Starting /dee2/code/volunteer_pipeline.sh SRR28623314 current disk space = 3048420003840 free memory = 1471798000 SRR28623314 SRAfilesize 1dbdd7fdcf2c3bd69f77c568ec324310 SRR28623314.sra SRR28623314.sra file validated SRR28623314 is paired end SRR28623314 is conventional basespace SRR28623314 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623314_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2865 37.0 37.0 37.0 37.0 37.0 2 36.5 37.0 37.0 37.0 37.0 37.0 3 36.512 37.0 37.0 37.0 37.0 37.0 4 36.6045 37.0 37.0 37.0 37.0 37.0 5 36.6655 37.0 37.0 37.0 37.0 37.0 6 36.5765 37.0 37.0 37.0 37.0 37.0 7 36.574 37.0 37.0 37.0 37.0 37.0 8 36.382 37.0 37.0 37.0 37.0 37.0 9 36.6025 37.0 37.0 37.0 37.0 37.0 10-14 36.5816 37.0 37.0 37.0 37.0 37.0 15-19 36.5718 37.0 37.0 37.0 37.0 37.0 20-24 36.485699999999994 37.0 37.0 37.0 37.0 37.0 25-29 36.4627 37.0 37.0 37.0 37.0 37.0 30-34 36.440400000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.3673 37.0 37.0 37.0 37.0 37.0 40-44 36.42229999999999 37.0 37.0 37.0 37.0 37.0 45-49 36.327299999999994 37.0 37.0 37.0 37.0 37.0 50-54 36.275600000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.26690000000001 37.0 37.0 37.0 37.0 37.0 60-64 36.236900000000006 37.0 37.0 37.0 37.0 37.0 65-69 36.2943 37.0 37.0 37.0 37.0 37.0 70-74 36.1896 37.0 37.0 37.0 37.0 37.0 75-79 36.1297 37.0 37.0 37.0 37.0 37.0 80-84 36.0845 37.0 37.0 37.0 37.0 37.0 85-89 36.0774 37.0 37.0 37.0 37.0 37.0 90-94 36.1117 37.0 37.0 37.0 37.0 37.0 95-99 35.927 37.0 37.0 37.0 37.0 37.0 100-104 36.021800000000006 37.0 37.0 37.0 37.0 37.0 105-109 36.0262 37.0 37.0 37.0 37.0 37.0 110-114 35.84910000000001 37.0 37.0 37.0 37.0 37.0 115-119 35.933499999999995 37.0 37.0 37.0 37.0 37.0 120-124 35.7818 37.0 37.0 37.0 37.0 37.0 125-129 35.715199999999996 37.0 37.0 37.0 37.0 37.0 130-134 35.842499999999994 37.0 37.0 37.0 37.0 37.0 135-139 35.6074 37.0 37.0 37.0 37.0 37.0 140-144 35.3834 37.0 37.0 37.0 34.6 37.0 145-149 35.2783 37.0 37.0 37.0 32.2 37.0 150-151 35.04575 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 1.0 22 0.0 23 1.0 24 2.0 25 2.0 26 5.0 27 15.0 28 13.0 29 26.0 30 34.0 31 45.0 32 54.0 33 80.0 34 147.0 35 395.0 36 2941.0 37 238.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.49522373051785 13.75062845651081 9.803921568627452 40.95022624434389 2 18.375 14.05 38.75 28.825 3 18.375 19.0 28.025 34.599999999999994 4 22.175 25.974999999999998 24.575 27.275 5 25.1 31.025000000000002 23.95 19.925 6 21.0 35.675000000000004 21.725 21.6 7 16.8 27.450000000000003 39.725 16.025 8 18.625 26.85 31.25 23.275000000000002 9 18.4 24.4 34.575 22.625 10-14 19.775000000000002 30.314999999999998 27.775 22.134999999999998 15-19 20.185 28.88 27.73 23.205000000000002 20-24 20.06 30.325000000000003 26.884999999999998 22.73 25-29 20.560000000000002 29.23 27.529999999999998 22.68 30-34 19.634999999999998 29.294999999999998 27.055 24.015 35-39 20.27 28.475 27.800000000000004 23.455000000000002 40-44 20.005 28.799999999999997 27.85 23.345 45-49 20.485 28.904999999999998 27.650000000000002 22.96 50-54 20.599999999999998 28.93 27.145000000000003 23.325000000000003 55-59 19.72 29.43 27.29 23.56 60-64 20.355 28.26 27.47 23.915 65-69 20.89 28.37 27.005000000000003 23.735 70-74 20.845 29.085 27.295 22.775000000000002 75-79 20.72 28.565 27.1 23.615 80-84 20.785 28.825 27.265 23.125 85-89 20.855 28.225 27.255000000000003 23.665 90-94 21.72 27.894999999999996 26.69 23.695 95-99 20.84 28.335 27.85 22.975 100-104 21.62 28.675 26.245 23.46 105-109 21.325 29.38 26.51 22.785 110-114 21.415 29.215000000000003 26.0 23.369999999999997 115-119 21.38 29.115000000000002 25.86 23.645 120-124 21.565 28.615000000000002 25.685000000000002 24.135 125-129 21.605 27.71 26.045 24.64 130-134 21.205 28.485 25.790000000000003 24.52 135-139 21.87 27.915 25.835 24.38 140-144 21.915000000000003 27.61 25.995 24.48 145-149 21.855 27.295 26.35 24.5 150-151 22.275 26.9125 25.9625 24.85 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.5 18 0.5 19 0.0 20 0.5 21 1.0 22 1.0 23 1.0 24 1.0 25 1.0 26 4.5 27 8.0 28 12.0 29 19.0 30 21.5 31 20.5 32 38.5 33 57.5 34 65.5 35 90.0 36 114.0 37 119.5 38 131.5 39 148.0 40 174.0 41 215.0 42 222.0 43 226.5 44 245.0 45 244.5 46 248.0 47 243.0 48 220.5 49 207.0 50 196.5 51 144.5 52 102.0 53 99.0 54 78.0 55 58.0 56 46.0 57 38.0 58 41.0 59 32.0 60 21.0 61 18.0 62 7.0 63 1.0 64 3.5 65 4.0 66 2.0 67 1.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.5499999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.125 #Duplication Level Percentage of deduplicated Percentage of total 1 83.69924812030075 69.575 2 13.142857142857142 21.85 3 2.4060150375939853 6.0 4 0.6616541353383459 2.1999999999999997 5 0.09022556390977443 0.375 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCGTCCTTTGGTGACTGACGTTTATATGCTCTTTTTCCAAAGGCCCAAGC 5 0.125 No Hit GCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAG 5 0.125 No Hit CACCCTTCGGCTTGGAGGCGATAAAACTGATGCACTGCACTTGACGAGTG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.0875 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1625 0.0 0.0 0.0 0.0 74-75 0.2 0.0 0.0 0.0 0.0 76-77 0.3125 0.0 0.0 0.0 0.0 78-79 0.3625 0.0 0.0 0.0 0.0 80-81 0.5 0.0 0.0 0.0 0.0 82-83 0.6625 0.0 0.0 0.0 0.0 84-85 0.8875 0.0 0.0 0.0 0.0 86-87 1.1375000000000002 0.0 0.0 0.0 0.0 88-89 1.375 0.0 0.0 0.0 0.0 90-91 1.725 0.0 0.0 0.0 0.0 92-93 2.125 0.0 0.0 0.0 0.0 94-95 2.45 0.0 0.0 0.0 0.0 96-97 2.75 0.0 0.0 0.0 0.0 98-99 3.125 0.0 0.0 0.0 0.0 100-101 3.6375 0.0 0.0 0.0 0.0 102-103 4.1 0.0 0.0 0.0 0.0 104-105 4.525 0.0 0.0 0.0 0.0 106-107 5.074999999999999 0.0 0.0 0.0 0.0 108-109 5.825 0.0 0.0 0.0 0.0 110-111 6.387499999999999 0.0 0.0 0.0 0.0 112-113 7.1875 0.0 0.0 0.0 0.0 114-115 7.825 0.0 0.0 0.0 0.0 116-117 8.575 0.0 0.0 0.0 0.0 118-119 9.225 0.0 0.0 0.0 0.0 120-121 10.05 0.0 0.0 0.0 0.0 122-123 10.9 0.0 0.0 0.0 0.0 124-125 11.875 0.0 0.0 0.0 0.0 126-127 12.75 0.0 0.0 0.0 0.0 128-129 13.587499999999999 0.0 0.0 0.0 0.0 130-131 14.25 0.0 0.0 0.0 0.0 132-133 15.1125 0.0 0.0 0.0 0.0 134-135 15.9375 0.0 0.0 0.0 0.0 136-137 16.775 0.0 0.0 0.0 0.0 138-139 17.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTCCAC 10 0.006830828 145.0 5 >>END_MODULE SRR28623314 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623314_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.9765 37.0 37.0 37.0 37.0 37.0 2 36.3155 37.0 37.0 37.0 37.0 37.0 3 36.2795 37.0 37.0 37.0 37.0 37.0 4 36.4315 37.0 37.0 37.0 37.0 37.0 5 36.434 37.0 37.0 37.0 37.0 37.0 6 36.2865 37.0 37.0 37.0 37.0 37.0 7 36.3505 37.0 37.0 37.0 37.0 37.0 8 36.1995 37.0 37.0 37.0 37.0 37.0 9 36.1715 37.0 37.0 37.0 37.0 37.0 10-14 36.1642 37.0 37.0 37.0 37.0 37.0 15-19 36.1154 37.0 37.0 37.0 37.0 37.0 20-24 36.0914 37.0 37.0 37.0 37.0 37.0 25-29 36.013099999999994 37.0 37.0 37.0 37.0 37.0 30-34 35.896100000000004 37.0 37.0 37.0 37.0 37.0 35-39 35.944 37.0 37.0 37.0 37.0 37.0 40-44 35.920100000000005 37.0 37.0 37.0 37.0 37.0 45-49 35.9077 37.0 37.0 37.0 37.0 37.0 50-54 35.882099999999994 37.0 37.0 37.0 37.0 37.0 55-59 35.75269999999999 37.0 37.0 37.0 37.0 37.0 60-64 35.6928 37.0 37.0 37.0 37.0 37.0 65-69 35.7861 37.0 37.0 37.0 37.0 37.0 70-74 35.809000000000005 37.0 37.0 37.0 37.0 37.0 75-79 35.7196 37.0 37.0 37.0 37.0 37.0 80-84 35.7136 37.0 37.0 37.0 37.0 37.0 85-89 35.6799 37.0 37.0 37.0 37.0 37.0 90-94 35.5499 37.0 37.0 37.0 37.0 37.0 95-99 35.6219 37.0 37.0 37.0 37.0 37.0 100-104 35.5092 37.0 37.0 37.0 37.0 37.0 105-109 35.489999999999995 37.0 37.0 37.0 37.0 37.0 110-114 35.504200000000004 37.0 37.0 37.0 37.0 37.0 115-119 35.3892 37.0 37.0 37.0 37.0 37.0 120-124 35.478899999999996 37.0 37.0 37.0 37.0 37.0 125-129 34.8992 37.0 37.0 37.0 27.4 37.0 130-134 35.1964 37.0 37.0 37.0 34.6 37.0 135-139 35.070800000000006 37.0 37.0 37.0 29.8 37.0 140-144 35.0824 37.0 37.0 37.0 27.4 37.0 145-149 35.0117 37.0 37.0 37.0 27.4 37.0 150-151 34.702 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 10.0 14 18.0 15 8.0 16 2.0 17 9.0 18 2.0 19 2.0 20 3.0 21 4.0 22 13.0 23 11.0 24 8.0 25 8.0 26 7.0 27 11.0 28 16.0 29 20.0 30 18.0 31 22.0 32 48.0 33 100.0 34 174.0 35 555.0 36 2609.0 37 320.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.800000000000004 20.775 12.575 26.85 2 27.025 27.025 27.450000000000003 18.5 3 24.325 27.750000000000004 29.2 18.725 4 25.650000000000002 34.300000000000004 21.7 18.35 5 26.424999999999997 34.625 21.15 17.8 6 22.375 36.475 22.275 18.875 7 21.55 22.25 37.25 18.95 8 22.375 25.15 27.775 24.7 9 23.9 24.3 28.499999999999996 23.3 10-14 24.099999999999998 28.860000000000003 25.540000000000003 21.5 15-19 24.025 27.38 27.32 21.275 20-24 23.665 28.1 27.155 21.08 25-29 24.25 27.83 26.435 21.485000000000003 30-34 23.955000000000002 27.72 27.825 20.5 35-39 23.265 27.72 27.644999999999996 21.37 40-44 23.544999999999998 27.994999999999997 27.435 21.025 45-49 23.669999999999998 28.13 27.07 21.13 50-54 23.51 28.139999999999997 26.965 21.385 55-59 23.27 27.83 27.66 21.240000000000002 60-64 23.215 27.61 27.779999999999998 21.395 65-69 23.5 28.060000000000002 27.500000000000004 20.94 70-74 23.505000000000003 27.74 27.665 21.09 75-79 22.89 27.655 28.615000000000002 20.84 80-84 23.025000000000002 28.275 27.6 21.099999999999998 85-89 23.055 28.515 27.145000000000003 21.285 90-94 23.57 28.175 27.51 20.745 95-99 23.765 28.175 27.105 20.955 100-104 24.09 27.485 27.794999999999998 20.630000000000003 105-109 24.395 28.355000000000004 26.945000000000004 20.305 110-114 23.97 28.744999999999997 26.57 20.715 115-119 24.68 28.134999999999998 27.55 19.634999999999998 120-124 25.41 27.925 26.61 20.055 125-129 25.119999999999997 28.83 26.66 19.39 130-134 25.965 28.505000000000003 26.455000000000002 19.075 135-139 26.765 27.735 26.305 19.195 140-144 25.61 27.955000000000002 26.884999999999998 19.55 145-149 26.43 27.445000000000004 26.56 19.564999999999998 150-151 26.687499999999996 27.987499999999997 26.474999999999998 18.85 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 1.0 8 2.0 9 1.5 10 2.0 11 2.5 12 1.0 13 0.5 14 0.5 15 1.0 16 0.5 17 0.0 18 0.0 19 2.0 20 2.5 21 0.5 22 0.5 23 1.0 24 2.0 25 3.0 26 4.5 27 5.0 28 6.0 29 11.5 30 15.0 31 18.5 32 22.5 33 33.0 34 52.5 35 71.5 36 86.0 37 105.5 38 130.5 39 146.0 40 171.5 41 201.0 42 231.0 43 261.0 44 258.0 45 243.5 46 252.0 47 246.5 48 213.0 49 190.5 50 173.0 51 159.0 52 139.5 53 106.0 54 84.0 55 76.0 56 59.0 57 42.0 58 35.0 59 29.5 60 28.0 61 17.0 62 5.0 63 6.0 64 8.0 65 4.5 66 1.0 67 0.5 68 0.5 69 0.5 70 0.5 71 0.5 72 1.0 73 0.5 74 0.0 75 0.0 76 0.5 77 1.0 78 1.0 79 2.0 80 2.0 81 1.0 82 1.0 83 1.0 84 0.5 85 0.0 86 0.0 87 0.5 88 0.5 89 0.5 90 0.5 91 0.0 92 0.0 93 0.5 94 1.0 95 0.5 96 0.5 97 1.0 98 0.5 99 1.0 100 3.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.275 #Duplication Level Percentage of deduplicated Percentage of total 1 84.35905133593515 70.25 2 12.518763134193936 20.849999999999998 3 2.281597117982588 5.7 4 0.6604623236265386 2.1999999999999997 5 0.09006304413089163 0.375 6 0.03002101471029721 0.15 7 0.03002101471029721 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.03002101471029721 0.3 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 12 0.3 No Hit ACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCC 7 0.17500000000000002 No Hit GAAAGGTTGGGTCTACCGCGAGCACCACCAGTCCCCAGGGTACTATGATG 6 0.15 No Hit GCAATAGCTAAGCCGCACCATCAGCTAAACAATGGCAGCAGCAACAATGG 5 0.125 No Hit CATCTCTCTCCTTCCCATGTAGCAACAGGAGTGACTATGTGTACTGGGAT 5 0.125 No Hit ATTGGATTCGACAACACTCGTCAAGTGCAGTGCATCAGTTTTATCGCCTC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.0875 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1625 0.0 0.0 0.0 0.0 74-75 0.2 0.0 0.0 0.0 0.0 76-77 0.3125 0.0 0.0 0.0 0.0 78-79 0.3625 0.0 0.0 0.0 0.0 80-81 0.5249999999999999 0.0 0.0 0.0 0.0 82-83 0.6625 0.0 0.0 0.0 0.0 84-85 0.8875 0.0 0.0 0.0 0.0 86-87 1.1375000000000002 0.0 0.0 0.0 0.0 88-89 1.3875000000000002 0.0 0.0 0.0 0.0 90-91 1.75 0.0 0.0 0.0 0.0 92-93 2.175 0.0 0.0 0.0 0.0 94-95 2.5 0.0 0.0 0.0 0.0 96-97 2.8 0.0 0.0 0.0 0.0 98-99 3.2 0.0 0.0 0.0 0.0 100-101 3.7125000000000004 0.0 0.0 0.0 0.0 102-103 4.175000000000001 0.0 0.0 0.0 0.0 104-105 4.612500000000001 0.0 0.0 0.0 0.0 106-107 5.175000000000001 0.0 0.0 0.0 0.0 108-109 5.9375 0.0 0.0 0.0 0.0 110-111 6.487500000000001 0.0 0.0 0.0 0.0 112-113 7.2875 0.0 0.0 0.0 0.0 114-115 7.9 0.0 0.0 0.0 0.0 116-117 8.675 0.0 0.0 0.0 0.0 118-119 9.375 0.0 0.0 0.0 0.0 120-121 10.225000000000001 0.0 0.0 0.0 0.0 122-123 11.1 0.0 0.0 0.0 0.0 124-125 12.075 0.0 0.0 0.0 0.0 126-127 12.95 0.0 0.0 0.0 0.0 128-129 13.8 0.0 0.0 0.0 0.0 130-131 14.45 0.0 0.0 0.0 0.0 132-133 15.3 0.0 0.0 0.0 0.0 134-135 16.0625 0.0 0.0 0.0 0.0 136-137 16.9125 0.0 0.0 0.0 0.0 138-139 18.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAAGATC 10 0.006830828 145.0 1 >>END_MODULE Read 2069460 spots for SRR28623314.sra Written 2069460 spots for SRR28623314.sra Read 2069460 spots for SRR28623314.sra Written 2069460 spots for SRR28623314.sra Read 2069460 spots for SRR28623314.sra Written 2069460 spots for SRR28623314.sra Read 2069461 spots for SRR28623314.sra Written 2069461 spots for SRR28623314.sra Read 2069460 spots for SRR28623314.sra Written 2069460 spots for SRR28623314.sra Read 2069460 spots for SRR28623314.sra Written 2069460 spots for SRR28623314.sra Read 2069460 spots for SRR28623314.sra Written 2069460 spots for SRR28623314.sra Read 2069460 spots for SRR28623314.sra Written 2069460 spots for SRR28623314.sra Read 2069460 spots for SRR28623314.sra Written 2069460 spots for SRR28623314.sra Read 2069460 spots for SRR28623314.sra Written 2069460 spots for SRR28623314.sra Read 2069460 spots for SRR28623314.sra Written 2069460 spots for SRR28623314.sra Read 2069460 spots for SRR28623314.sra Written 2069460 spots for SRR28623314.sra Read 2069460 spots for SRR28623314.sra Written 2069460 spots for SRR28623314.sra Read 2069460 spots for SRR28623314.sra Written 2069460 spots for SRR28623314.sra Read 2069460 spots for SRR28623314.sra Written 2069460 spots for SRR28623314.sra Read 2069460 spots for SRR28623314.sra Written 2069460 spots for SRR28623314.sra Read 2069460 spots for SRR28623314.sra Written 2069460 spots for SRR28623314.sra Read 2069460 spots for SRR28623314.sra Written 2069460 spots for SRR28623314.sra Read 2069460 spots for SRR28623314.sra Written 2069460 spots for SRR28623314.sra Read 2069460 spots for SRR28623314.sra Written 2069460 spots for SRR28623314.sra SRR ids: ['SRR28623314.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zz9oxhbd SRR28623314.sra spots: 41389201 blocks: [[1, 2069460], [2069461, 4138920], [4138921, 6208380], [6208381, 8277840], [8277841, 10347300], [10347301, 12416760], [12416761, 14486220], [14486221, 16555680], [16555681, 18625140], [18625141, 20694600], [20694601, 22764060], [22764061, 24833520], [24833521, 26902980], [26902981, 28972440], [28972441, 31041900], [31041901, 33111360], [33111361, 35180820], [35180821, 37250280], [37250281, 39319740], [39319741, 41389201]] SRR28623314 file size 15286402 SRR28623314 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR28623314 SRR28623314_1.fastq SRR28623314_2.fastq Input file: SRR28623314_1.fastq Paired file: SRR28623314_2.fastq trimmed: SRR28623314-trimmed-pair1.fastq, SRR28623314-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 17:05:47 2025 >> started Tue Feb 11 17:06:36 2025 >> done (49.280s) 41389201 read pairs processed; of these: 24 ( 0.00%) short read pairs filtered out after trimming by size control 26034 ( 0.06%) empty read pairs filtered out after trimming by size control 41363143 (99.94%) read pairs available; of these: 9592743 (23.19%) trimmed read pairs available after processing 31770400 (76.81%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 5 0.00% 20 5 0.00% 21 8 0.00% 22 8 0.00% 23 2 0.00% 24 10 0.00% 25 8 0.00% 26 8 0.00% 27 13 0.00% 28 24 0.00% 29 12 0.00% 30 9 0.00% 31 29 0.00% 32 24 0.00% 33 25 0.00% 34 29 0.00% 35 38 0.00% 36 41 0.00% 37 52 0.00% 38 62 0.00% 39 80 0.00% 40 89 0.00% 41 115 0.00% 42 128 0.00% 43 135 0.00% 44 144 0.00% 45 173 0.00% 46 233 0.00% 47 200 0.00% 48 320 0.00% 49 332 0.00% 50 482 0.00% 51 579 0.00% 52 583 0.00% 53 635 0.00% 54 817 0.00% 55 828 0.00% 56 948 0.00% 57 1103 0.00% 58 1323 0.00% 59 1555 0.00% 60 1773 0.00% 61 2270 0.01% 62 2384 0.01% 63 2822 0.01% 64 3328 0.01% 65 3634 0.01% 66 4231 0.01% 67 4800 0.01% 68 5365 0.01% 69 6032 0.01% 70 7325 0.02% 71 8062 0.02% 72 9364 0.02% 73 10810 0.03% 74 12467 0.03% 75 13855 0.03% 76 15589 0.04% 77 17064 0.04% 78 19049 0.05% 79 21866 0.05% 80 23395 0.06% 81 26174 0.06% 82 29955 0.07% 83 32654 0.08% 84 36075 0.09% 85 40299 0.10% 86 42634 0.10% 87 46560 0.11% 88 49715 0.12% 89 52682 0.13% 90 56099 0.14% 91 61356 0.15% 92 65490 0.16% 93 70511 0.17% 94 75043 0.18% 95 80063 0.19% 96 84582 0.20% 97 88409 0.21% 98 91718 0.22% 99 94228 0.23% 100 99031 0.24% 101 101489 0.25% 102 106255 0.26% 103 109938 0.27% 104 114010 0.28% 105 118673 0.29% 106 122483 0.30% 107 126314 0.31% 108 128151 0.31% 109 132322 0.32% 110 133130 0.32% 111 136959 0.33% 112 138946 0.34% 113 139946 0.34% 114 145211 0.35% 115 149546 0.36% 116 151421 0.37% 117 155893 0.38% 118 158092 0.38% 119 159085 0.38% 120 160479 0.39% 121 162627 0.39% 122 161943 0.39% 123 165188 0.40% 124 167874 0.41% 125 168075 0.41% 126 172711 0.42% 127 175814 0.43% 128 176530 0.43% 129 178843 0.43% 130 179451 0.43% 131 179811 0.43% 132 180909 0.44% 133 182343 0.44% 134 183011 0.44% 135 182547 0.44% 136 185342 0.45% 137 186265 0.45% 138 187121 0.45% 139 191456 0.46% 140 189553 0.46% 141 191029 0.46% 142 190230 0.46% 143 190015 0.46% 144 190971 0.46% 145 190109 0.46% 146 190445 0.46% 147 191434 0.46% 148 193843 0.47% 149 193939 0.47% 150 194991 0.47% 151 31770400 76.81% 41363143 reads passed initial QC criterion=sequence-density sequence-density=0.88 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=28 prefix-density=0.89 prefix-fanout=1.9 sequence=ATACGGATAAAGGAGTTAGGGTAAGCTTTCTTCGCCTCCTCGAGCTCAATCAGCACCTGAGATGCCTCAGTGCATCCAAACATGGGTAGTTTCCACATAGTCCAGTAGCGTCCATCATAGTACCCTGG criterion=fanout-score sequence-density=0.25 sequence-density-rank=21 fanout-score=19.19 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=19.2 sequence=GGATCGGAAGAGCACACGTCTGAACTCCAGTCACTACGCCTTATCTCGTATGCCGTCTTCTGCTTGAAAA criterion=sequence-density sequence-density=0.83 sequence-density-rank=1 fanout-score=2.86 fanout-score-rank=9 prefix-density=1.20 prefix-fanout=2.0 sequence=AACCGCACCCCGGCACA criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=12.42 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=3.7 sequence=AGCAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCC SRR28623314 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 17:07:20 Started mapping on | Feb 11 17:07:21 Finished on | Feb 11 17:11:37 Mapping speed, Million of reads per hour | 581.67 Number of input reads | 41363143 Average input read length | 288 UNIQUE READS: Uniquely mapped reads number | 38518772 Uniquely mapped reads % | 93.12% Average mapped length | 287.09 Number of splices: Total | 33386796 Number of splices: Annotated (sjdb) | 32712180 Number of splices: GT/AG | 32685160 Number of splices: GC/AG | 585159 Number of splices: AT/AC | 24907 Number of splices: Non-canonical | 91570 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.74 Insertion rate per base | 0.02% Insertion average length | 2.27 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 980098 % of reads mapped to multiple loci | 2.37% Number of reads mapped to too many loci | 202529 % of reads mapped to too many loci | 0.49% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.79% % of reads unmapped: other | 0.22% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1864273 1864273 1864273 N_multimapping 980098 980098 980098 N_noFeature 1239387 37995576 1450385 N_ambiguous 559426 2351 245591 UnstrandedReadsAssigned:36719959 PositiveStrandReadsAssigned:520845 NegativeStrandReadsAssigned:36822796 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=143 echo kmer=139 SRR28623314 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR28623314-trimmed-pair1.fastq SRR28623314-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 41,363,143 reads, 37,570,605 reads pseudoaligned [quant] estimated average fragment length: 206.4 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,159 rounds 52401 SRR28623314.ke.tsv 34699 SRR28623314.se.tsv 87100 total ==> SRR28623314.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1812.6 748 11.0077 Potri.005G024800.1.v4.1 1035 829.6 189 6.07701 Potri.004G059700.1.v4.1 961 755.61 104 3.67141 Potri.007G009000.2.v4.1 1416 1210.6 0 0 Potri.003G141000.2.v4.1 2943 2737.6 594 5.7878 Potri.016G087400.1.v4.1 270 103.065 1650.85 427.26 Potri.015G069301.1.v4.1 564 362.193 0 0 Potri.010G195200.1.v4.1 1773 1567.6 1 0.0170162 Potri.012G127500.1.v4.1 977 771.61 3105 107.34 ==> SRR28623314.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 49 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 446 Potri.001G212900.v4.1 53 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR28623314 completed mapping pipeline successfully