Starting /dee2/code/volunteer_pipeline.sh SRR2962391 current disk space = 3058879811584 free memory = 1379829340 SRR2962391 SRAfilesize ad2ed9473bc45966b5501c2fcafeebe9 SRR2962391.sra SRR2962391.sra file validated SRR2962391 is single end SRR2962391 is conventional basespace SRR2962391 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR2962391_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 39 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.809 31.0 31.0 34.0 30.0 34.0 2 32.32725 34.0 31.0 34.0 30.0 34.0 3 32.4495 34.0 31.0 34.0 30.0 34.0 4 36.04875 37.0 35.0 37.0 35.0 37.0 5 36.00275 37.0 35.0 37.0 35.0 37.0 6 35.88675 37.0 35.0 37.0 33.0 37.0 7 35.62125 37.0 35.0 37.0 33.0 37.0 8 35.828 37.0 35.0 37.0 35.0 37.0 9 37.573 39.0 37.0 39.0 35.0 39.0 10-11 37.421625 39.0 37.0 39.0 34.5 39.0 12-13 37.4105 39.0 37.0 39.0 34.0 39.0 14-15 38.483875 40.0 38.0 41.0 33.0 41.0 16-17 38.655625 40.0 38.0 41.0 34.0 41.0 18-19 38.394875 40.0 38.0 41.0 33.5 41.0 20-21 38.486875 40.0 38.0 41.0 33.5 41.0 22-23 38.19775 39.5 37.5 40.5 33.5 41.0 24-25 37.398250000000004 40.0 37.5 41.0 32.0 41.0 26-27 33.03875 39.0 34.0 41.0 2.0 41.0 28-29 32.75925 39.0 34.0 41.0 2.0 41.0 30-31 30.552125 38.5 20.5 41.0 2.0 41.0 32-33 26.421 37.5 2.0 40.0 2.0 41.0 34-35 29.796999999999997 37.0 16.0 40.0 8.5 41.0 36-37 33.499625 38.0 31.0 40.0 20.0 41.0 38-39 35.36175 38.0 35.0 40.0 29.0 41.0 40-41 31.77075 38.0 31.0 40.0 7.0 41.0 42-43 33.92575 38.0 32.0 40.0 18.5 41.0 44-45 35.105374999999995 38.0 34.5 40.0 27.0 41.0 46-47 35.1095 38.0 35.0 40.0 26.5 41.0 48-49 34.72225 38.0 34.5 40.0 25.0 41.0 50-51 34.41074999999999 38.0 34.0 40.0 23.5 41.0 52-53 33.60275 38.0 33.0 40.0 17.0 41.0 54-55 32.192375 37.5 31.5 40.0 2.0 41.0 56-57 31.174750000000003 37.0 30.0 40.0 2.0 41.0 58-59 30.744999999999997 37.0 29.0 40.0 2.0 41.0 60-61 30.228375 36.0 28.0 39.5 2.0 41.0 62-63 29.607125 36.0 27.5 39.0 2.0 41.0 64-65 26.3585 34.5 7.0 39.0 2.0 40.0 66-67 24.319875000000003 33.5 2.0 38.0 2.0 40.0 68-69 23.420625 32.0 2.0 37.0 2.0 40.0 70-71 22.750999999999998 31.5 2.0 36.5 2.0 39.0 72-73 21.98575 30.5 2.0 36.0 2.0 39.0 74-75 21.5475 30.0 2.0 35.5 2.0 38.5 76-77 19.881625 27.5 2.0 34.0 2.0 36.5 78-79 20.417875000000002 29.0 2.0 35.0 2.0 37.0 80-81 20.509875 29.0 2.0 35.0 2.0 36.5 82-83 20.639375 29.5 2.0 35.0 2.0 36.0 84-85 20.44375 29.5 2.0 35.0 2.0 36.0 86-87 19.689 28.0 2.0 34.0 2.0 35.0 88-89 19.24475 26.5 2.0 34.0 2.0 35.0 90-91 18.421750000000003 24.5 2.0 34.0 2.0 35.0 92-93 15.67275 2.0 2.0 33.5 2.0 35.0 94-95 14.765125000000001 2.0 2.0 33.0 2.0 35.0 96-97 14.794875000000001 2.0 2.0 32.5 2.0 35.0 98-99 14.910125 2.0 2.0 32.0 2.0 35.0 100-101 14.209375 2.0 2.0 32.0 2.0 34.5 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 2.0 8 10.0 9 20.0 10 22.0 11 45.0 12 26.0 13 37.0 14 22.0 15 58.0 16 90.0 17 91.0 18 135.0 19 227.0 20 262.0 21 140.0 22 93.0 23 101.0 24 87.0 25 51.0 26 58.0 27 81.0 28 105.0 29 123.0 30 134.0 31 120.0 32 160.0 33 195.0 34 179.0 35 224.0 36 354.0 37 403.0 38 313.0 39 31.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 11.85 45.300000000000004 26.575 16.275000000000002 2 16.8 46.2 22.95 14.05 3 39.475 22.05 22.6 15.875 4 15.425 22.975 23.125 38.475 5 17.424999999999997 45.574999999999996 22.75 14.249999999999998 6 40.45 22.475 21.575 15.5 7 16.729182295573892 21.48037009252313 46.51162790697674 15.27881970492623 8 40.550000000000004 21.5 23.075000000000003 14.875 9 39.675 20.724999999999998 23.5 16.1 10-11 16.0625 34.2625 34.2125 15.462500000000002 12-13 15.6375 22.787499999999998 34.5625 27.0125 14-15 15.775 46.2 22.05 15.975 16-17 28.1 22.5625 21.875 27.462500000000002 18-19 15.9 34.5875 21.45 28.0625 20-21 27.8625 33.7375 22.325 16.075 22-23 28.4375 21.987499999999997 34.6875 14.887500000000001 24-25 16.247459349593495 33.549288617886184 22.840447154471544 27.36280487804878 26-27 15.70853693590112 27.148605921241735 41.075021557918944 16.0678355849382 28-29 26.769496900677524 21.796165489404643 35.577338907308636 15.856998702609197 30-31 25.147744945567652 23.203732503888023 35.31881804043546 16.329704510108865 32-33 18.868593722291184 26.38765738606136 37.32931370810427 17.41443518354318 34-35 18.856073767205668 24.82961379126019 38.23332887879193 18.080983562742215 36-37 17.275 25.637500000000003 38.987500000000004 18.099999999999998 38-39 18.65 25.887500000000003 37.512499999999996 17.95 40-41 17.57466814159292 24.79258849557522 39.0625 18.57024336283186 42-43 18.212500000000002 25.75 38.987500000000004 17.05 44-45 18.7375 25.162499999999998 38.4625 17.6375 46-47 18.05 25.924999999999997 38.8125 17.2125 48-49 17.6375 25.224999999999998 38.487500000000004 18.65 50-51 17.299999999999997 25.5 38.25 18.95 52-53 18.5 26.075 37.1875 18.2375 54-55 19.1875 27.175 34.9125 18.725 56-57 20.0875 29.375 31.175000000000004 19.3625 58-59 19.900000000000002 31.2625 29.599999999999998 19.2375 60-61 19.5 31.1 29.775000000000002 19.625 62-63 18.850200400801604 31.938877755511026 29.584168336673343 19.626753507014026 64-65 19.162686147794325 29.79769598201742 31.55380724922731 19.485810620960944 66-67 19.48585336172802 29.190751445086704 30.833586857316703 20.489808335868574 68-69 19.476701455240335 30.06026752903131 30.956930765838603 19.506100249889755 70-71 19.785681006367447 29.43003571983227 30.532691411709894 20.251591862090386 72-73 18.301974809516405 29.886487327009796 31.348157362774064 20.463380500699735 74-75 19.1097829506134 29.773513683548288 31.9754639823844 19.141239383453918 76-77 18.927973199329983 30.201005025125628 31.959798994974875 18.911222780569513 78-79 18.6769787724206 30.146453842356426 31.627447753825898 19.549119631397073 80-81 18.479796552698502 30.26278609776773 31.831025713478382 19.42639163605538 82-83 19.237023139462163 30.906816760475298 31.05691056910569 18.79924953095685 84-85 19.1 30.1875 31.1875 19.525000000000002 86-87 18.525 30.9875 31.087500000000002 19.400000000000002 88-89 18.925 31.2125 30.275000000000002 19.5875 90-91 19.044828596542633 30.413126281863462 30.413126281863462 20.128918839730442 92-93 18.54641310487667 32.10318207493881 30.352099416305776 18.998305403878742 94-95 19.599400973418195 31.317858479970052 30.08236615499813 19.00037439161363 96-97 18.900030385900944 31.327863871163782 29.367973260407172 20.404132482528105 98-99 19.225361114661897 30.21858622012016 29.31100600792535 21.245046657292598 100-101 19.07680760570428 30.910683012259195 30.26019514635977 19.752314235676756 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 8.0 1 4.5 2 0.5 3 0.0 4 1.5 5 3.0 6 3.5 7 3.0 8 5.0 9 4.0 10 3.5 11 7.0 12 36.0 13 41.5 14 20.0 15 25.0 16 28.0 17 24.0 18 32.0 19 43.0 20 43.0 21 50.5 22 56.5 23 69.5 24 80.0 25 85.0 26 86.5 27 84.5 28 90.5 29 95.0 30 94.0 31 84.0 32 84.5 33 93.0 34 98.0 35 99.5 36 110.5 37 124.5 38 133.0 39 152.5 40 156.0 41 151.0 42 164.0 43 166.5 44 169.0 45 176.0 46 160.0 47 137.0 48 120.0 49 102.0 50 85.0 51 69.0 52 62.0 53 52.0 54 32.0 55 21.5 56 19.0 57 15.0 58 10.0 59 9.0 60 8.0 61 4.0 62 1.0 63 2.0 64 2.5 65 1.0 66 0.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.025 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 1.6 26-27 13.025 28-29 13.2875 30-31 19.625 32-33 29.512500000000003 34-35 6.4625 36-37 0.0 38-39 0.0 40-41 9.6 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.2 64-65 11.025 66-67 17.825 68-69 14.9625 70-71 19.5125 72-73 19.6125 74-75 20.525 76-77 25.374999999999996 78-79 24.0375 80-81 11.525 82-83 0.0625 84-85 0.0 86-87 0.0 88-89 0.0 90-91 14.674999999999999 92-93 33.6125 94-95 33.225 96-97 17.724999999999998 98-99 2.2125 100-101 0.075 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 88.125 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29078014184397 87.5 2 0.3120567375886525 0.5499999999999999 3 0.05673758865248227 0.15 4 0.05673758865248227 0.2 5 0.0 0.0 6 0.028368794326241134 0.15 7 0.028368794326241134 0.17500000000000002 8 0.028368794326241134 0.2 9 0.028368794326241134 0.22499999999999998 >10 0.14184397163120568 3.025 >50 0.0 0.0 >100 0.028368794326241134 7.825 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source AAGCAGTGGTATCAACGCAGAGTACTTTTTTTTTTTTTTTTTTTTTTTTT 313 7.825 No Hit AAGCAGTGGTATCAACGCAGAGTACTTTTTNNNTTTTTTTTTTTTTTTTT 34 0.8500000000000001 No Hit AAGCAGTGGTATCAACGCAGAGTACNNNNNNNNNTTTTTNTTTTTTTTTT 33 0.8250000000000001 No Hit AAGCAGTGGTATCAACGCAGAGTACTTTTTTNNTTTTTTTTTTTTTTTTT 21 0.525 No Hit AAGCAGTGGTATCAACGCAGAGTANNNNNNNNNNTTTTTNNTTTTTTTTT 20 0.5 No Hit AAGCAGTGGTATCAACGCAGAGTACNNNNNNNNNTTTTTNNTTTTTTTTT 13 0.325 No Hit AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 9 0.22499999999999998 No Hit AAGCAGTGGTATCAACGCAGAGTACTTTTNNNNTTTTTTTTTTTTTTTTT 8 0.2 No Hit AAGCAGTGGTATCAACGCAGAGTACTTTTTTNTTTTTTTTTTTTTTTTTT 7 0.17500000000000002 No Hit AAGCAGTGGTATCAACGCAGAGTACNNTNNNNNNTTTTTNTTTTTTTTTT 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content fail #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGTGGTA 85 0.0 80.4125 5 GTATCAA 90 0.0 80.4125 9 GCAGTGG 85 0.0 80.4125 3 CAGTGGT 85 0.0 80.4125 4 GGTATCA 90 0.0 80.4125 8 AAGCAGT 85 0.0 80.4125 1 AGCAGTG 90 0.0 75.94514 2 GTGGTAT 90 0.0 75.94514 6 TGGTATC 95 0.0 71.94802 7 ATGGGGA 20 1.0914558E-4 64.33 26-27 ACATGGG 40 1.8098945E-9 50.653545 24-25 ACTTTTT 30 8.150673E-7 50.653545 24-25 CATGGGG 20 3.634505E-4 50.653545 24-25 TACATGG 40 4.129106E-9 46.28058 22-23 AGTACAT 45 2.6375346E-10 45.30282 20-21 GTACATG 50 5.984475E-10 41.652515 22-23 GAGTACA 50 7.4396667E-10 40.772533 20-21 CAGAGTA 90 0.0 40.715187 18-19 AGAGTAC 90 0.0 40.715187 18-19 GTACTTT 40 2.282759E-7 40.495506 22-23 >>END_MODULE Read 5180690 spots for SRR2962391.sra Written 5180690 spots for SRR2962391.sra Read 5180690 spots for SRR2962391.sra Written 5180690 spots for SRR2962391.sra Read 5180690 spots for SRR2962391.sra Written 5180690 spots for SRR2962391.sra Read 5180690 spots for SRR2962391.sra Written 5180690 spots for SRR2962391.sra Read 5180690 spots for SRR2962391.sra Written 5180690 spots for SRR2962391.sra Read 5180690 spots for SRR2962391.sra Written 5180690 spots for SRR2962391.sra Read 5180690 spots for SRR2962391.sra Written 5180690 spots for SRR2962391.sra Read 5180690 spots for SRR2962391.sra Written 5180690 spots for SRR2962391.sra Read 5180690 spots for SRR2962391.sra Written 5180690 spots for SRR2962391.sra Read 5180690 spots for SRR2962391.sra Written 5180690 spots for SRR2962391.sra Read 5180690 spots for SRR2962391.sra Written 5180690 spots for SRR2962391.sra Read 5180690 spots for SRR2962391.sra Written 5180690 spots for SRR2962391.sra Read 5180690 spots for SRR2962391.sra Written 5180690 spots for SRR2962391.sra Read 5180690 spots for SRR2962391.sra Written 5180690 spots for SRR2962391.sra Read 5180690 spots for SRR2962391.sra Written 5180690 spots for SRR2962391.sra Read 5180707 spots for SRR2962391.sra Written 5180707 spots for SRR2962391.sra Read 5180690 spots for SRR2962391.sra Written 5180690 spots for SRR2962391.sra Read 5180690 spots for SRR2962391.sra Written 5180690 spots for SRR2962391.sra Read 5180690 spots for SRR2962391.sra Written 5180690 spots for SRR2962391.sra Read 5180690 spots for SRR2962391.sra Written 5180690 spots for SRR2962391.sra SRR ids: ['SRR2962391.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_m1tej00p SRR2962391.sra spots: 103613817 blocks: [[1, 5180690], [5180691, 10361380], [10361381, 15542070], [15542071, 20722760], [20722761, 25903450], [25903451, 31084140], [31084141, 36264830], [36264831, 41445520], [41445521, 46626210], [46626211, 51806900], [51806901, 56987590], [56987591, 62168280], [62168281, 67348970], [67348971, 72529660], [72529661, 77710350], [77710351, 82891040], [82891041, 88071730], [88071731, 93252420], [93252421, 98433110], [98433111, 103613817]] SRR2962391 file size 27517799 SRR2962391 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR2962391 SRR2962391_1.fastq Input file: SRR2962391_1.fastq trimmed: SRR2962391-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 12:03:19 2025 >> started Mon Feb 10 12:04:12 2025 >> done (52.911s) 103613817 reads processed; of these: 20672 ( 0.02%) short reads filtered out after trimming by size control 184559 ( 0.18%) empty reads filtered out after trimming by size control 103408586 (99.80%) reads available; of these: 40378673 (39.05%) trimmed reads available after processing 63029913 (60.95%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 5637 0.01% 19 6766 0.01% 20 9049 0.01% 21 12282 0.01% 22 20937 0.02% 23 22884 0.02% 24 38967 0.04% 25 97447 0.09% 26 39305 0.04% 27 904941 0.88% 28 128285 0.12% 29 82755 0.08% 30 181319 0.18% 31 192825 0.19% 32 181575 0.18% 33 173419 0.17% 34 137974 0.13% 35 140839 0.14% 36 160018 0.15% 37 140414 0.14% 38 126116 0.12% 39 141232 0.14% 40 162843 0.16% 41 243200 0.24% 42 144070 0.14% 43 149950 0.15% 44 162529 0.16% 45 187232 0.18% 46 233903 0.23% 47 268862 0.26% 48 351405 0.34% 49 520882 0.50% 50 697769 0.67% 51 1053348 1.02% 52 1489998 1.44% 53 1791216 1.73% 54 1843294 1.78% 55 1194706 1.16% 56 642859 0.62% 57 409445 0.40% 58 347938 0.34% 59 349875 0.34% 60 375559 0.36% 61 388565 0.38% 62 399871 0.39% 63 390228 0.38% 64 371478 0.36% 65 339090 0.33% 66 338340 0.33% 67 326626 0.32% 68 310490 0.30% 69 313976 0.30% 70 316381 0.31% 71 327760 0.32% 72 335831 0.32% 73 331684 0.32% 74 325285 0.31% 75 319981 0.31% 76 226869 0.22% 77 257671 0.25% 78 305049 0.29% 79 347470 0.34% 80 376500 0.36% 81 398972 0.39% 82 431325 0.42% 83 468953 0.45% 84 493058 0.48% 85 545434 0.53% 86 605898 0.59% 87 687399 0.66% 88 807476 0.78% 89 800939 0.77% 90 796009 0.77% 91 810731 0.78% 92 881060 0.85% 93 1020241 0.99% 94 1050100 1.02% 95 1104064 1.07% 96 1276578 1.23% 97 1424004 1.38% 98 1480848 1.43% 99 1437499 1.39% 100 1643071 1.59% 101 63029913 60.95% 103408586 reads passed initial QC criterion=sequence-density sequence-density=4.14 sequence-density-rank=1 fanout-score=2.46 fanout-score-rank=44 prefix-density=10.18 prefix-fanout=1.0 sequence=AGTACATGGGGA criterion=fanout-score sequence-density=0.17 sequence-density-rank=40 fanout-score=60.33 fanout-score-rank=1 prefix-density=10.18 prefix-fanout=1.0 sequence=AGTACATGGGCT Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 0 (0.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 1 (100.00%) aligned >1 times 100.00% overall alignment rate Potential adapter found in reference sequence. Continuing without clipping. Started job on | Feb 10 12:06:17 Started mapping on | Feb 10 12:06:19 Finished on | Feb 10 12:11:45 Mapping speed, Million of reads per hour | 1141.94 Number of input reads | 103408586 Average input read length | 81 UNIQUE READS: Uniquely mapped reads number | 81239999 Uniquely mapped reads % | 78.56% Average mapped length | 83.76 Number of splices: Total | 16880929 Number of splices: Annotated (sjdb) | 15957542 Number of splices: GT/AG | 16363646 Number of splices: GC/AG | 228495 Number of splices: AT/AC | 19541 Number of splices: Non-canonical | 269247 Mismatch rate per base, % | 0.63% Deletion rate per base | 0.03% Deletion average length | 2.06 Insertion rate per base | 0.02% Insertion average length | 1.88 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 12866256 % of reads mapped to multiple loci | 12.44% Number of reads mapped to too many loci | 1630994 % of reads mapped to too many loci | 1.58% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.32% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 9302331 9302331 9302331 N_multimapping 12866256 12866256 12866256 N_noFeature 8734146 41381427 48181314 N_ambiguous 663296 150542 103333 UnstrandedReadsAssigned:71842557 PositiveStrandReadsAssigned:39708030 NegativeStrandReadsAssigned:32955352 Dataset is classified unstranded MeadianReadLen=93 20thPercentileLength=62 echo kmer=57 SRR2962391 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR2962391-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 103,408,586 reads, 76,822,224 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,181 rounds 52401 SRR2962391.ke.tsv 34699 SRR2962391.se.tsv 87100 total ==> SRR2962391.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 4084 31.5358 Potri.005G024800.1.v4.1 1035 936 575.05 9.1038 Potri.004G059700.1.v4.1 961 862 1610 27.6765 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 2858.61 14.8942 Potri.016G087400.1.v4.1 270 171 3352.44 290.508 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 566.724 5.01659 Potri.012G127500.1.v4.1 977 878 8067 136.148 ==> SRR2962391.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 72 Potri.001G233950.v4.1 6 Potri.001G122700.v4.1 5309 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 7 Potri.001G256600.v4.1 1 Potri.001G040500.v4.1 5 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 3793 SRR2962391 completed mapping pipeline successfully