Starting /dee2/code/volunteer_pipeline.sh SRR28623312 current disk space = 3050418413568 free memory = 1400200588 SRR28623312 SRAfilesize faef7be431adb4dc97dc93c93c4be73d SRR28623312.sra SRR28623312.sra file validated SRR28623312 is paired end SRR28623312 is conventional basespace SRR28623312 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623312_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.527 37.0 37.0 37.0 37.0 37.0 2 36.513 37.0 37.0 37.0 37.0 37.0 3 36.5765 37.0 37.0 37.0 37.0 37.0 4 36.624 37.0 37.0 37.0 37.0 37.0 5 36.617 37.0 37.0 37.0 37.0 37.0 6 36.643 37.0 37.0 37.0 37.0 37.0 7 36.5325 37.0 37.0 37.0 37.0 37.0 8 36.5275 37.0 37.0 37.0 37.0 37.0 9 36.5945 37.0 37.0 37.0 37.0 37.0 10-14 36.584199999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.544500000000006 37.0 37.0 37.0 37.0 37.0 20-24 36.5512 37.0 37.0 37.0 37.0 37.0 25-29 36.513999999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.52 37.0 37.0 37.0 37.0 37.0 35-39 36.42530000000001 37.0 37.0 37.0 37.0 37.0 40-44 36.397000000000006 37.0 37.0 37.0 37.0 37.0 45-49 36.4297 37.0 37.0 37.0 37.0 37.0 50-54 36.360400000000006 37.0 37.0 37.0 37.0 37.0 55-59 36.3412 37.0 37.0 37.0 37.0 37.0 60-64 36.3593 37.0 37.0 37.0 37.0 37.0 65-69 36.304500000000004 37.0 37.0 37.0 37.0 37.0 70-74 36.210499999999996 37.0 37.0 37.0 37.0 37.0 75-79 36.218500000000006 37.0 37.0 37.0 37.0 37.0 80-84 36.0991 37.0 37.0 37.0 37.0 37.0 85-89 36.1037 37.0 37.0 37.0 37.0 37.0 90-94 36.123200000000004 37.0 37.0 37.0 37.0 37.0 95-99 36.0058 37.0 37.0 37.0 37.0 37.0 100-104 36.0436 37.0 37.0 37.0 37.0 37.0 105-109 35.9875 37.0 37.0 37.0 37.0 37.0 110-114 35.946799999999996 37.0 37.0 37.0 37.0 37.0 115-119 35.9253 37.0 37.0 37.0 37.0 37.0 120-124 35.7516 37.0 37.0 37.0 37.0 37.0 125-129 35.6997 37.0 37.0 37.0 37.0 37.0 130-134 35.772800000000004 37.0 37.0 37.0 37.0 37.0 135-139 35.6868 37.0 37.0 37.0 37.0 37.0 140-144 35.4902 37.0 37.0 37.0 37.0 37.0 145-149 35.4037 37.0 37.0 37.0 34.6 37.0 150-151 35.137 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 1.0 21 0.0 22 1.0 23 1.0 24 1.0 25 2.0 26 4.0 27 10.0 28 14.0 29 22.0 30 22.0 31 45.0 32 51.0 33 91.0 34 163.0 35 362.0 36 2927.0 37 282.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.55210420841683 13.702404809619239 8.41683366733467 39.328657314629254 2 16.975 15.475 37.675 29.875 3 17.349999999999998 18.075 30.099999999999998 34.475 4 21.224999999999998 26.674999999999997 23.325000000000003 28.775000000000002 5 22.900000000000002 32.800000000000004 24.775 19.525000000000002 6 19.950000000000003 36.65 24.8 18.6 7 14.975 28.95 40.025 16.05 8 18.325 26.75 32.1 22.825 9 16.425 25.05 36.9 21.625 10-14 19.235 30.869999999999997 27.91 21.985 15-19 19.035 29.475 28.28 23.21 20-24 19.71 29.075 27.96 23.255 25-29 19.345000000000002 29.354999999999997 27.97 23.330000000000002 30-34 19.7 29.56 27.29 23.45 35-39 19.035 30.325000000000003 26.810000000000002 23.830000000000002 40-44 20.025000000000002 29.17 27.865000000000002 22.939999999999998 45-49 19.794999999999998 29.23 27.41 23.565 50-54 19.195 30.049999999999997 27.38 23.375 55-59 19.25 29.26 27.785 23.705000000000002 60-64 20.119999999999997 29.375 26.96 23.544999999999998 65-69 19.09 29.965000000000003 27.245 23.7 70-74 19.72 29.085 27.855 23.34 75-79 19.625 28.945 28.125 23.305 80-84 19.625 28.860000000000003 27.815 23.7 85-89 19.79 29.435 27.245 23.53 90-94 20.075000000000003 29.485 26.889999999999997 23.549999999999997 95-99 20.175 29.15 27.400000000000002 23.275000000000002 100-104 19.85 28.849999999999998 27.605 23.695 105-109 20.28 28.660000000000004 27.250000000000004 23.810000000000002 110-114 20.305 29.065 26.665 23.965 115-119 21.04 28.804999999999996 26.46 23.695 120-124 20.415 29.599999999999998 25.619999999999997 24.365000000000002 125-129 20.0 29.17 26.135 24.695 130-134 20.175 29.145 26.290000000000003 24.39 135-139 20.349999999999998 28.63 26.450000000000003 24.57 140-144 21.175 28.7 25.755 24.37 145-149 21.02 28.189999999999998 25.385 25.405 150-151 21.8125 26.6625 26.5 25.025 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.5 17 1.5 18 1.0 19 0.5 20 1.5 21 2.5 22 1.5 23 0.5 24 1.5 25 3.5 26 5.0 27 11.0 28 20.5 29 20.0 30 20.5 31 37.5 32 55.0 33 59.5 34 74.0 35 95.0 36 114.0 37 150.5 38 170.0 39 172.0 40 197.5 41 219.0 42 213.5 43 227.0 44 264.5 45 266.0 46 254.5 47 234.5 48 198.0 49 176.5 50 138.0 51 115.0 52 112.0 53 91.5 54 69.5 55 56.0 56 41.5 57 28.0 58 25.0 59 16.5 60 7.5 61 8.0 62 6.0 63 2.5 64 3.0 65 3.0 66 2.0 67 1.5 68 1.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.5 97 0.5 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.2 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.55 #Duplication Level Percentage of deduplicated Percentage of total 1 86.26534190531852 73.8 2 11.309175920514319 19.35 3 1.8994739918176504 4.875 4 0.4091174751607247 1.4000000000000001 5 0.058445353594389245 0.25 6 0.029222676797194622 0.15 7 0.029222676797194622 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAG 7 0.17500000000000002 No Hit CAGGTGCTAGAAAACTTTCCTCAGTGGGATTTCAGTGTACCATGACCAGT 6 0.15 No Hit TGTGCTTTCAGAGTTTCAATATCACGCTCCAACTGCTGTTTCCAGTCCAC 5 0.125 No Hit ATAGGTATTGTGAATAAAGTTTATTCATGTACTGTGATTCATGATATATG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.1125 0.0 0.0 0.0 0.0 70-71 0.1375 0.0 0.0 0.0 0.0 72-73 0.225 0.0 0.0 0.0 0.0 74-75 0.25 0.0 0.0 0.0 0.0 76-77 0.3375 0.0 0.0 0.0 0.0 78-79 0.4 0.0 0.0 0.0 0.0 80-81 0.6375 0.0 0.0 0.0 0.0 82-83 0.7375 0.0 0.0 0.0 0.0 84-85 0.9375 0.0 0.0 0.0 0.0 86-87 1.1375000000000002 0.0 0.0 0.0 0.0 88-89 1.35 0.0 0.0 0.0 0.0 90-91 1.6125 0.0 0.0 0.0 0.0 92-93 1.85 0.0 0.0 0.0 0.0 94-95 2.3125 0.0 0.0 0.0 0.0 96-97 2.7874999999999996 0.0 0.0 0.0 0.0 98-99 3.225 0.0 0.0 0.0 0.0 100-101 3.7 0.0 0.0 0.0 0.0 102-103 4.0875 0.0 0.0 0.0 0.0 104-105 4.487500000000001 0.0 0.0 0.0 0.0 106-107 5.0 0.0 0.0 0.0 0.0 108-109 5.5 0.0 0.0 0.0 0.0 110-111 6.199999999999999 0.0 0.0 0.0 0.0 112-113 6.975 0.0 0.0 0.0 0.0 114-115 7.7 0.0 0.0 0.0 0.0 116-117 8.462499999999999 0.0 0.0 0.0 0.0 118-119 9.125 0.0 0.0 0.0 0.0 120-121 9.925 0.0 0.0 0.0 0.0 122-123 10.725000000000001 0.0 0.0 0.0 0.0 124-125 11.65 0.0 0.0 0.0 0.0 126-127 12.55 0.0 0.0 0.0 0.0 128-129 13.175 0.0 0.0 0.0 0.0 130-131 14.1875 0.0 0.0 0.0 0.0 132-133 15.325 0.0 0.0 0.0 0.0 134-135 16.4375 0.0 0.0 0.0 0.0 136-137 17.4125 0.0 0.0 0.0 0.0 138-139 18.4875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCTAGGC 10 0.006830828 145.0 7 >>END_MODULE SRR28623312 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623312_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.0565 37.0 37.0 37.0 37.0 37.0 2 36.21 37.0 37.0 37.0 37.0 37.0 3 36.1555 37.0 37.0 37.0 37.0 37.0 4 36.1455 37.0 37.0 37.0 37.0 37.0 5 36.2955 37.0 37.0 37.0 37.0 37.0 6 36.232 37.0 37.0 37.0 37.0 37.0 7 36.224 37.0 37.0 37.0 37.0 37.0 8 36.2705 37.0 37.0 37.0 37.0 37.0 9 36.1145 37.0 37.0 37.0 37.0 37.0 10-14 36.0822 37.0 37.0 37.0 37.0 37.0 15-19 35.9928 37.0 37.0 37.0 37.0 37.0 20-24 36.0089 37.0 37.0 37.0 37.0 37.0 25-29 35.972 37.0 37.0 37.0 37.0 37.0 30-34 35.8334 37.0 37.0 37.0 37.0 37.0 35-39 35.857800000000005 37.0 37.0 37.0 37.0 37.0 40-44 35.747 37.0 37.0 37.0 37.0 37.0 45-49 35.77309999999999 37.0 37.0 37.0 37.0 37.0 50-54 35.7736 37.0 37.0 37.0 37.0 37.0 55-59 35.6511 37.0 37.0 37.0 37.0 37.0 60-64 35.6301 37.0 37.0 37.0 37.0 37.0 65-69 35.7199 37.0 37.0 37.0 37.0 37.0 70-74 35.636399999999995 37.0 37.0 37.0 37.0 37.0 75-79 35.6676 37.0 37.0 37.0 37.0 37.0 80-84 35.5619 37.0 37.0 37.0 37.0 37.0 85-89 35.5585 37.0 37.0 37.0 37.0 37.0 90-94 35.527 37.0 37.0 37.0 37.0 37.0 95-99 35.511 37.0 37.0 37.0 37.0 37.0 100-104 35.398399999999995 37.0 37.0 37.0 37.0 37.0 105-109 35.3808 37.0 37.0 37.0 37.0 37.0 110-114 35.4173 37.0 37.0 37.0 37.0 37.0 115-119 35.286100000000005 37.0 37.0 37.0 37.0 37.0 120-124 35.39919999999999 37.0 37.0 37.0 37.0 37.0 125-129 35.0064 37.0 37.0 37.0 32.2 37.0 130-134 35.2374 37.0 37.0 37.0 34.6 37.0 135-139 35.0197 37.0 37.0 37.0 25.0 37.0 140-144 35.1066 37.0 37.0 37.0 25.0 37.0 145-149 34.97539999999999 37.0 37.0 37.0 27.4 37.0 150-151 34.623999999999995 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 6.0 13 10.0 14 10.0 15 12.0 16 8.0 17 5.0 18 1.0 19 6.0 20 3.0 21 8.0 22 7.0 23 14.0 24 7.0 25 9.0 26 20.0 27 19.0 28 20.0 29 17.0 30 18.0 31 35.0 32 42.0 33 68.0 34 179.0 35 584.0 36 2597.0 37 295.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.575 23.0 12.049999999999999 23.375 2 29.625 27.075 29.15 14.149999999999999 3 24.025 27.250000000000004 31.724999999999998 17.0 4 26.55 31.825 24.25 17.375 5 26.150000000000002 34.25 23.25 16.35 6 22.1 36.725 22.975 18.2 7 22.900000000000002 21.675 37.125 18.3 8 24.125 25.575 27.725 22.575 9 24.25 24.6 28.749999999999996 22.400000000000002 10-14 24.325 29.445 26.715 19.515 15-19 23.990000000000002 28.185 28.249999999999996 19.575 20-24 24.63 28.405 27.544999999999998 19.42 25-29 24.285 28.73 27.43 19.555 30-34 23.995 28.205000000000002 28.505000000000003 19.295 35-39 23.39 28.565 27.67 20.375 40-44 24.2 28.235 28.110000000000003 19.455 45-49 23.445 28.205000000000002 28.705000000000002 19.645000000000003 50-54 24.32 28.449999999999996 27.68 19.55 55-59 24.07 28.09 28.345 19.495 60-64 23.65 28.815 27.575 19.96 65-69 23.73 28.945 27.92 19.405 70-74 24.115000000000002 28.444999999999997 27.735 19.705000000000002 75-79 23.97 27.944999999999997 28.15 19.935 80-84 23.25 28.425 28.444999999999997 19.88 85-89 24.099999999999998 28.875 27.51 19.515 90-94 24.48 28.044999999999998 28.139999999999997 19.335 95-99 24.03 28.485 28.425 19.06 100-104 24.16 28.675 27.97 19.195 105-109 25.115 29.115000000000002 27.229999999999997 18.54 110-114 24.345 28.194999999999997 28.345 19.115 115-119 25.255 28.64 27.450000000000003 18.655 120-124 25.1 29.459999999999997 27.1 18.34 125-129 25.650000000000002 28.285 27.41 18.655 130-134 26.090000000000003 28.525 26.8 18.584999999999997 135-139 26.314999999999998 28.410000000000004 26.355 18.92 140-144 26.900000000000002 28.785 26.165 18.15 145-149 26.290000000000003 28.470000000000002 26.495 18.745 150-151 27.200000000000003 28.925 25.5375 18.337500000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.5 3 1.5 4 2.5 5 2.0 6 1.5 7 2.0 8 1.5 9 0.5 10 0.0 11 0.5 12 2.0 13 2.0 14 1.0 15 2.0 16 3.5 17 2.5 18 2.0 19 1.5 20 1.0 21 2.0 22 2.5 23 3.5 24 4.0 25 4.0 26 4.0 27 6.0 28 13.5 29 17.5 30 24.5 31 30.5 32 34.5 33 49.5 34 58.5 35 72.0 36 100.5 37 115.0 38 141.0 39 172.5 40 200.0 41 238.5 42 237.5 43 248.5 44 293.0 45 280.0 46 235.5 47 220.5 48 199.5 49 178.0 50 154.0 51 130.5 52 110.5 53 77.5 54 67.0 55 55.0 56 36.0 57 25.0 58 24.5 59 21.5 60 11.5 61 8.5 62 6.5 63 7.0 64 4.0 65 1.5 66 3.0 67 2.5 68 2.0 69 1.5 70 1.0 71 3.0 72 2.5 73 1.5 74 1.0 75 0.0 76 0.5 77 0.5 78 1.0 79 1.5 80 0.5 81 0.5 82 0.5 83 0.0 84 0.0 85 0.5 86 1.0 87 0.5 88 0.0 89 1.0 90 2.0 91 1.0 92 0.0 93 0.5 94 0.5 95 1.0 96 1.5 97 1.5 98 1.0 99 0.0 100 4.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.775 #Duplication Level Percentage of deduplicated Percentage of total 1 86.94258233751093 74.575 2 10.696589915476537 18.35 3 1.8653453803555815 4.8 4 0.2914602156805596 1.0 5 0.11658408627222384 0.5 6 0.02914602156805596 0.15 7 0.0 0.0 8 0.02914602156805596 0.2 9 0.0 0.0 >10 0.02914602156805596 0.42500000000000004 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 17 0.42500000000000004 No Hit CAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTA 8 0.2 No Hit GGCAATTTCTAAGGATTCTGGTAATGTGTGTGATACATGTGGAGTGGAAT 6 0.15 No Hit GTTTCACAGGCGAGATGGGTTTGAGGTTGGAAATGCAGATAAGATTTTTG 5 0.125 No Hit CTTTGGAAGACCGAGTGATAGGAGCAAAGAAACACCCAAAGCAATGAAGC 5 0.125 No Hit GGGCTGAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTT 5 0.125 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.1125 0.0 0.0 0.0 0.0 70-71 0.1375 0.0 0.0 0.0 0.0 72-73 0.225 0.0 0.0 0.0 0.0 74-75 0.25 0.0 0.0 0.0 0.0 76-77 0.3375 0.0 0.0 0.0 0.0 78-79 0.4 0.0 0.0 0.0 0.0 80-81 0.6375 0.0 0.0 0.0 0.0 82-83 0.7375 0.0 0.0 0.0 0.0 84-85 0.9375 0.0 0.0 0.0 0.0 86-87 1.1375000000000002 0.0 0.0 0.0 0.0 88-89 1.35 0.0 0.0 0.0 0.0 90-91 1.6375 0.0 0.0 0.0 0.0 92-93 1.875 0.0 0.0 0.0 0.0 94-95 2.2875 0.0 0.0 0.0 0.0 96-97 2.7625 0.0 0.0 0.0 0.0 98-99 3.2 0.0 0.0 0.0 0.0 100-101 3.675 0.0 0.0 0.0 0.0 102-103 4.0625 0.0 0.0 0.0 0.0 104-105 4.487500000000001 0.0 0.0 0.0 0.0 106-107 5.0 0.0 0.0 0.0 0.0 108-109 5.574999999999999 0.0 0.0 0.0 0.0 110-111 6.275 0.0 0.0 0.0 0.0 112-113 7.0 0.0 0.0 0.0 0.0 114-115 7.75 0.0 0.0 0.0 0.0 116-117 8.5125 0.0 0.0 0.0 0.0 118-119 9.175 0.0 0.0 0.0 0.0 120-121 10.05 0.0 0.0 0.0 0.0 122-123 10.850000000000001 0.0 0.0 0.0 0.0 124-125 11.775 0.0 0.0 0.0 0.0 126-127 12.6375 0.0 0.0 0.0 0.0 128-129 13.25 0.0 0.0 0.0 0.0 130-131 14.3125 0.0 0.0 0.0 0.0 132-133 15.475 0.0 0.0 0.0 0.0 134-135 16.6 0.0 0.0 0.0 0.0 136-137 17.5625 0.0 0.0 0.0 0.0 138-139 18.6 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1013183 spots for SRR28623312.sra Written 1013183 spots for SRR28623312.sra Read 1013183 spots for SRR28623312.sra Written 1013183 spots for SRR28623312.sra Read 1013183 spots for SRR28623312.sra Written 1013183 spots for SRR28623312.sra Read 1013183 spots for SRR28623312.sra Written 1013183 spots for SRR28623312.sra Read 1013183 spots for SRR28623312.sra Written 1013183 spots for SRR28623312.sra Read 1013183 spots for SRR28623312.sra Written 1013183 spots for SRR28623312.sra Read 1013183 spots for SRR28623312.sra Written 1013183 spots for SRR28623312.sra Read 1013183 spots for SRR28623312.sra Written 1013183 spots for SRR28623312.sra Read 1013183 spots for SRR28623312.sra Written 1013183 spots for SRR28623312.sra Read 1013183 spots for SRR28623312.sra Written 1013183 spots for SRR28623312.sra Read 1013183 spots for SRR28623312.sra Written 1013183 spots for SRR28623312.sra Read 1013183 spots for SRR28623312.sra Written 1013183 spots for SRR28623312.sra Read 1013183 spots for SRR28623312.sra Written 1013183 spots for SRR28623312.sra Read 1013183 spots for SRR28623312.sra Written 1013183 spots for SRR28623312.sra Read 1013183 spots for SRR28623312.sra Written 1013183 spots for SRR28623312.sra Read 1013183 spots for SRR28623312.sra Written 1013183 spots for SRR28623312.sra Read 1013183 spots for SRR28623312.sra Written 1013183 spots for SRR28623312.sra Read 1013183 spots for SRR28623312.sra Written 1013183 spots for SRR28623312.sra Read 1013183 spots for SRR28623312.sra Written 1013183 spots for SRR28623312.sra Read 1013183 spots for SRR28623312.sra Written 1013183 spots for SRR28623312.sra SRR ids: ['SRR28623312.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_sp9lg3zv SRR28623312.sra spots: 20263660 blocks: [[1, 1013183], [1013184, 2026366], [2026367, 3039549], [3039550, 4052732], [4052733, 5065915], [5065916, 6079098], [6079099, 7092281], [7092282, 8105464], [8105465, 9118647], [9118648, 10131830], [10131831, 11145013], [11145014, 12158196], [12158197, 13171379], [13171380, 14184562], [14184563, 15197745], [15197746, 16210928], [16210929, 17224111], [17224112, 18237294], [18237295, 19250477], [19250478, 20263660]] SRR28623312 file size 7478491 SRR28623312 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR28623312 SRR28623312_1.fastq SRR28623312_2.fastq Input file: SRR28623312_1.fastq Paired file: SRR28623312_2.fastq trimmed: SRR28623312-trimmed-pair1.fastq, SRR28623312-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 17:36:09 2025 >> started Tue Feb 11 17:36:32 2025 >> done (23.552s) 20263660 read pairs processed; of these: 21 ( 0.00%) short read pairs filtered out after trimming by size control 20251 ( 0.10%) empty read pairs filtered out after trimming by size control 20243388 (99.90%) read pairs available; of these: 4355765 (21.52%) trimmed read pairs available after processing 15887623 (78.48%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 3 0.00% 20 3 0.00% 21 3 0.00% 22 2 0.00% 23 4 0.00% 24 0 0.00% 25 3 0.00% 26 2 0.00% 27 7 0.00% 28 6 0.00% 29 4 0.00% 30 4 0.00% 31 13 0.00% 32 19 0.00% 33 13 0.00% 34 18 0.00% 35 12 0.00% 36 16 0.00% 37 25 0.00% 38 37 0.00% 39 38 0.00% 40 63 0.00% 41 26 0.00% 42 67 0.00% 43 58 0.00% 44 63 0.00% 45 84 0.00% 46 81 0.00% 47 135 0.00% 48 113 0.00% 49 150 0.00% 50 189 0.00% 51 244 0.00% 52 254 0.00% 53 278 0.00% 54 334 0.00% 55 383 0.00% 56 373 0.00% 57 513 0.00% 58 601 0.00% 59 689 0.00% 60 801 0.00% 61 927 0.00% 62 1076 0.01% 63 1295 0.01% 64 1441 0.01% 65 1637 0.01% 66 1848 0.01% 67 2062 0.01% 68 2344 0.01% 69 2670 0.01% 70 3096 0.02% 71 3625 0.02% 72 4243 0.02% 73 4957 0.02% 74 5492 0.03% 75 5957 0.03% 76 6873 0.03% 77 7520 0.04% 78 8373 0.04% 79 9565 0.05% 80 10186 0.05% 81 11655 0.06% 82 12825 0.06% 83 14291 0.07% 84 16115 0.08% 85 17574 0.09% 86 18984 0.09% 87 20291 0.10% 88 21933 0.11% 89 22763 0.11% 90 24950 0.12% 91 27161 0.13% 92 27951 0.14% 93 30906 0.15% 94 33093 0.16% 95 34932 0.17% 96 37011 0.18% 97 38645 0.19% 98 40244 0.20% 99 41524 0.21% 100 43305 0.21% 101 44012 0.22% 102 46168 0.23% 103 48450 0.24% 104 50445 0.25% 105 52547 0.26% 106 54579 0.27% 107 55903 0.28% 108 57518 0.28% 109 58157 0.29% 110 58986 0.29% 111 60204 0.30% 112 61965 0.31% 113 63331 0.31% 114 65413 0.32% 115 67334 0.33% 116 68043 0.34% 117 70595 0.35% 118 71241 0.35% 119 72620 0.36% 120 73118 0.36% 121 73716 0.36% 122 73520 0.36% 123 74976 0.37% 124 76277 0.38% 125 77179 0.38% 126 79203 0.39% 127 80181 0.40% 128 79755 0.39% 129 82347 0.41% 130 81920 0.40% 131 81798 0.40% 132 82415 0.41% 133 83796 0.41% 134 83700 0.41% 135 84287 0.42% 136 85471 0.42% 137 85922 0.42% 138 86728 0.43% 139 88450 0.44% 140 87706 0.43% 141 88414 0.44% 142 89026 0.44% 143 87414 0.43% 144 89298 0.44% 145 89455 0.44% 146 89858 0.44% 147 90070 0.44% 148 91547 0.45% 149 91805 0.45% 150 91831 0.45% 151 15887623 78.48% 20243388 reads passed initial QC criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=20.71 fanout-score-rank=4 prefix-density=0.26 prefix-fanout=20.7 sequence=GGATCGGAAGAGCACACGTCTGAACTCCAGTCACCAATCGACATCTCGTATGCCGTCTTCTGCTTGAAAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=85.26 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=11.6 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGCCAGGTTCTCCAGTGGTCCCTTTCCGGTCACAATGGCCTGGACAAAGAATCCGAACATTGAGAACATAGCCAACCT criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=3.63 fanout-score-rank=21 prefix-density=0.29 prefix-fanout=3.3 sequence=TGCAAGTGCGGCAGCGGCTGTGGAGGATGCAAGATGTACCCTGACATGAGCTCCTCAGAGACGATCACCAACGAAACTCTGGTTCTTGGTGTGGCACCAGAGAAGGGTCACTTTGCGGGAGCTGCTGAGACGGTCGTGGGAGCCGAGAATGGCTG criterion=fanout-score sequence-density=0.03 sequence-density-rank=38 fanout-score=62.96 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=7.6 sequence=TGGTGTTGACAAAGCCTTCGGCCGTGACATTGTCGATGCGCATTACAAGGCATGTCTGTATGCAGGCATTAACATTAGCGGCATCAATGGAGAAGTGATGCCAGGCCAATGGGAGTTTCAAGTTGGACCTTCAGTCGGTATCTCCGCCGGAGATGAATTATGGGCTGCTCGGTATATTTTGGAGAGGATTACTGAGGTTGCTGGAGTTGTGCTTTCATTTGATCCCAAGCCAATTCAGGGCGATTGGAATGGAGCGGGGGCACACACAAATTACAGTACTGAGTCTATGAGAAATGAAGGAGGCTATGAAATCATCAAGAAAGCAATTGAAAAGCTTGGTCTGAGGCATAAAGAACACATTGCAGCTTATGGAGAAGGGAATGAGCGGAGACTCACCGGCCGACACGAAACGGCTGACATTAATACCTTCAAATGGGGTGTGGCTGATCGTGGAGCTTCTATTCGTGTTGGTCGCGACACAGAGAAAGAAGGAAAGGGGTATTTTGAGGAT SRR28623312 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 17:37:16 Started mapping on | Feb 11 17:37:16 Finished on | Feb 11 17:39:44 Mapping speed, Million of reads per hour | 492.41 Number of input reads | 20243388 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 18561024 Uniquely mapped reads % | 91.69% Average mapped length | 288.01 Number of splices: Total | 16536308 Number of splices: Annotated (sjdb) | 16123534 Number of splices: GT/AG | 16212495 Number of splices: GC/AG | 251413 Number of splices: AT/AC | 13711 Number of splices: Non-canonical | 58689 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.04% Deletion average length | 2.66 Insertion rate per base | 0.03% Insertion average length | 2.32 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 507162 % of reads mapped to multiple loci | 2.51% Number of reads mapped to too many loci | 86731 % of reads mapped to too many loci | 0.43% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.04% % of reads unmapped: other | 0.34% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1175202 1175202 1175202 N_multimapping 507162 507162 507162 N_noFeature 780323 18192592 926350 N_ambiguous 330421 1221 107300 UnstrandedReadsAssigned:17450280 PositiveStrandReadsAssigned:367211 NegativeStrandReadsAssigned:17527374 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=146 echo kmer=141 SRR28623312 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR28623312-trimmed-pair1.fastq SRR28623312-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,243,388 reads, 17,829,776 reads pseudoaligned [quant] estimated average fragment length: 211.687 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,244 rounds 52401 SRR28623312.ke.tsv 34699 SRR28623312.se.tsv 87100 total ==> SRR28623312.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1807.31 1446 38.8631 Potri.005G024800.1.v4.1 1035 824.313 603 35.5326 Potri.004G059700.1.v4.1 961 750.326 189 12.2353 Potri.007G009000.2.v4.1 1416 1205.31 0 0 Potri.003G141000.2.v4.1 2943 2732.31 1266.6 22.517 Potri.016G087400.1.v4.1 270 101.213 1044.06 501.065 Potri.015G069301.1.v4.1 564 357.673 0 0 Potri.010G195200.1.v4.1 1773 1562.31 46 1.43018 Potri.012G127500.1.v4.1 977 766.326 101 6.40192 ==> SRR28623312.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 213 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 292 Potri.001G212900.v4.1 9 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 7 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 4 SRR28623312 completed mapping pipeline successfully