Starting /dee2/code/volunteer_pipeline.sh SRR28623315 current disk space = 3053199237120 free memory = 1579093648 SRR28623315 SRAfilesize e0ae120fa6c0eb7621bee81cc6503fec SRR28623315.sra SRR28623315.sra file validated SRR28623315 is paired end SRR28623315 is conventional basespace SRR28623315 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623315_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4565 37.0 37.0 37.0 37.0 37.0 2 36.4985 37.0 37.0 37.0 37.0 37.0 3 36.595 37.0 37.0 37.0 37.0 37.0 4 36.628 37.0 37.0 37.0 37.0 37.0 5 36.63 37.0 37.0 37.0 37.0 37.0 6 36.6035 37.0 37.0 37.0 37.0 37.0 7 36.606 37.0 37.0 37.0 37.0 37.0 8 36.526 37.0 37.0 37.0 37.0 37.0 9 36.6445 37.0 37.0 37.0 37.0 37.0 10-14 36.580799999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.5736 37.0 37.0 37.0 37.0 37.0 20-24 36.5176 37.0 37.0 37.0 37.0 37.0 25-29 36.480999999999995 37.0 37.0 37.0 37.0 37.0 30-34 36.4462 37.0 37.0 37.0 37.0 37.0 35-39 36.4369 37.0 37.0 37.0 37.0 37.0 40-44 36.421099999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.3935 37.0 37.0 37.0 37.0 37.0 50-54 36.321400000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.315 37.0 37.0 37.0 37.0 37.0 60-64 36.3125 37.0 37.0 37.0 37.0 37.0 65-69 36.3004 37.0 37.0 37.0 37.0 37.0 70-74 36.206399999999995 37.0 37.0 37.0 37.0 37.0 75-79 36.17100000000001 37.0 37.0 37.0 37.0 37.0 80-84 36.0948 37.0 37.0 37.0 37.0 37.0 85-89 36.1439 37.0 37.0 37.0 37.0 37.0 90-94 36.1192 37.0 37.0 37.0 37.0 37.0 95-99 36.0423 37.0 37.0 37.0 37.0 37.0 100-104 36.0585 37.0 37.0 37.0 37.0 37.0 105-109 36.0168 37.0 37.0 37.0 37.0 37.0 110-114 35.9765 37.0 37.0 37.0 37.0 37.0 115-119 35.962 37.0 37.0 37.0 37.0 37.0 120-124 35.8186 37.0 37.0 37.0 37.0 37.0 125-129 35.645700000000005 37.0 37.0 37.0 37.0 37.0 130-134 35.8408 37.0 37.0 37.0 37.0 37.0 135-139 35.6614 37.0 37.0 37.0 37.0 37.0 140-144 35.4143 37.0 37.0 37.0 37.0 37.0 145-149 35.3065 37.0 37.0 37.0 34.6 37.0 150-151 35.23075 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 2.0 22 1.0 23 1.0 24 3.0 25 2.0 26 6.0 27 7.0 28 7.0 29 24.0 30 38.0 31 40.0 32 44.0 33 86.0 34 153.0 35 383.0 36 2918.0 37 285.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.03258145363409 12.606516290726816 10.977443609022556 43.38345864661654 2 18.15 15.825 35.949999999999996 30.075000000000003 3 17.625 18.425 28.999999999999996 34.949999999999996 4 22.5 26.3 24.6 26.6 5 24.675 30.675 25.374999999999996 19.275000000000002 6 20.075000000000003 35.825 23.925 20.175 7 16.05 28.549999999999997 39.225 16.175 8 18.3 28.325 30.225 23.150000000000002 9 17.599999999999998 25.825 33.975 22.6 10-14 19.139999999999997 30.725 27.705000000000002 22.43 15-19 19.52 28.88 28.48 23.119999999999997 20-24 20.235 28.915000000000003 27.955000000000002 22.895 25-29 19.48 28.82 28.04 23.66 30-34 19.314999999999998 28.395 28.095 24.195 35-39 20.115 28.199999999999996 27.765 23.919999999999998 40-44 19.545 29.330000000000002 27.665 23.46 45-49 19.775000000000002 29.575000000000003 27.255000000000003 23.395 50-54 20.549999999999997 29.2 27.145000000000003 23.105 55-59 19.97 28.865000000000002 27.700000000000003 23.465 60-64 19.905 28.93 27.185 23.98 65-69 19.919999999999998 29.275000000000002 27.779999999999998 23.025000000000002 70-74 19.89 29.14 27.36 23.61 75-79 20.0 28.38 27.534999999999997 24.085 80-84 20.16 28.205000000000002 28.18 23.455000000000002 85-89 20.365 29.294999999999998 26.57 23.77 90-94 20.45 28.244999999999997 27.944999999999997 23.36 95-99 20.080000000000002 28.51 27.975 23.435 100-104 20.105 28.68 27.595 23.62 105-109 20.655 28.244999999999997 27.735 23.365 110-114 20.419999999999998 28.99 27.005000000000003 23.585 115-119 21.42 28.444999999999997 26.93 23.205000000000002 120-124 20.965 28.449999999999996 26.905 23.68 125-129 20.405 28.92 27.015 23.66 130-134 20.830000000000002 28.689999999999998 26.474999999999998 24.005000000000003 135-139 20.915 28.360000000000003 26.815 23.91 140-144 21.48 28.4 25.945 24.175 145-149 21.27 27.93 26.755000000000003 24.044999999999998 150-151 22.5125 27.187499999999996 26.174999999999997 24.125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 1.5 20 1.5 21 0.5 22 2.0 23 5.0 24 6.5 25 6.5 26 10.5 27 11.5 28 12.5 29 23.5 30 23.0 31 35.0 32 62.5 33 64.0 34 63.0 35 82.0 36 95.0 37 118.5 38 137.0 39 149.5 40 192.5 41 213.0 42 231.0 43 240.0 44 237.5 45 246.0 46 243.5 47 227.5 48 223.5 49 194.0 50 158.5 51 141.0 52 111.5 53 98.5 54 82.5 55 63.5 56 54.5 57 42.0 58 23.5 59 16.5 60 12.0 61 7.5 62 7.5 63 7.5 64 4.5 65 2.0 66 1.5 67 1.5 68 0.5 69 1.0 70 1.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.25 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.3 #Duplication Level Percentage of deduplicated Percentage of total 1 86.10785463071512 73.45 2 11.04923798358734 18.85 3 2.4618991793669402 6.3 4 0.2637749120750293 0.8999999999999999 5 0.11723329425556857 0.5 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCTTTTCCTGTTATTGCCTCTCCCAACAACGATGCAGCAAATCCAATCAT 5 0.125 No Hit AAGAAAGACACAGAAACCTTGTTATATACCAAGTGCAACTTAGTATGACC 5 0.125 No Hit CCCAGTAGAACACAGTTTCACATAGTAAATATTGGTATTATAAACATTAT 5 0.125 No Hit CCAGAATTCGAGCAGCAGAGAGAGCACCGCGAGCTGCGGAGGCAGCAAGT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1875 0.0 0.0 0.0 0.0 78-79 0.2375 0.0 0.0 0.0 0.0 80-81 0.36250000000000004 0.0 0.0 0.0 0.0 82-83 0.4875 0.0 0.0 0.0 0.0 84-85 0.5625 0.0 0.0 0.0 0.0 86-87 0.7250000000000001 0.0 0.0 0.0 0.0 88-89 0.9125 0.0 0.0 0.0 0.0 90-91 1.0875 0.0 0.0 0.0 0.0 92-93 1.2625 0.0 0.0 0.0 0.0 94-95 1.5375 0.0 0.0 0.0 0.0 96-97 1.8125 0.0 0.0 0.0 0.0 98-99 2.1500000000000004 0.0 0.0 0.0 0.0 100-101 2.7 0.0 0.0 0.0 0.0 102-103 2.9875 0.0 0.0 0.0 0.0 104-105 3.3625 0.0 0.0 0.0 0.0 106-107 3.7625 0.0 0.0 0.0 0.0 108-109 4.199999999999999 0.0 0.0 0.0 0.0 110-111 4.625 0.0 0.0 0.0 0.0 112-113 5.1875 0.0 0.0 0.0 0.0 114-115 5.85 0.0 0.0 0.0 0.0 116-117 6.4 0.0 0.0 0.0 0.0 118-119 6.887499999999999 0.0 0.0 0.0 0.0 120-121 7.3625 0.0 0.0 0.0 0.0 122-123 7.7875 0.0 0.0 0.0 0.0 124-125 8.2625 0.0 0.0 0.0 0.0 126-127 9.0 0.0 0.0 0.0 0.0 128-129 9.5625 0.0 0.0 0.0 0.0 130-131 10.475000000000001 0.0 0.0 0.0 0.0 132-133 11.399999999999999 0.0 0.0 0.0 0.0 134-135 12.275 0.0 0.0 0.0 0.0 136-137 13.125 0.0 0.0 0.0 0.0 138-139 14.2125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR28623315 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28623315_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.9655 37.0 37.0 37.0 37.0 37.0 2 36.273 37.0 37.0 37.0 37.0 37.0 3 36.2885 37.0 37.0 37.0 37.0 37.0 4 36.201 37.0 37.0 37.0 37.0 37.0 5 36.3775 37.0 37.0 37.0 37.0 37.0 6 36.201 37.0 37.0 37.0 37.0 37.0 7 36.229 37.0 37.0 37.0 37.0 37.0 8 36.167 37.0 37.0 37.0 37.0 37.0 9 36.209 37.0 37.0 37.0 37.0 37.0 10-14 36.1723 37.0 37.0 37.0 37.0 37.0 15-19 36.1709 37.0 37.0 37.0 37.0 37.0 20-24 36.0904 37.0 37.0 37.0 37.0 37.0 25-29 36.0219 37.0 37.0 37.0 37.0 37.0 30-34 35.974000000000004 37.0 37.0 37.0 37.0 37.0 35-39 35.9923 37.0 37.0 37.0 37.0 37.0 40-44 35.9799 37.0 37.0 37.0 37.0 37.0 45-49 35.8906 37.0 37.0 37.0 37.0 37.0 50-54 35.918699999999994 37.0 37.0 37.0 37.0 37.0 55-59 35.8349 37.0 37.0 37.0 37.0 37.0 60-64 35.8089 37.0 37.0 37.0 37.0 37.0 65-69 35.841100000000004 37.0 37.0 37.0 37.0 37.0 70-74 35.8255 37.0 37.0 37.0 37.0 37.0 75-79 35.813300000000005 37.0 37.0 37.0 37.0 37.0 80-84 35.743399999999994 37.0 37.0 37.0 37.0 37.0 85-89 35.6862 37.0 37.0 37.0 37.0 37.0 90-94 35.5754 37.0 37.0 37.0 37.0 37.0 95-99 35.6448 37.0 37.0 37.0 37.0 37.0 100-104 35.635000000000005 37.0 37.0 37.0 37.0 37.0 105-109 35.4945 37.0 37.0 37.0 37.0 37.0 110-114 35.582 37.0 37.0 37.0 37.0 37.0 115-119 35.4366 37.0 37.0 37.0 37.0 37.0 120-124 35.521100000000004 37.0 37.0 37.0 37.0 37.0 125-129 35.143 37.0 37.0 37.0 29.8 37.0 130-134 35.313700000000004 37.0 37.0 37.0 37.0 37.0 135-139 35.1243 37.0 37.0 37.0 27.4 37.0 140-144 35.2571 37.0 37.0 37.0 34.6 37.0 145-149 35.2032 37.0 37.0 37.0 29.8 37.0 150-151 34.74725 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 6.0 14 8.0 15 10.0 16 6.0 17 5.0 18 6.0 19 2.0 20 4.0 21 11.0 22 9.0 23 9.0 24 9.0 25 5.0 26 8.0 27 8.0 28 13.0 29 18.0 30 26.0 31 36.0 32 49.0 33 94.0 34 158.0 35 532.0 36 2669.0 37 298.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.875 20.150000000000002 14.124999999999998 24.85 2 28.675 26.200000000000003 28.849999999999998 16.275000000000002 3 21.95 28.299999999999997 31.1 18.65 4 25.15 33.4 22.35 19.1 5 24.325 36.85 23.325000000000003 15.5 6 21.5 39.175 22.75 16.575 7 21.475 22.3 36.425000000000004 19.8 8 22.325 24.525 28.725 24.425 9 22.575 24.4 31.474999999999998 21.55 10-14 24.93 29.005 25.755 20.31 15-19 24.185000000000002 28.134999999999998 27.295 20.385 20-24 23.665 28.439999999999998 27.815 20.080000000000002 25-29 23.995 28.505000000000003 26.855 20.645 30-34 23.205000000000002 28.38 27.625 20.79 35-39 22.775000000000002 28.360000000000003 28.305000000000003 20.560000000000002 40-44 23.765 28.549999999999997 28.43 19.255 45-49 23.775 28.265 27.735 20.225 50-54 23.745 28.294999999999998 27.265 20.695 55-59 22.825 29.015 27.825 20.335 60-64 22.745 29.04 28.105000000000004 20.11 65-69 23.669999999999998 28.189999999999998 28.025 20.115 70-74 23.549999999999997 28.38 27.48 20.59 75-79 23.25 28.32 27.634999999999998 20.794999999999998 80-84 23.505000000000003 28.84 27.884999999999998 19.77 85-89 23.445 28.660000000000004 28.060000000000002 19.835 90-94 23.59 28.810000000000002 27.465 20.135 95-99 23.810000000000002 29.025000000000002 26.945000000000004 20.22 100-104 23.76 28.860000000000003 26.919999999999998 20.46 105-109 24.895 29.255 26.755000000000003 19.095000000000002 110-114 24.695 28.810000000000002 27.065 19.43 115-119 24.26 28.875 27.515 19.35 120-124 25.4 28.725 26.889999999999997 18.985 125-129 25.025 28.535 26.845000000000002 19.595000000000002 130-134 25.82 28.87 26.369999999999997 18.94 135-139 26.025 28.389999999999997 26.619999999999997 18.965 140-144 25.945 28.46 26.445 19.15 145-149 26.195 29.07 25.77 18.965 150-151 26.424999999999997 27.5125 27.5875 18.475 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 1.0 3 1.5 4 0.5 5 0.0 6 0.0 7 0.0 8 1.0 9 1.5 10 1.5 11 2.0 12 2.0 13 1.5 14 1.0 15 0.5 16 0.5 17 1.5 18 1.5 19 3.0 20 4.5 21 2.5 22 1.0 23 1.5 24 2.5 25 5.0 26 6.0 27 6.0 28 10.5 29 21.0 30 24.0 31 24.5 32 31.5 33 35.5 34 57.5 35 87.5 36 98.0 37 109.5 38 132.0 39 167.0 40 170.5 41 197.0 42 262.5 43 280.0 44 293.0 45 273.5 46 241.0 47 238.0 48 205.0 49 178.5 50 151.0 51 117.5 52 112.5 53 94.0 54 74.0 55 66.0 56 54.5 57 39.5 58 25.0 59 16.0 60 10.0 61 10.0 62 9.5 63 4.0 64 2.0 65 2.0 66 1.0 67 2.0 68 2.0 69 1.0 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 1.0 83 1.0 84 0.5 85 0.5 86 0.0 87 1.5 88 1.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.5 94 1.0 95 0.5 96 0.0 97 0.5 98 0.5 99 0.5 100 4.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.925 #Duplication Level Percentage of deduplicated Percentage of total 1 86.93628164096596 74.7 2 10.328775094559209 17.75 3 2.4439918533604885 6.3 4 0.14547570555717193 0.5 5 0.11638056444573756 0.5 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02909514111143439 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 10 0.25 No Hit AATCTTCTCTCTGTCTTCTTGATTCCTTGTTTTTCGTTCTGTTTATTACA 5 0.125 No Hit CGATGGCTCAAACCATGGTGCTCATGTCTGGTGTCTCTACGAGGCAAGTG 5 0.125 No Hit AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 5 0.125 No Hit TACATTCCTCACTCTTAGAGGCAGGTGATTCTTCACATGTCTTCGAGCCC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1875 0.0 0.0 0.0 0.0 78-79 0.2375 0.0 0.0 0.0 0.0 80-81 0.36250000000000004 0.0 0.0 0.0 0.0 82-83 0.4875 0.0 0.0 0.0 0.0 84-85 0.5625 0.0 0.0 0.0 0.0 86-87 0.7250000000000001 0.0 0.0 0.0 0.0 88-89 0.9125 0.0 0.0 0.0 0.0 90-91 1.0875 0.0 0.0 0.0 0.0 92-93 1.2625 0.0 0.0 0.0 0.0 94-95 1.5375 0.0 0.0 0.0 0.0 96-97 1.7875 0.0 0.0 0.0 0.0 98-99 2.1500000000000004 0.0 0.0 0.0 0.0 100-101 2.725 0.0 0.0 0.0 0.0 102-103 3.0125 0.0 0.0 0.0 0.0 104-105 3.4 0.0 0.0 0.0 0.0 106-107 3.7875 0.0 0.0 0.0 0.0 108-109 4.175000000000001 0.0 0.0 0.0 0.0 110-111 4.6 0.0 0.0 0.0 0.0 112-113 5.15 0.0 0.0 0.0 0.0 114-115 5.800000000000001 0.0 0.0 0.0 0.0 116-117 6.362500000000001 0.0 0.0 0.0 0.0 118-119 6.8375 0.0 0.0 0.0 0.0 120-121 7.3 0.0 0.0 0.0 0.0 122-123 7.7375 0.0 0.0 0.0 0.0 124-125 8.2 0.0 0.0 0.0 0.0 126-127 8.9 0.0 0.0 0.0 0.0 128-129 9.475 0.0 0.0 0.0 0.0 130-131 10.375 0.0 0.0 0.0 0.0 132-133 11.3 0.0 0.0 0.0 0.0 134-135 12.225 0.0 0.0 0.0 0.0 136-137 13.075 0.0 0.0 0.0 0.0 138-139 14.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCAACC 10 0.006830828 145.0 2 TCATTGA 10 0.006830828 145.0 3 >>END_MODULE Read 1418337 spots for SRR28623315.sra Written 1418337 spots for SRR28623315.sra Read 1418337 spots for SRR28623315.sra Written 1418337 spots for SRR28623315.sra Read 1418337 spots for SRR28623315.sra Written 1418337 spots for SRR28623315.sra Read 1418337 spots for SRR28623315.sra Written 1418337 spots for SRR28623315.sra Read 1418337 spots for SRR28623315.sra Written 1418337 spots for SRR28623315.sra Read 1418337 spots for SRR28623315.sra Written 1418337 spots for SRR28623315.sra Read 1418337 spots for SRR28623315.sra Written 1418337 spots for SRR28623315.sra Read 1418337 spots for SRR28623315.sra Written 1418337 spots for SRR28623315.sra Read 1418337 spots for SRR28623315.sra Written 1418337 spots for SRR28623315.sra Read 1418337 spots for SRR28623315.sra Written 1418337 spots for SRR28623315.sra Read 1418337 spots for SRR28623315.sra Written 1418337 spots for SRR28623315.sra Read 1418337 spots for SRR28623315.sra Written 1418337 spots for SRR28623315.sra Read 1418337 spots for SRR28623315.sra Written 1418337 spots for SRR28623315.sra Read 1418337 spots for SRR28623315.sra Written 1418337 spots for SRR28623315.sra Read 1418337 spots for SRR28623315.sra Written 1418337 spots for SRR28623315.sra Read 1418337 spots for SRR28623315.sra Written 1418337 spots for SRR28623315.sra Read 1418337 spots for SRR28623315.sra Written 1418337 spots for SRR28623315.sra Read 1418337 spots for SRR28623315.sra Written 1418337 spots for SRR28623315.sra Read 1418337 spots for SRR28623315.sra Written 1418337 spots for SRR28623315.sra Read 1418337 spots for SRR28623315.sra Written 1418337 spots for SRR28623315.sra SRR ids: ['SRR28623315.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3gryir62 SRR28623315.sra spots: 28366740 blocks: [[1, 1418337], [1418338, 2836674], [2836675, 4255011], [4255012, 5673348], [5673349, 7091685], [7091686, 8510022], [8510023, 9928359], [9928360, 11346696], [11346697, 12765033], [12765034, 14183370], [14183371, 15601707], [15601708, 17020044], [17020045, 18438381], [18438382, 19856718], [19856719, 21275055], [21275056, 22693392], [22693393, 24111729], [24111730, 25530066], [25530067, 26948403], [26948404, 28366740]] SRR28623315 file size 10473356 SRR28623315 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR28623315 SRR28623315_1.fastq SRR28623315_2.fastq Input file: SRR28623315_1.fastq Paired file: SRR28623315_2.fastq trimmed: SRR28623315-trimmed-pair1.fastq, SRR28623315-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 19:56:15 2025 >> started Tue Feb 11 19:56:50 2025 >> done (35.478s) 28366740 read pairs processed; of these: 16 ( 0.00%) short read pairs filtered out after trimming by size control 29872 ( 0.11%) empty read pairs filtered out after trimming by size control 28336852 (99.89%) read pairs available; of these: 5265630 (18.58%) trimmed read pairs available after processing 23071222 (81.42%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 3 0.00% 20 1 0.00% 21 4 0.00% 22 2 0.00% 23 1 0.00% 24 6 0.00% 25 6 0.00% 26 5 0.00% 27 6 0.00% 28 11 0.00% 29 8 0.00% 30 12 0.00% 31 8 0.00% 32 16 0.00% 33 12 0.00% 34 19 0.00% 35 22 0.00% 36 22 0.00% 37 29 0.00% 38 27 0.00% 39 39 0.00% 40 30 0.00% 41 54 0.00% 42 59 0.00% 43 76 0.00% 44 65 0.00% 45 104 0.00% 46 102 0.00% 47 115 0.00% 48 119 0.00% 49 156 0.00% 50 203 0.00% 51 238 0.00% 52 236 0.00% 53 303 0.00% 54 318 0.00% 55 404 0.00% 56 382 0.00% 57 484 0.00% 58 567 0.00% 59 637 0.00% 60 771 0.00% 61 884 0.00% 62 1062 0.00% 63 1201 0.00% 64 1451 0.01% 65 1579 0.01% 66 1792 0.01% 67 1965 0.01% 68 2277 0.01% 69 2734 0.01% 70 3042 0.01% 71 3495 0.01% 72 4052 0.01% 73 4786 0.02% 74 5334 0.02% 75 6056 0.02% 76 6643 0.02% 77 7314 0.03% 78 8307 0.03% 79 9207 0.03% 80 10373 0.04% 81 11681 0.04% 82 12886 0.05% 83 14464 0.05% 84 16324 0.06% 85 17722 0.06% 86 19797 0.07% 87 20573 0.07% 88 22825 0.08% 89 23656 0.08% 90 25850 0.09% 91 28371 0.10% 92 29835 0.11% 93 33164 0.12% 94 34853 0.12% 95 37217 0.13% 96 39492 0.14% 97 41524 0.15% 98 43530 0.15% 99 45360 0.16% 100 46982 0.17% 101 48253 0.17% 102 51317 0.18% 103 53039 0.19% 104 55848 0.20% 105 58928 0.21% 106 61055 0.22% 107 63228 0.22% 108 64402 0.23% 109 66945 0.24% 110 68072 0.24% 111 69926 0.25% 112 72452 0.26% 113 72969 0.26% 114 75774 0.27% 115 78487 0.28% 116 80322 0.28% 117 83029 0.29% 118 85181 0.30% 119 85874 0.30% 120 87822 0.31% 121 88515 0.31% 122 89661 0.32% 123 91902 0.32% 124 93282 0.33% 125 94427 0.33% 126 97167 0.34% 127 98685 0.35% 128 100073 0.35% 129 102184 0.36% 130 103106 0.36% 131 103588 0.37% 132 104325 0.37% 133 105659 0.37% 134 105330 0.37% 135 106985 0.38% 136 108835 0.38% 137 110080 0.39% 138 111450 0.39% 139 113832 0.40% 140 113451 0.40% 141 115185 0.41% 142 115572 0.41% 143 115626 0.41% 144 117596 0.41% 145 117296 0.41% 146 117984 0.42% 147 119321 0.42% 148 120896 0.43% 149 121998 0.43% 150 123353 0.44% 151 23071222 81.42% 28336852 reads passed initial QC criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=2.05 fanout-score-rank=31 prefix-density=0.30 prefix-fanout=2.0 sequence=TACGTGCTTAAT criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=55.39 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=8.5 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGCCAGGTTCTCCAGTGGTCCCTTTCCGGTCACAATGGCCTGGACAAAGAATCCGAACATTGAGAACATAGCCAA criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=3.36 fanout-score-rank=22 prefix-density=0.37 prefix-fanout=3.2 sequence=TGCAAGTGCGGCAG criterion=fanout-score sequence-density=0.06 sequence-density-rank=36 fanout-score=38.94 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=9.7 sequence=AAGGCCAAGATCCAGGACAAGGA SRR28623315 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 19:57:33 Started mapping on | Feb 11 19:57:35 Finished on | Feb 11 20:00:33 Mapping speed, Million of reads per hour | 573.10 Number of input reads | 28336852 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 26582752 Uniquely mapped reads % | 93.81% Average mapped length | 290.44 Number of splices: Total | 25096209 Number of splices: Annotated (sjdb) | 24504436 Number of splices: GT/AG | 24596296 Number of splices: GC/AG | 393190 Number of splices: AT/AC | 21307 Number of splices: Non-canonical | 85416 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.65 Insertion rate per base | 0.02% Insertion average length | 2.30 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 697171 % of reads mapped to multiple loci | 2.46% Number of reads mapped to too many loci | 84751 % of reads mapped to too many loci | 0.30% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.22% % of reads unmapped: other | 0.21% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1056929 1056929 1056929 N_multimapping 697171 697171 697171 N_noFeature 1161960 25998984 1372190 N_ambiguous 531898 2048 157161 UnstrandedReadsAssigned:24888894 PositiveStrandReadsAssigned:581720 NegativeStrandReadsAssigned:25053401 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR28623315 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR28623315-trimmed-pair1.fastq SRR28623315-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 28,336,852 reads, 25,258,394 reads pseudoaligned [quant] estimated average fragment length: 219.879 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,065 rounds 52401 SRR28623315.ke.tsv 34699 SRR28623315.se.tsv 87100 total ==> SRR28623315.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1799.12 1980.22 35.0768 Potri.005G024800.1.v4.1 1035 816.121 1320 51.545 Potri.004G059700.1.v4.1 961 742.141 144 6.18363 Potri.007G009000.2.v4.1 1416 1197.12 0 0 Potri.003G141000.2.v4.1 2943 2724.12 1669.09 19.5263 Potri.016G087400.1.v4.1 270 96.734 1620.64 533.918 Potri.015G069301.1.v4.1 564 349.888 0 0 Potri.010G195200.1.v4.1 1773 1554.12 131 2.68629 Potri.012G127500.1.v4.1 977 758.141 73 3.0686 ==> SRR28623315.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 200 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 465 Potri.001G212900.v4.1 103 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 28 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 12 SRR28623315 completed mapping pipeline successfully