Starting /dee2/code/volunteer_pipeline.sh SRR28623313 current disk space = 3051235442688 free memory = 1410448916 SRR28623313 SRAfilesize b6f0d6f42e60a3372a73bd603fe02011 SRR28623313.sra SRR28623313.sra file validated SRR28623313 is paired end SRR28623313 is conventional basespace SRR28623313 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623313_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.43025 37.0 37.0 37.0 37.0 37.0 2 36.4565 37.0 37.0 37.0 37.0 37.0 3 36.6195 37.0 37.0 37.0 37.0 37.0 4 36.624 37.0 37.0 37.0 37.0 37.0 5 36.6765 37.0 37.0 37.0 37.0 37.0 6 36.627 37.0 37.0 37.0 37.0 37.0 7 36.6125 37.0 37.0 37.0 37.0 37.0 8 36.4755 37.0 37.0 37.0 37.0 37.0 9 36.6195 37.0 37.0 37.0 37.0 37.0 10-14 36.6016 37.0 37.0 37.0 37.0 37.0 15-19 36.5917 37.0 37.0 37.0 37.0 37.0 20-24 36.5427 37.0 37.0 37.0 37.0 37.0 25-29 36.4853 37.0 37.0 37.0 37.0 37.0 30-34 36.4816 37.0 37.0 37.0 37.0 37.0 35-39 36.431 37.0 37.0 37.0 37.0 37.0 40-44 36.4228 37.0 37.0 37.0 37.0 37.0 45-49 36.357299999999995 37.0 37.0 37.0 37.0 37.0 50-54 36.3011 37.0 37.0 37.0 37.0 37.0 55-59 36.2681 37.0 37.0 37.0 37.0 37.0 60-64 36.3081 37.0 37.0 37.0 37.0 37.0 65-69 36.2559 37.0 37.0 37.0 37.0 37.0 70-74 36.1426 37.0 37.0 37.0 37.0 37.0 75-79 36.15 37.0 37.0 37.0 37.0 37.0 80-84 36.0723 37.0 37.0 37.0 37.0 37.0 85-89 36.087599999999995 37.0 37.0 37.0 37.0 37.0 90-94 36.0098 37.0 37.0 37.0 37.0 37.0 95-99 35.99490000000001 37.0 37.0 37.0 37.0 37.0 100-104 35.986599999999996 37.0 37.0 37.0 37.0 37.0 105-109 36.01389999999999 37.0 37.0 37.0 37.0 37.0 110-114 35.915400000000005 37.0 37.0 37.0 37.0 37.0 115-119 35.911 37.0 37.0 37.0 37.0 37.0 120-124 35.79690000000001 37.0 37.0 37.0 37.0 37.0 125-129 35.6659 37.0 37.0 37.0 37.0 37.0 130-134 35.8485 37.0 37.0 37.0 37.0 37.0 135-139 35.7457 37.0 37.0 37.0 37.0 37.0 140-144 35.471199999999996 37.0 37.0 37.0 37.0 37.0 145-149 35.4722 37.0 37.0 37.0 37.0 37.0 150-151 35.332499999999996 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 1.0 22 0.0 23 3.0 24 3.0 25 5.0 26 5.0 27 10.0 28 12.0 29 23.0 30 27.0 31 36.0 32 48.0 33 87.0 34 144.0 35 385.0 36 2946.0 37 264.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.22835633626098 13.626097867001254 11.09159347553325 41.05395232120452 2 18.425 15.75 36.125 29.7 3 17.8 18.2 28.000000000000004 36.0 4 22.275 26.424999999999997 23.9 27.400000000000002 5 24.625 31.125000000000004 25.474999999999998 18.775 6 21.224999999999998 35.65 23.7 19.425 7 16.675 27.175 38.975 17.175 8 17.25 28.175 31.85 22.725 9 16.725 24.875 35.199999999999996 23.200000000000003 10-14 19.06 30.455 27.805000000000003 22.68 15-19 19.335 29.25 27.865000000000002 23.549999999999997 20-24 20.205000000000002 28.854999999999997 27.905 23.035 25-29 19.564999999999998 29.575000000000003 27.150000000000002 23.71 30-34 19.43 29.299999999999997 27.825 23.445 35-39 19.919999999999998 28.605000000000004 27.825 23.65 40-44 20.125 28.925 27.455000000000002 23.494999999999997 45-49 19.35 28.720000000000002 28.28 23.65 50-54 20.44 28.13 27.994999999999997 23.435 55-59 19.41 28.64 28.54 23.41 60-64 20.455000000000002 28.74 27.474999999999998 23.330000000000002 65-69 19.57 28.810000000000002 27.595 24.025 70-74 19.655 28.799999999999997 27.36 24.185000000000002 75-79 19.75 28.435 28.325 23.49 80-84 20.415 28.82 27.625 23.14 85-89 19.830000000000002 28.67 27.815 23.685000000000002 90-94 20.26 29.84 27.21 22.689999999999998 95-99 19.759999999999998 29.225 27.525 23.49 100-104 20.27 28.825 27.075 23.830000000000002 105-109 20.325 29.160000000000004 27.229999999999997 23.285 110-114 20.565 28.144999999999996 27.889999999999997 23.400000000000002 115-119 21.0 28.975 26.55 23.474999999999998 120-124 21.04 29.15 25.94 23.87 125-129 20.880000000000003 28.535 26.645000000000003 23.94 130-134 20.21 28.325 27.205000000000002 24.26 135-139 21.45 28.605000000000004 26.38 23.565 140-144 21.16 27.98 27.084999999999997 23.775 145-149 21.065 28.599999999999998 26.305 24.03 150-151 21.6125 26.700000000000003 27.075 24.6125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 0.5 19 0.0 20 0.5 21 1.0 22 1.5 23 2.0 24 4.0 25 3.5 26 3.0 27 9.5 28 15.5 29 21.5 30 33.0 31 35.0 32 33.5 33 49.0 34 67.0 35 89.5 36 116.0 37 125.5 38 133.0 39 164.0 40 208.0 41 234.0 42 238.0 43 242.0 44 258.0 45 269.0 46 242.5 47 227.0 48 216.0 49 178.5 50 155.0 51 135.5 52 106.0 53 82.0 54 75.0 55 65.5 56 43.5 57 22.5 58 20.5 59 18.5 60 11.0 61 9.5 62 8.5 63 6.0 64 2.5 65 2.0 66 3.0 67 4.5 68 3.5 69 1.0 70 1.0 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.375 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 86.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 86.97162709901563 75.1 2 10.68326577880718 18.45 3 1.9687319050376375 5.1 4 0.3184713375796179 1.0999999999999999 5 0.05790387955993051 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TGTTGATTCATTGCTTTTGGGTCCCCGCCAGCAGATTTTGCTGCAGCAGC 5 0.125 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACACGATGACATCTCGTAT 5 0.125 TruSeq Adapter, Index 15 (97% over 36bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0125 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.23750000000000002 0.0 0.0 0.0 0.0 76-77 0.3125 0.0 0.0 0.0 0.0 78-79 0.3625 0.0 0.0 0.0 0.0 80-81 0.375 0.0 0.0 0.0 0.0 82-83 0.4125 0.0 0.0 0.0 0.0 84-85 0.525 0.0 0.0 0.0 0.0 86-87 0.675 0.0 0.0 0.0 0.0 88-89 0.825 0.0 0.0 0.0 0.0 90-91 0.9375 0.0 0.0 0.0 0.0 92-93 1.1625 0.0 0.0 0.0 0.0 94-95 1.4375 0.0 0.0 0.0 0.0 96-97 1.6875 0.0 0.0 0.0 0.0 98-99 2.0 0.0 0.0 0.0 0.0 100-101 2.4 0.0 0.0 0.0 0.0 102-103 2.8 0.0 0.0 0.0 0.0 104-105 3.1625 0.0 0.0 0.0 0.0 106-107 3.55 0.0 0.0 0.0 0.0 108-109 4.05 0.0 0.0 0.0 0.0 110-111 4.375 0.0 0.0 0.0 0.0 112-113 4.762499999999999 0.0 0.0 0.0 0.0 114-115 5.2125 0.0 0.0 0.0 0.0 116-117 5.65 0.0 0.0 0.0 0.0 118-119 6.1 0.0 0.0 0.0 0.0 120-121 6.6875 0.0 0.0 0.0 0.0 122-123 7.375 0.0 0.0 0.0 0.0 124-125 7.9625 0.0 0.0 0.0 0.0 126-127 8.8125 0.0 0.0 0.0 0.0 128-129 9.35 0.0 0.0 0.0 0.0 130-131 9.75 0.0 0.0 0.0 0.0 132-133 10.4375 0.0 0.0 0.0 0.0 134-135 11.3 0.0 0.0 0.0 0.0 136-137 12.25 0.0 0.0 0.0 0.0 138-139 12.975 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCACAA 10 0.006830828 145.0 1 >>END_MODULE SRR28623313 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623313_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1015 37.0 37.0 37.0 37.0 37.0 2 36.364 37.0 37.0 37.0 37.0 37.0 3 36.36 37.0 37.0 37.0 37.0 37.0 4 36.342 37.0 37.0 37.0 37.0 37.0 5 36.5045 37.0 37.0 37.0 37.0 37.0 6 36.444 37.0 37.0 37.0 37.0 37.0 7 36.4095 37.0 37.0 37.0 37.0 37.0 8 36.3015 37.0 37.0 37.0 37.0 37.0 9 36.326 37.0 37.0 37.0 37.0 37.0 10-14 36.23570000000001 37.0 37.0 37.0 37.0 37.0 15-19 36.283300000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.2186 37.0 37.0 37.0 37.0 37.0 25-29 36.2013 37.0 37.0 37.0 37.0 37.0 30-34 36.1062 37.0 37.0 37.0 37.0 37.0 35-39 36.201499999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.07040000000001 37.0 37.0 37.0 37.0 37.0 45-49 36.0452 37.0 37.0 37.0 37.0 37.0 50-54 36.085699999999996 37.0 37.0 37.0 37.0 37.0 55-59 35.92229999999999 37.0 37.0 37.0 37.0 37.0 60-64 35.894099999999995 37.0 37.0 37.0 37.0 37.0 65-69 35.9348 37.0 37.0 37.0 37.0 37.0 70-74 36.0051 37.0 37.0 37.0 37.0 37.0 75-79 35.926 37.0 37.0 37.0 37.0 37.0 80-84 35.879999999999995 37.0 37.0 37.0 37.0 37.0 85-89 35.829899999999995 37.0 37.0 37.0 37.0 37.0 90-94 35.787400000000005 37.0 37.0 37.0 37.0 37.0 95-99 35.836 37.0 37.0 37.0 37.0 37.0 100-104 35.74660000000001 37.0 37.0 37.0 37.0 37.0 105-109 35.706399999999995 37.0 37.0 37.0 37.0 37.0 110-114 35.676399999999994 37.0 37.0 37.0 37.0 37.0 115-119 35.617399999999996 37.0 37.0 37.0 37.0 37.0 120-124 35.7164 37.0 37.0 37.0 37.0 37.0 125-129 35.2197 37.0 37.0 37.0 32.2 37.0 130-134 35.567499999999995 37.0 37.0 37.0 37.0 37.0 135-139 35.37 37.0 37.0 37.0 34.6 37.0 140-144 35.3578 37.0 37.0 37.0 34.6 37.0 145-149 35.2838 37.0 37.0 37.0 34.6 37.0 150-151 34.82775 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 5.0 14 3.0 15 3.0 16 1.0 17 4.0 18 2.0 19 2.0 20 3.0 21 2.0 22 6.0 23 6.0 24 6.0 25 5.0 26 5.0 27 10.0 28 17.0 29 13.0 30 32.0 31 28.0 32 57.0 33 100.0 34 176.0 35 574.0 36 2664.0 37 275.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.375 21.8 15.075 26.75 2 28.475 26.525 28.050000000000004 16.950000000000003 3 22.825 27.875 31.1 18.2 4 23.799999999999997 34.075 23.474999999999998 18.65 5 26.924999999999997 36.325 21.675 15.075 6 20.974999999999998 40.025 22.175 16.825000000000003 7 21.8 21.925 37.8 18.475 8 21.725 25.674999999999997 27.525 25.074999999999996 9 23.025000000000002 26.174999999999997 29.4 21.4 10-14 24.154999999999998 29.37 26.41 20.064999999999998 15-19 23.72 27.97 28.115000000000002 20.195 20-24 23.3 28.83 27.55 20.32 25-29 23.56 28.88 26.935 20.625 30-34 23.225 29.49 27.365000000000002 19.919999999999998 35-39 23.53 27.93 28.110000000000003 20.43 40-44 23.335 28.144999999999996 28.599999999999998 19.919999999999998 45-49 23.35 28.560000000000002 28.53 19.56 50-54 23.515 28.449999999999996 27.900000000000002 20.135 55-59 23.345 27.800000000000004 28.389999999999997 20.465 60-64 23.06 28.655 28.09 20.195 65-69 23.04 28.645 28.050000000000004 20.265 70-74 23.605 28.360000000000003 28.01 20.025000000000002 75-79 23.14 28.244999999999997 28.060000000000002 20.555 80-84 23.09 27.884999999999998 28.43 20.595 85-89 23.925 28.675 27.76 19.64 90-94 23.985 27.750000000000004 28.299999999999997 19.965 95-99 23.685000000000002 27.644999999999996 28.48 20.19 100-104 24.455 27.779999999999998 27.655 20.11 105-109 24.21 28.435 27.48 19.875 110-114 24.240000000000002 28.24 27.1 20.419999999999998 115-119 24.915000000000003 28.955 26.400000000000002 19.73 120-124 24.63 29.020000000000003 26.82 19.53 125-129 25.040000000000003 28.88 27.18 18.9 130-134 25.845000000000002 28.249999999999996 26.6 19.305 135-139 26.015 27.98 26.775 19.23 140-144 26.085 28.625 26.325 18.965 145-149 27.08 27.779999999999998 26.365 18.775 150-151 26.9625 27.800000000000004 26.0625 19.175 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 2.0 12 2.5 13 1.5 14 1.5 15 1.5 16 1.0 17 0.5 18 0.5 19 0.5 20 1.0 21 1.5 22 1.0 23 2.5 24 2.5 25 1.5 26 4.5 27 11.5 28 14.0 29 16.0 30 19.5 31 24.0 32 44.5 33 48.0 34 51.0 35 74.5 36 91.0 37 122.0 38 156.0 39 173.0 40 204.5 41 234.5 42 250.0 43 267.0 44 259.0 45 251.0 46 255.5 47 251.5 48 229.5 49 183.0 50 154.0 51 131.5 52 99.5 53 80.5 54 67.0 55 51.0 56 35.0 57 24.5 58 17.0 59 12.0 60 10.5 61 12.0 62 10.5 63 5.0 64 3.5 65 4.0 66 2.5 67 1.5 68 0.5 69 0.0 70 1.0 71 2.0 72 2.0 73 1.0 74 0.0 75 0.0 76 0.5 77 1.0 78 0.5 79 0.0 80 0.0 81 0.0 82 1.5 83 1.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.5 90 1.0 91 1.0 92 1.5 93 1.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 0.5 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 86.75 #Duplication Level Percentage of deduplicated Percentage of total 1 87.492795389049 75.9 2 10.230547550432277 17.75 3 1.9020172910662825 4.95 4 0.3170028818443804 1.0999999999999999 5 0.028818443804034585 0.125 6 0.0 0.0 7 0.028818443804034585 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 7 0.17500000000000002 No Hit GAAATACTGGTCCAACTAAGCAGTAGAAAATGATACCCAGTCCGTTTCTG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0125 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.2125 0.0 0.0 0.0 0.0 76-77 0.2875 0.0 0.0 0.0 0.0 78-79 0.3375 0.0 0.0 0.0 0.0 80-81 0.35 0.0 0.0 0.0 0.0 82-83 0.38749999999999996 0.0 0.0 0.0 0.0 84-85 0.5 0.0 0.0 0.0 0.0 86-87 0.65 0.0 0.0 0.0 0.0 88-89 0.825 0.0 0.0 0.0 0.0 90-91 0.9624999999999999 0.0 0.0 0.0 0.0 92-93 1.1875 0.0 0.0 0.0 0.0 94-95 1.4625 0.0 0.0 0.0 0.0 96-97 1.7125 0.0 0.0 0.0 0.0 98-99 2.025 0.0 0.0 0.0 0.0 100-101 2.425 0.0 0.0 0.0 0.0 102-103 2.8 0.0 0.0 0.0 0.0 104-105 3.1875 0.0 0.0 0.0 0.0 106-107 3.6 0.0 0.0 0.0 0.0 108-109 4.125 0.0 0.0 0.0 0.0 110-111 4.4625 0.0 0.0 0.0 0.0 112-113 4.862500000000001 0.0 0.0 0.0 0.0 114-115 5.3625 0.0 0.0 0.0 0.0 116-117 5.8125 0.0 0.0 0.0 0.0 118-119 6.3 0.0 0.0 0.0 0.0 120-121 6.9375 0.0 0.0 0.0 0.0 122-123 7.625 0.0 0.0 0.0 0.0 124-125 8.2125 0.0 0.0 0.0 0.0 126-127 9.0375 0.0 0.0 0.0 0.0 128-129 9.5125 0.0 0.0 0.0 0.0 130-131 9.9 0.0 0.0 0.0 0.0 132-133 10.6125 0.0 0.0 0.0 0.0 134-135 11.4875 0.0 0.0 0.0 0.0 136-137 12.45 0.0 0.0 0.0 0.0 138-139 13.212499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1690893 spots for SRR28623313.sra Written 1690893 spots for SRR28623313.sra Read 1690893 spots for SRR28623313.sra Written 1690893 spots for SRR28623313.sra Read 1690893 spots for SRR28623313.sra Written 1690893 spots for SRR28623313.sra Read 1690893 spots for SRR28623313.sra Written 1690893 spots for SRR28623313.sra Read 1690893 spots for SRR28623313.sra Written 1690893 spots for SRR28623313.sra Read 1690893 spots for SRR28623313.sra Written 1690893 spots for SRR28623313.sra Read 1690893 spots for SRR28623313.sra Written 1690893 spots for SRR28623313.sra Read 1690893 spots for SRR28623313.sra Written 1690893 spots for SRR28623313.sra Read 1690893 spots for SRR28623313.sra Written 1690893 spots for SRR28623313.sra Read 1690893 spots for SRR28623313.sra Written 1690893 spots for SRR28623313.sra Read 1690893 spots for SRR28623313.sra Written 1690893 spots for SRR28623313.sra Read 1690893 spots for SRR28623313.sra Written 1690893 spots for SRR28623313.sra Read 1690893 spots for SRR28623313.sra Written 1690893 spots for SRR28623313.sra Read 1690893 spots for SRR28623313.sra Written 1690893 spots for SRR28623313.sra Read 1690893 spots for SRR28623313.sra Written 1690893 spots for SRR28623313.sra Read 1690893 spots for SRR28623313.sra Written 1690893 spots for SRR28623313.sra Read 1690893 spots for SRR28623313.sra Written 1690893 spots for SRR28623313.sra Read 1690911 spots for SRR28623313.sra Written 1690911 spots for SRR28623313.sra Read 1690893 spots for SRR28623313.sra Written 1690893 spots for SRR28623313.sra Read 1690893 spots for SRR28623313.sra Written 1690893 spots for SRR28623313.sra SRR ids: ['SRR28623313.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_nw1girxv SRR28623313.sra spots: 33817878 blocks: [[1, 1690893], [1690894, 3381786], [3381787, 5072679], [5072680, 6763572], [6763573, 8454465], [8454466, 10145358], [10145359, 11836251], [11836252, 13527144], [13527145, 15218037], [15218038, 16908930], [16908931, 18599823], [18599824, 20290716], [20290717, 21981609], [21981610, 23672502], [23672503, 25363395], [25363396, 27054288], [27054289, 28745181], [28745182, 30436074], [30436075, 32126967], [32126968, 33817878]] SRR28623313 file size 12488070 SRR28623313 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR28623313 SRR28623313_1.fastq SRR28623313_2.fastq Input file: SRR28623313_1.fastq Paired file: SRR28623313_2.fastq trimmed: SRR28623313-trimmed-pair1.fastq, SRR28623313-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 17:44:40 2025 >> started Tue Feb 11 17:45:35 2025 >> done (55.256s) 33817878 read pairs processed; of these: 24 ( 0.00%) short read pairs filtered out after trimming by size control 56784 ( 0.17%) empty read pairs filtered out after trimming by size control 33761070 (99.83%) read pairs available; of these: 5992699 (17.75%) trimmed read pairs available after processing 27768371 (82.25%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 6 0.00% 20 3 0.00% 21 6 0.00% 22 8 0.00% 23 1 0.00% 24 6 0.00% 25 4 0.00% 26 7 0.00% 27 9 0.00% 28 7 0.00% 29 17 0.00% 30 16 0.00% 31 13 0.00% 32 10 0.00% 33 24 0.00% 34 24 0.00% 35 30 0.00% 36 18 0.00% 37 21 0.00% 38 59 0.00% 39 55 0.00% 40 58 0.00% 41 68 0.00% 42 90 0.00% 43 89 0.00% 44 96 0.00% 45 105 0.00% 46 134 0.00% 47 131 0.00% 48 169 0.00% 49 201 0.00% 50 275 0.00% 51 289 0.00% 52 303 0.00% 53 350 0.00% 54 383 0.00% 55 428 0.00% 56 484 0.00% 57 578 0.00% 58 640 0.00% 59 757 0.00% 60 947 0.00% 61 1054 0.00% 62 1224 0.00% 63 1419 0.00% 64 1534 0.00% 65 1685 0.00% 66 1907 0.01% 67 2187 0.01% 68 2440 0.01% 69 2849 0.01% 70 3305 0.01% 71 3734 0.01% 72 4395 0.01% 73 4967 0.01% 74 5818 0.02% 75 6458 0.02% 76 7326 0.02% 77 7674 0.02% 78 8561 0.03% 79 9829 0.03% 80 10731 0.03% 81 12126 0.04% 82 13784 0.04% 83 15389 0.05% 84 17190 0.05% 85 19191 0.06% 86 20818 0.06% 87 22594 0.07% 88 24052 0.07% 89 25742 0.08% 90 27892 0.08% 91 30440 0.09% 92 32682 0.10% 93 35348 0.10% 94 38778 0.11% 95 41529 0.12% 96 44526 0.13% 97 46408 0.14% 98 48593 0.14% 99 50938 0.15% 100 53004 0.16% 101 55145 0.16% 102 57790 0.17% 103 61798 0.18% 104 63917 0.19% 105 68161 0.20% 106 71050 0.21% 107 72583 0.21% 108 74635 0.22% 109 77569 0.23% 110 77479 0.23% 111 80470 0.24% 112 82705 0.24% 113 84781 0.25% 114 88107 0.26% 115 90723 0.27% 116 93241 0.28% 117 94903 0.28% 118 97550 0.29% 119 98528 0.29% 120 100198 0.30% 121 102270 0.30% 122 103344 0.31% 123 104424 0.31% 124 108012 0.32% 125 109368 0.32% 126 111880 0.33% 127 114584 0.34% 128 115124 0.34% 129 116299 0.34% 130 118419 0.35% 131 118722 0.35% 132 119618 0.35% 133 120939 0.36% 134 121555 0.36% 135 123589 0.37% 136 124436 0.37% 137 125966 0.37% 138 127769 0.38% 139 129957 0.38% 140 129665 0.38% 141 130967 0.39% 142 131721 0.39% 143 131941 0.39% 144 133319 0.39% 145 134094 0.40% 146 132166 0.39% 147 134192 0.40% 148 136197 0.40% 149 136158 0.40% 150 137628 0.41% 151 27768371 82.25% 33761070 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=13.25 fanout-score-rank=14 prefix-density=0.10 prefix-fanout=13.2 sequence=GGATCGGAAGAGCACACGTCTGAACTCCAGTCACACGATGACATCTCGTATGCCGTCTTCTGCTTG criterion=fanout-score sequence-density=0.02 sequence-density-rank=38 fanout-score=172.87 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=11.9 sequence=ACAACAACAAGAGGAGCGGGCCTAACCAGGCTAAAAACAGGGCAGTTAAACCAACATTAATACCACAACTATCTTAATTGCCACTGACTAGCAATAACAACACCCATTTCTAAAGAAAATATCTTATTCTGCAAATCTCAGACTCTTCTCCCTCGTTGTAAACAAGGAAGAGAAGTACTTGAGTTTGACATGTAGCAAATCAAAGTTTCTAGTGGTGCTTGTTTGCAACAGTGCACTGCTTTCTGATCTCACCCTTGGTACCGGTGAGTGGGTTGTTCTCAGAAAGAATGGTGATAGCCCTAGAAAACTCCTTAAAGAAGTAATCCTGACTCTTGGCCATTTTCTTCACGTAAGGCTTAGTTCTCTTGTCAGTGGCTAGTTGGTGATCCACTATCAACAAGCCCTTGTTGTCCAATATGTTTCTGTAGTAGTTGTTGTCTAGAACCATGGGTGTGCCTCTGTCATTCCTCACATATTGGACAGCTTTAGGGTCTGGGATTGAATCAGGGCA criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=14.17 fanout-score-rank=18 prefix-density=0.13 prefix-fanout=13.5 sequence=GAGAGAGAGAGTTAAGACAATGGCCTCGAAGAAATCTGCAATCGTATTACCTGGTTCAAAGGTGTTGAAGCACATAGTTTTTGTACGGTTTAATGATGGGATCACTGATGAACAAATTGAGAA criterion=fanout-score sequence-density=0.02 sequence-density-rank=38 fanout-score=422.50 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=25.9 sequence=ACAAGAAGATCAACTGTCTCTCTGCCTGGTTTGTATTCCAAGAAATGGAGAAAGTCCAAAAGCTCTTTTGTGTGGCTCTATTGCTTGCAGTACTAGCCATAGCAAGCAATATTGCGAATGCCCAGAGTACCATATGCAAAATGCCTGTTGCTGGCCTAATGTCATGCAAGCCTTCTGTAACTCCTCCTAACCCTACCGCACCCTCGGCAGACTGCTGCTCGGCACTTTCGCATGCTGACATAAACTGCCTTTGCTCCTACAAAAATTCCAACCTGCTCCCTTCCCTTGGAATCGACCCAAAACTTGCCATGCAGCTCCCTGGCAAGTGCA SRR28623313 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 17:46:15 Started mapping on | Feb 11 17:46:15 Finished on | Feb 11 17:49:27 Mapping speed, Million of reads per hour | 633.02 Number of input reads | 33761070 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 31747077 Uniquely mapped reads % | 94.03% Average mapped length | 290.91 Number of splices: Total | 28577471 Number of splices: Annotated (sjdb) | 27850410 Number of splices: GT/AG | 28056137 Number of splices: GC/AG | 403455 Number of splices: AT/AC | 30939 Number of splices: Non-canonical | 86940 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.04% Deletion average length | 2.94 Insertion rate per base | 0.03% Insertion average length | 2.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 765668 % of reads mapped to multiple loci | 2.27% Number of reads mapped to too many loci | 286098 % of reads mapped to too many loci | 0.85% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.58% % of reads unmapped: other | 0.27% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1248325 1248325 1248325 N_multimapping 765668 765668 765668 N_noFeature 1533387 31325964 1759511 N_ambiguous 377896 3215 180593 UnstrandedReadsAssigned:29835794 PositiveStrandReadsAssigned:417898 NegativeStrandReadsAssigned:29806973 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR28623313 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR28623313-trimmed-pair1.fastq SRR28623313-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 33,761,070 reads, 30,216,122 reads pseudoaligned [quant] estimated average fragment length: 223.436 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,070 rounds 52401 SRR28623313.ke.tsv 34699 SRR28623313.se.tsv 87100 total ==> SRR28623313.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1795.56 1388 24.7147 Potri.005G024800.1.v4.1 1035 812.564 1014 39.8977 Potri.004G059700.1.v4.1 961 738.581 417 18.0512 Potri.007G009000.2.v4.1 1416 1193.56 0 0 Potri.003G141000.2.v4.1 2943 2720.56 960.384 11.2863 Potri.016G087400.1.v4.1 270 96.4592 2320.38 769.101 Potri.015G069301.1.v4.1 564 346.708 0 0 Potri.010G195200.1.v4.1 1773 1550.56 58 1.19593 Potri.012G127500.1.v4.1 977 754.57 14360 608.446 ==> SRR28623313.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2139 Potri.001G233950.v4.1 8 Potri.001G122700.v4.1 660 Potri.001G212900.v4.1 6 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 31 Potri.001G452600.v4.1 25 SRR28623313 completed mapping pipeline successfully