 2.84 Insertion rate per base | 0.03% Insertion average length | 2.17 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 659548 % of reads mapped to multiple loci | 1.89% Number of reads mapped to too many loci | 927266 % of reads mapped to too many loci | 2.66% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.42% % of reads unmapped: other | 0.60% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3720530 3720530 3720530 N_multimapping 659548 659548 659548 N_noFeature 1246895 29910183 1457138 N_ambiguous 454286 3603 124349 UnstrandedReadsAssigned:28746473 PositiveStrandReadsAssigned:533868 NegativeStrandReadsAssigned:28866167 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=144 echo kmer=139 SRR28623310 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR28623310-trimmed-pair1.fastq SRR28623310-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 34,827,732 reads, 30,087,300 reads pseudoaligned [quant] estimated average fragment length: 204.591 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,217 rounds 52401 SRR28623310.ke.tsv 34699 SRR28623310.se.tsv 87100 total ==> SRR28623310.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1814.41 942 18.7044 Potri.005G024800.1.v4.1 1035 831.409 163 7.06318 Potri.004G059700.1.v4.1 961 757.418 24 1.14157 Potri.007G009000.2.v4.1 1416 1212.41 0 0 Potri.003G141000.2.v4.1 2943 2739.41 337.522 4.43887 Potri.016G087400.1.v4.1 270 101.7 2582.16 914.719 Potri.015G069301.1.v4.1 564 363.611 0 0 Potri.010G195200.1.v4.1 1773 1569.41 68 1.56099 Potri.012G127500.1.v4.1 977 773.418 4838 225.361 ==> SRR28623310.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 3705 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 730 Potri.001G212900.v4.1 6 Potri.001G182400.v4.1 13 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 12 SRR28623310 completed mapping pipeline successfully