Starting /dee2/code/volunteer_pipeline.sh SRR28623311 current disk space = 3048591462400 free memory = 1137580028 SRR28623311 SRAfilesize dba51bfa406e612b39e557c376dea537 SRR28623311.sra SRR28623311.sra file validated SRR28623311 is paired end SRR28623311 is conventional basespace SRR28623311 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623311_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.37225 37.0 37.0 37.0 37.0 37.0 2 36.4605 37.0 37.0 37.0 37.0 37.0 3 36.512 37.0 37.0 37.0 37.0 37.0 4 36.607 37.0 37.0 37.0 37.0 37.0 5 36.6145 37.0 37.0 37.0 37.0 37.0 6 36.584 37.0 37.0 37.0 37.0 37.0 7 36.597 37.0 37.0 37.0 37.0 37.0 8 36.3505 37.0 37.0 37.0 37.0 37.0 9 36.4795 37.0 37.0 37.0 37.0 37.0 10-14 36.5679 37.0 37.0 37.0 37.0 37.0 15-19 36.525400000000005 37.0 37.0 37.0 37.0 37.0 20-24 36.5536 37.0 37.0 37.0 37.0 37.0 25-29 36.4464 37.0 37.0 37.0 37.0 37.0 30-34 36.4302 37.0 37.0 37.0 37.0 37.0 35-39 36.4003 37.0 37.0 37.0 37.0 37.0 40-44 36.3439 37.0 37.0 37.0 37.0 37.0 45-49 36.3361 37.0 37.0 37.0 37.0 37.0 50-54 36.2657 37.0 37.0 37.0 37.0 37.0 55-59 36.271 37.0 37.0 37.0 37.0 37.0 60-64 36.2582 37.0 37.0 37.0 37.0 37.0 65-69 36.1996 37.0 37.0 37.0 37.0 37.0 70-74 36.228 37.0 37.0 37.0 37.0 37.0 75-79 36.129599999999996 37.0 37.0 37.0 37.0 37.0 80-84 36.053200000000004 37.0 37.0 37.0 37.0 37.0 85-89 36.0843 37.0 37.0 37.0 37.0 37.0 90-94 36.049800000000005 37.0 37.0 37.0 37.0 37.0 95-99 35.9396 37.0 37.0 37.0 37.0 37.0 100-104 35.9975 37.0 37.0 37.0 37.0 37.0 105-109 35.964800000000004 37.0 37.0 37.0 37.0 37.0 110-114 35.85699999999999 37.0 37.0 37.0 37.0 37.0 115-119 35.868900000000004 37.0 37.0 37.0 37.0 37.0 120-124 35.7691 37.0 37.0 37.0 37.0 37.0 125-129 35.658500000000004 37.0 37.0 37.0 37.0 37.0 130-134 35.798199999999994 37.0 37.0 37.0 37.0 37.0 135-139 35.6388 37.0 37.0 37.0 37.0 37.0 140-144 35.3327 37.0 37.0 37.0 34.6 37.0 145-149 35.3457 37.0 37.0 37.0 34.6 37.0 150-151 35.2325 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 0.0 21 3.0 22 2.0 23 3.0 24 3.0 25 3.0 26 12.0 27 5.0 28 13.0 29 27.0 30 31.0 31 43.0 32 57.0 33 92.0 34 141.0 35 378.0 36 2927.0 37 259.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.26787057938299 12.54075746175069 9.330323551542513 41.8610484073238 2 18.325 14.899999999999999 37.325 29.45 3 18.224999999999998 17.549999999999997 29.549999999999997 34.675 4 22.650000000000002 25.624999999999996 24.099999999999998 27.625 5 24.3 31.874999999999996 23.400000000000002 20.424999999999997 6 22.525000000000002 34.599999999999994 23.325000000000003 19.55 7 15.875 29.125 39.225 15.775 8 17.05 28.000000000000004 32.574999999999996 22.375 9 17.925 24.55 34.025 23.5 10-14 19.13 30.61 27.57 22.689999999999998 15-19 19.115 29.459999999999997 27.66 23.765 20-24 19.8 28.825 27.425 23.95 25-29 19.765 29.215000000000003 27.235 23.785 30-34 19.67 29.025000000000002 27.82 23.485 35-39 19.59 29.375 27.21 23.825 40-44 20.225 29.304999999999996 26.52 23.95 45-49 20.22 29.049999999999997 26.979999999999997 23.75 50-54 19.705000000000002 28.715000000000003 28.21 23.369999999999997 55-59 20.45 29.060000000000002 27.275 23.215 60-64 19.945 28.555000000000003 27.095000000000002 24.404999999999998 65-69 20.24 28.96 27.43 23.369999999999997 70-74 20.549999999999997 29.145 26.625 23.68 75-79 20.03 28.860000000000003 27.075 24.035 80-84 20.485 28.605000000000004 27.584999999999997 23.325000000000003 85-89 20.035 28.49 27.68 23.794999999999998 90-94 20.57 28.785 27.025 23.62 95-99 20.86 28.720000000000002 27.115000000000002 23.305 100-104 20.925 28.29 26.729999999999997 24.055 105-109 20.669999999999998 28.155 27.18 23.995 110-114 21.09 28.105000000000004 27.055 23.75 115-119 21.035 29.25 26.419999999999998 23.294999999999998 120-124 21.075 28.925 26.08 23.919999999999998 125-129 21.490000000000002 27.955000000000002 26.26 24.295 130-134 21.23 28.15 26.334999999999997 24.285 135-139 22.195 28.415000000000003 25.885 23.505000000000003 140-144 21.46 28.139999999999997 26.02 24.38 145-149 21.82 27.98 26.055 24.145 150-151 22.8875 27.5625 26.275 23.275000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.0 21 0.5 22 2.0 23 2.0 24 5.0 25 6.5 26 4.0 27 4.0 28 11.5 29 13.0 30 13.5 31 28.0 32 41.5 33 59.5 34 77.5 35 86.0 36 97.5 37 103.0 38 137.0 39 171.5 40 186.0 41 214.5 42 221.5 43 242.0 44 256.5 45 249.0 46 260.5 47 240.5 48 207.0 49 200.0 50 182.0 51 141.5 52 110.0 53 103.0 54 86.5 55 55.0 56 37.5 57 33.5 58 24.0 59 16.0 60 19.0 61 16.5 62 7.0 63 3.5 64 7.5 65 6.0 66 1.0 67 0.5 68 0.0 69 2.0 70 2.0 71 0.0 72 0.0 73 0.5 74 1.0 75 0.5 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.325 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.475 #Duplication Level Percentage of deduplicated Percentage of total 1 84.0670859538784 70.175 2 12.96795447738844 21.65 3 2.3060796645702304 5.775 4 0.5390835579514826 1.7999999999999998 5 0.05989817310572028 0.25 6 0.02994908655286014 0.15 7 0.0 0.0 8 0.02994908655286014 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCTTCCTCTATCTGGTCATCATCAAGGAAGCTAGCATCAGACTGATCCAC 8 0.2 No Hit CCGAGTTCTTGAATCCTCCCGCGTACAACTTCGAAGCTGCCATAACGGAC 6 0.15 No Hit CTGGAGGGCTGAGTTCTCCACTACAGAAATATACTGCCTGTGTCATACAT 5 0.125 No Hit CCTAATTCTGTCATCAAAACAAGAATTGTCCCTGCAACATAAGCTGCCCA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.0625 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.1625 0.0 0.0 0.0 0.0 76-77 0.25 0.0 0.0 0.0 0.0 78-79 0.2875 0.0 0.0 0.0 0.0 80-81 0.3625 0.0 0.0 0.0 0.0 82-83 0.4 0.0 0.0 0.0 0.0 84-85 0.4125 0.0 0.0 0.0 0.0 86-87 0.425 0.0 0.0 0.0 0.0 88-89 0.6125 0.0 0.0 0.0 0.0 90-91 0.8 0.0 0.0 0.0 0.0 92-93 0.9375 0.0 0.0 0.0 0.0 94-95 1.1 0.0 0.0 0.0 0.0 96-97 1.5375 0.0 0.0 0.0 0.0 98-99 1.775 0.0 0.0 0.0 0.0 100-101 2.075 0.0 0.0 0.0 0.0 102-103 2.3875 0.0 0.0 0.0 0.0 104-105 2.6125 0.0 0.0 0.0 0.0 106-107 3.0 0.0 0.0 0.0 0.0 108-109 3.5125 0.0 0.0 0.0 0.0 110-111 4.0625 0.0 0.0 0.0 0.0 112-113 4.6125 0.0 0.0 0.0 0.0 114-115 5.1625 0.0 0.0 0.0 0.0 116-117 5.8125 0.0 0.0 0.0 0.0 118-119 6.487500000000001 0.0 0.0 0.0 0.0 120-121 7.075 0.0 0.0 0.0 0.0 122-123 7.675 0.0 0.0 0.0 0.0 124-125 8.6 0.0 0.0 0.0 0.0 126-127 9.3625 0.0 0.0 0.0 0.0 128-129 10.2125 0.0 0.0 0.0 0.0 130-131 11.2625 0.0 0.0 0.0 0.0 132-133 11.9125 0.0 0.0 0.0 0.0 134-135 12.7 0.0 0.0 0.0 0.0 136-137 13.5125 0.0 0.0 0.0 0.0 138-139 14.3375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCCACCT 10 0.006830828 145.0 1 TTAATCT 10 0.006830828 145.0 5 ATTTCTG 20 0.00593511 29.0 55-59 GGGGGGG 35 0.0035366106 20.714287 140-144 >>END_MODULE SRR28623311 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623311_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.924 37.0 37.0 37.0 37.0 37.0 2 36.36 37.0 37.0 37.0 37.0 37.0 3 36.28 37.0 37.0 37.0 37.0 37.0 4 36.185 37.0 37.0 37.0 37.0 37.0 5 36.4655 37.0 37.0 37.0 37.0 37.0 6 36.287 37.0 37.0 37.0 37.0 37.0 7 36.2675 37.0 37.0 37.0 37.0 37.0 8 36.271 37.0 37.0 37.0 37.0 37.0 9 36.2065 37.0 37.0 37.0 37.0 37.0 10-14 36.2346 37.0 37.0 37.0 37.0 37.0 15-19 36.184999999999995 37.0 37.0 37.0 37.0 37.0 20-24 36.1788 37.0 37.0 37.0 37.0 37.0 25-29 36.145 37.0 37.0 37.0 37.0 37.0 30-34 36.007600000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.075300000000006 37.0 37.0 37.0 37.0 37.0 40-44 35.9903 37.0 37.0 37.0 37.0 37.0 45-49 36.0588 37.0 37.0 37.0 37.0 37.0 50-54 35.9821 37.0 37.0 37.0 37.0 37.0 55-59 35.8953 37.0 37.0 37.0 37.0 37.0 60-64 35.897499999999994 37.0 37.0 37.0 37.0 37.0 65-69 35.8831 37.0 37.0 37.0 37.0 37.0 70-74 35.9054 37.0 37.0 37.0 37.0 37.0 75-79 35.921 37.0 37.0 37.0 37.0 37.0 80-84 35.8259 37.0 37.0 37.0 37.0 37.0 85-89 35.7489 37.0 37.0 37.0 37.0 37.0 90-94 35.74210000000001 37.0 37.0 37.0 37.0 37.0 95-99 35.7235 37.0 37.0 37.0 37.0 37.0 100-104 35.590799999999994 37.0 37.0 37.0 37.0 37.0 105-109 35.55579999999999 37.0 37.0 37.0 37.0 37.0 110-114 35.654399999999995 37.0 37.0 37.0 37.0 37.0 115-119 35.5567 37.0 37.0 37.0 37.0 37.0 120-124 35.5298 37.0 37.0 37.0 37.0 37.0 125-129 35.116200000000006 37.0 37.0 37.0 32.2 37.0 130-134 35.384 37.0 37.0 37.0 37.0 37.0 135-139 35.2318 37.0 37.0 37.0 29.8 37.0 140-144 35.271 37.0 37.0 37.0 34.6 37.0 145-149 35.1802 37.0 37.0 37.0 32.2 37.0 150-151 34.848749999999995 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 0.0 14 6.0 15 6.0 16 7.0 17 4.0 18 1.0 19 3.0 20 4.0 21 6.0 22 7.0 23 9.0 24 9.0 25 5.0 26 9.0 27 12.0 28 14.0 29 12.0 30 16.0 31 43.0 32 39.0 33 111.0 34 213.0 35 586.0 36 2585.0 37 292.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.65 21.175 13.350000000000001 25.825 2 26.85 25.974999999999998 31.1 16.075 3 20.424999999999997 27.675 31.8 20.1 4 25.474999999999998 31.825 23.9 18.8 5 24.65 35.775 23.150000000000002 16.425 6 21.75 39.0 21.675 17.575 7 21.15 22.425 38.05 18.375 8 22.75 26.0 28.449999999999996 22.8 9 23.0 23.150000000000002 31.5 22.35 10-14 24.325 28.785 26.215 20.674999999999997 15-19 23.669999999999998 28.485 27.310000000000002 20.535 20-24 24.18 28.025 27.295 20.5 25-29 24.315 27.875 27.08 20.73 30-34 23.65 28.294999999999998 27.48 20.575 35-39 24.349999999999998 27.389999999999997 27.93 20.330000000000002 40-44 24.15 27.58 27.805000000000003 20.465 45-49 23.799999999999997 27.525 28.105000000000004 20.57 50-54 24.310000000000002 27.779999999999998 27.68 20.23 55-59 23.68 28.07 27.785 20.465 60-64 23.25 28.355000000000004 27.865000000000002 20.53 65-69 24.05 27.525 27.700000000000003 20.724999999999998 70-74 23.97 27.825 27.93 20.275000000000002 75-79 23.485 27.744999999999997 27.52 21.25 80-84 24.355 28.63 27.05 19.965 85-89 23.855 27.855 28.075 20.215 90-94 23.43 27.639999999999997 28.18 20.75 95-99 24.04 28.189999999999998 27.77 20.0 100-104 24.735 28.21 27.175 19.88 105-109 24.38 27.735 27.82 20.064999999999998 110-114 24.115000000000002 28.185 27.355 20.345 115-119 24.62 28.505000000000003 26.939999999999998 19.935 120-124 24.68 28.48 26.865 19.975 125-129 25.905 28.425 26.490000000000002 19.18 130-134 26.150000000000002 28.49 26.5 18.86 135-139 26.700000000000003 28.349999999999998 26.490000000000002 18.459999999999997 140-144 27.155 27.62 27.015 18.21 145-149 27.339999999999996 27.675 26.35 18.634999999999998 150-151 26.650000000000002 27.5625 27.737499999999997 18.05 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.5 7 0.5 8 0.5 9 1.5 10 1.0 11 0.5 12 0.5 13 0.0 14 0.5 15 1.5 16 1.5 17 1.0 18 1.5 19 1.0 20 0.0 21 1.0 22 1.5 23 0.5 24 2.0 25 3.0 26 2.5 27 5.5 28 8.0 29 11.5 30 18.5 31 21.5 32 26.0 33 38.0 34 57.0 35 75.5 36 99.0 37 119.0 38 134.5 39 168.0 40 185.5 41 207.0 42 237.5 43 253.0 44 266.5 45 268.5 46 265.5 47 231.5 48 207.0 49 190.5 50 163.5 51 142.0 52 117.5 53 92.5 54 66.5 55 58.5 56 50.0 57 38.0 58 32.0 59 23.5 60 14.5 61 17.0 62 15.5 63 7.5 64 5.5 65 5.0 66 3.5 67 3.0 68 1.5 69 0.0 70 0.5 71 1.0 72 1.0 73 0.5 74 0.0 75 0.0 76 0.5 77 1.5 78 1.0 79 1.0 80 1.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.5 92 0.5 93 0.0 94 0.0 95 0.0 96 0.5 97 1.0 98 0.5 99 1.0 100 6.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.0 #Duplication Level Percentage of deduplicated Percentage of total 1 84.88095238095238 71.3 2 12.291666666666666 20.65 3 2.261904761904762 5.7 4 0.4166666666666667 1.4000000000000001 5 0.05952380952380953 0.25 6 0.029761904761904764 0.15 7 0.0 0.0 8 0.029761904761904764 0.2 9 0.0 0.0 >10 0.029761904761904764 0.35000000000000003 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 14 0.35000000000000003 No Hit GCTTGAAAGCCAGTCGAGGAGGACGTGTTAAAGCAATGGCAGCATACACG 8 0.2 No Hit GGCAGGGAGCTGATACAGTCTGGTGCTGTCAGGCCAATACCACCAAAGGA 6 0.15 No Hit ATCTGATTTTATGGATGGAGAGATGCCAATATCATATGACAAGGCAAAAA 5 0.125 No Hit CAAATGGTTGAGGAGTTTATGCTTGCTGCAAATGTTTCTGTAGCTGAAAA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.0625 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.1625 0.0 0.0 0.0 0.0 76-77 0.25 0.0 0.0 0.0 0.0 78-79 0.2875 0.0 0.0 0.0 0.0 80-81 0.3625 0.0 0.0 0.0 0.0 82-83 0.4 0.0 0.0 0.0 0.0 84-85 0.4125 0.0 0.0 0.0 0.0 86-87 0.425 0.0 0.0 0.0 0.0 88-89 0.5875 0.0 0.0 0.0 0.0 90-91 0.7625 0.0 0.0 0.0 0.0 92-93 0.9125000000000001 0.0 0.0 0.0 0.0 94-95 1.075 0.0 0.0 0.0 0.0 96-97 1.4874999999999998 0.0 0.0 0.0 0.0 98-99 1.725 0.0 0.0 0.0 0.0 100-101 2.0375 0.0 0.0 0.0 0.0 102-103 2.375 0.0 0.0 0.0 0.0 104-105 2.6125 0.0 0.0 0.0 0.0 106-107 3.0 0.0 0.0 0.0 0.0 108-109 3.525 0.0 0.0 0.0 0.0 110-111 4.1 0.0 0.0 0.0 0.0 112-113 4.6625 0.0 0.0 0.0 0.0 114-115 5.1875 0.0 0.0 0.0 0.0 116-117 5.8375 0.0 0.0 0.0 0.0 118-119 6.512499999999999 0.0 0.0 0.0 0.0 120-121 7.1 0.0 0.0 0.0 0.0 122-123 7.7 0.0 0.0 0.0 0.0 124-125 8.625 0.0 0.0 0.0 0.0 126-127 9.3875 0.0 0.0 0.0 0.0 128-129 10.2625 0.0 0.0 0.0 0.0 130-131 11.337499999999999 0.0 0.0 0.0 0.0 132-133 12.0125 0.0 0.0 0.0 0.0 134-135 12.8 0.0 0.0 0.0 0.0 136-137 13.6125 0.0 0.0 0.0 0.0 138-139 14.4625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCACTGC 10 0.006830828 145.0 8 TGAATTC 10 0.006830828 145.0 2 >>END_MODULE Read 1729818 spots for SRR28623311.sra Written 1729818 spots for SRR28623311.sra Read 1729818 spots for SRR28623311.sra Written 1729818 spots for SRR28623311.sra Read 1729818 spots for SRR28623311.sra Written 1729818 spots for SRR28623311.sra Read 1729818 spots for SRR28623311.sra Written 1729818 spots for SRR28623311.sra Read 1729818 spots for SRR28623311.sra Written 1729818 spots for SRR28623311.sra Read 1729818 spots for SRR28623311.sra Written 1729818 spots for SRR28623311.sra Read 1729818 spots for SRR28623311.sra Written 1729818 spots for SRR28623311.sra Read 1729818 spots for SRR28623311.sra Written 1729818 spots for SRR28623311.sra Read 1729818 spots for SRR28623311.sra Written 1729818 spots for SRR28623311.sra Read 1729818 spots for SRR28623311.sra Written 1729818 spots for SRR28623311.sra Read 1729818 spots for SRR28623311.sra Written 1729818 spots for SRR28623311.sra Read 1729818 spots for SRR28623311.sra Written 1729818 spots for SRR28623311.sra Read 1729818 spots for SRR28623311.sra Written 1729818 spots for SRR28623311.sra Read 1729818 spots for SRR28623311.sra Written 1729818 spots for SRR28623311.sra Read 1729824 spots for SRR28623311.sra Written 1729824 spots for SRR28623311.sra Read 1729818 spots for SRR28623311.sra Written 1729818 spots for SRR28623311.sra Read 1729818 spots for SRR28623311.sra Written 1729818 spots for SRR28623311.sra Read 1729818 spots for SRR28623311.sra Written 1729818 spots for SRR28623311.sra Read 1729818 spots for SRR28623311.sra Written 1729818 spots for SRR28623311.sra Read 1729818 spots for SRR28623311.sra Written 1729818 spots for SRR28623311.sra SRR ids: ['SRR28623311.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_39quen8g SRR28623311.sra spots: 34596366 blocks: [[1, 1729818], [1729819, 3459636], [3459637, 5189454], [5189455, 6919272], [6919273, 8649090], [8649091, 10378908], [10378909, 12108726], [12108727, 13838544], [13838545, 15568362], [15568363, 17298180], [17298181, 19027998], [19027999, 20757816], [20757817, 22487634], [22487635, 24217452], [24217453, 25947270], [25947271, 27677088], [27677089, 29406906], [29406907, 31136724], [31136725, 32866542], [32866543, 34596366]] SRR28623311 file size 12775800 SRR28623311 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR28623311 SRR28623311_1.fastq SRR28623311_2.fastq Input file: SRR28623311_1.fastq Paired file: SRR28623311_2.fastq trimmed: SRR28623311-trimmed-pair1.fastq, SRR28623311-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 17:24:07 2025 >> started Tue Feb 11 17:24:46 2025 >> done (39.215s) 34596366 read pairs processed; of these: 16 ( 0.00%) short read pairs filtered out after trimming by size control 16193 ( 0.05%) empty read pairs filtered out after trimming by size control 34580157 (99.95%) read pairs available; of these: 6930839 (20.04%) trimmed read pairs available after processing 27649318 (79.96%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 1 0.00% 20 5 0.00% 21 4 0.00% 22 6 0.00% 23 4 0.00% 24 13 0.00% 25 4 0.00% 26 8 0.00% 27 12 0.00% 28 12 0.00% 29 14 0.00% 30 11 0.00% 31 16 0.00% 32 22 0.00% 33 22 0.00% 34 34 0.00% 35 26 0.00% 36 30 0.00% 37 44 0.00% 38 49 0.00% 39 57 0.00% 40 61 0.00% 41 61 0.00% 42 82 0.00% 43 114 0.00% 44 81 0.00% 45 111 0.00% 46 136 0.00% 47 156 0.00% 48 171 0.00% 49 231 0.00% 50 288 0.00% 51 297 0.00% 52 330 0.00% 53 355 0.00% 54 377 0.00% 55 503 0.00% 56 507 0.00% 57 622 0.00% 58 763 0.00% 59 823 0.00% 60 959 0.00% 61 1120 0.00% 62 1352 0.00% 63 1532 0.00% 64 1833 0.01% 65 1970 0.01% 66 2214 0.01% 67 2424 0.01% 68 2851 0.01% 69 3242 0.01% 70 3847 0.01% 71 4369 0.01% 72 5119 0.01% 73 5958 0.02% 74 6743 0.02% 75 7569 0.02% 76 8467 0.02% 77 9561 0.03% 78 10566 0.03% 79 11974 0.03% 80 12856 0.04% 81 14675 0.04% 82 16511 0.05% 83 18376 0.05% 84 20771 0.06% 85 23297 0.07% 86 25002 0.07% 87 27195 0.08% 88 28925 0.08% 89 31415 0.09% 90 33769 0.10% 91 36453 0.11% 92 39418 0.11% 93 42950 0.12% 94 45823 0.13% 95 49305 0.14% 96 52857 0.15% 97 55948 0.16% 98 58216 0.17% 99 60964 0.18% 100 63428 0.18% 101 65997 0.19% 102 69279 0.20% 103 72157 0.21% 104 75394 0.22% 105 79757 0.23% 106 82558 0.24% 107 85479 0.25% 108 87699 0.25% 109 89823 0.26% 110 92075 0.27% 111 94695 0.27% 112 97509 0.28% 113 98851 0.29% 114 101720 0.29% 115 105358 0.30% 116 107306 0.31% 117 111262 0.32% 118 113442 0.33% 119 115849 0.34% 120 116207 0.34% 121 118672 0.34% 122 119125 0.34% 123 121896 0.35% 124 123591 0.36% 125 124264 0.36% 126 128745 0.37% 127 131050 0.38% 128 133005 0.38% 129 133890 0.39% 130 135699 0.39% 131 135791 0.39% 132 136911 0.40% 133 138776 0.40% 134 139743 0.40% 135 140730 0.41% 136 143563 0.42% 137 144519 0.42% 138 145959 0.42% 139 148449 0.43% 140 147619 0.43% 141 149735 0.43% 142 149869 0.43% 143 149720 0.43% 144 151436 0.44% 145 150975 0.44% 146 150740 0.44% 147 151514 0.44% 148 154269 0.45% 149 154211 0.45% 150 155667 0.45% 151 27649318 79.96% 34580157 reads passed initial QC criterion=sequence-density sequence-density=0.62 sequence-density-rank=1 fanout-score=1.92 fanout-score-rank=29 prefix-density=0.60 prefix-fanout=1.9 sequence=GTTAGGGTAAGCTTTCTTCGCCTCCTCGAGCTCAATCAGCACCTGAGATGCCTCAGTGCATCCAAACATGGGTAGTTTCCACATAGTCCAGTAGCGTCCATCATAGTACCCTGG criterion=fanout-score sequence-density=0.20 sequence-density-rank=17 fanout-score=15.67 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=15.7 sequence=GGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTGAGCTTATCTCGTATGCCGTCTTCTGCTTGAAA criterion=sequence-density sequence-density=0.56 sequence-density-rank=1 fanout-score=2.84 fanout-score-rank=15 prefix-density=0.81 prefix-fanout=2.0 sequence=AACCGCACCCCGGCACA criterion=fanout-score sequence-density=0.04 sequence-density-rank=29 fanout-score=14.04 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=2.9 sequence=AGACCATCACCTTGGAGGTGGAGAGCTC SRR28623311 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 17:25:28 Started mapping on | Feb 11 17:25:28 Finished on | Feb 11 17:28:44 Mapping speed, Million of reads per hour | 635.15 Number of input reads | 34580157 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 32315133 Uniquely mapped reads % | 93.45% Average mapped length | 289.54 Number of splices: Total | 28039479 Number of splices: Annotated (sjdb) | 27388643 Number of splices: GT/AG | 27492461 Number of splices: GC/AG | 433116 Number of splices: AT/AC | 26955 Number of splices: Non-canonical | 86947 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 2.67 Insertion rate per base | 0.03% Insertion average length | 2.33 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 985907 % of reads mapped to multiple loci | 2.85% Number of reads mapped to too many loci | 190920 % of reads mapped to too many loci | 0.55% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.92% % of reads unmapped: other | 0.22% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1279117 1279117 1279117 N_multimapping 985907 985907 985907 N_noFeature 1234783 31861762 1450487 N_ambiguous 432237 2439 193034 UnstrandedReadsAssigned:30648113 PositiveStrandReadsAssigned:450932 NegativeStrandReadsAssigned:30671612 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR28623311 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR28623311-trimmed-pair1.fastq SRR28623311-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 34,580,157 reads, 31,363,464 reads pseudoaligned [quant] estimated average fragment length: 215.052 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,166 rounds 52401 SRR28623311.ke.tsv 34699 SRR28623311.se.tsv 87100 total ==> SRR28623311.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1803.95 4341 79.0571 Potri.005G024800.1.v4.1 1035 820.948 1992 79.7166 Potri.004G059700.1.v4.1 961 746.961 187 8.22467 Potri.007G009000.2.v4.1 1416 1201.95 0 0 Potri.003G141000.2.v4.1 2943 2728.95 771.469 9.28749 Potri.016G087400.1.v4.1 270 98.8158 1689.45 561.687 Potri.015G069301.1.v4.1 564 354.29 0 0 Potri.010G195200.1.v4.1 1773 1558.95 12 0.252886 Potri.012G127500.1.v4.1 977 762.948 930 40.0464 ==> SRR28623311.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 25 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 405 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 21 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 0 SRR28623311 completed mapping pipeline successfully