Starting /dee2/code/volunteer_pipeline.sh SRR3207685 current disk space = 3058909474816 free memory = 1433285244 SRR3207685 SRAfilesize a2729bbc67abf632ac6ce8620346a086 SRR3207685.sra SRR3207685.sra file validated SRR3207685 is single end SRR3207685 is conventional basespace SRR3207685 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207685_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.794 38.0 36.0 39.0 33.0 40.0 2 36.53675 38.0 35.0 39.0 31.0 40.0 3 36.37025 38.0 35.0 39.0 30.0 40.0 4 36.21075 38.0 35.0 39.0 30.0 40.0 5 36.329 38.0 35.0 39.0 30.0 40.0 6 36.5135 38.0 36.0 39.0 31.0 40.0 7 36.4225 38.0 35.0 39.0 31.0 40.0 8 36.48075 38.0 35.0 39.0 31.0 40.0 9 36.29875 38.0 35.0 39.0 30.0 40.0 10 36.34275 38.0 35.0 39.0 30.0 40.0 11 36.587 38.0 35.0 39.0 31.0 40.0 12 36.39825 38.0 35.0 39.0 31.0 40.0 13 36.25675 38.0 35.0 39.0 30.0 40.0 14 36.306 38.0 35.0 39.0 31.0 40.0 15 36.052 38.0 35.0 39.0 30.0 40.0 16 36.23325 38.0 35.0 39.0 31.0 40.0 17 35.90425 38.0 35.0 39.0 29.0 40.0 18 35.916 38.0 35.0 39.0 29.0 40.0 19 35.83575 38.0 35.0 39.0 29.0 40.0 20 35.91375 38.0 35.0 39.0 30.0 40.0 21 35.90175 38.0 35.0 39.0 30.0 40.0 22 36.12225 38.0 35.0 39.0 30.0 40.0 23 35.7075 38.0 35.0 39.0 29.0 40.0 24 35.9085 38.0 35.0 39.0 30.0 40.0 25 35.8205 38.0 35.0 39.0 30.0 40.0 26 35.623 38.0 35.0 39.0 29.0 40.0 27 35.253 38.0 34.0 39.0 28.0 40.0 28 35.271 38.0 34.0 39.0 29.0 40.0 29 34.98625 38.0 33.0 39.0 27.0 40.0 30 34.95025 38.0 33.0 39.0 27.0 40.0 31 34.804 38.0 33.0 39.0 27.0 40.0 32 34.407 38.0 33.0 39.0 26.0 40.0 33 34.55075 38.0 33.0 39.0 27.0 40.0 34 34.0885 37.0 33.0 39.0 25.0 40.0 35 34.351 38.0 33.0 39.0 26.0 40.0 36 34.479 38.0 33.0 39.0 26.0 40.0 37 33.965 37.0 33.0 39.0 25.0 40.0 38 34.3285 37.0 33.0 39.0 26.0 40.0 39 34.11275 37.0 33.0 39.0 26.0 40.0 40 33.808 36.0 32.0 39.0 25.0 40.0 41 33.92375 37.0 33.0 39.0 25.0 40.0 42 33.95475 37.0 33.0 39.0 26.0 40.0 43 34.03125 37.0 33.0 39.0 26.0 40.0 44 33.53225 36.0 32.0 39.0 23.0 40.0 45 33.9455 37.0 33.0 39.0 26.0 40.0 46 33.752 37.0 33.0 39.0 25.0 40.0 47 33.40275 36.0 32.0 39.0 23.0 40.0 48 33.31675 36.0 32.0 39.0 24.0 40.0 49 33.25775 36.0 32.0 39.0 24.0 40.0 50 33.20125 36.0 32.0 39.0 23.0 40.0 51 33.1265 36.0 32.0 39.0 23.0 40.0 52 33.0325 36.0 32.0 39.0 23.0 40.0 53 32.70725 36.0 32.0 39.0 22.0 40.0 54 32.3395 36.0 31.0 38.0 22.0 40.0 55 32.18275 36.0 31.0 38.0 20.0 40.0 56 32.098 36.0 31.0 38.0 19.0 39.0 57 31.49625 35.0 30.0 38.0 17.0 39.0 58 31.56275 35.0 30.0 38.0 18.0 39.0 59 31.034 35.0 29.0 38.0 14.0 39.0 60 30.9765 35.0 30.0 38.0 12.0 39.0 61 30.72125 35.0 29.0 38.0 2.0 39.0 62 30.43375 35.0 29.0 38.0 2.0 39.0 63 30.07575 35.0 29.0 38.0 2.0 39.0 64 29.952 34.0 29.0 38.0 2.0 39.0 65 29.74125 34.0 29.0 38.0 2.0 39.0 66 29.4905 34.0 29.0 38.0 2.0 39.0 67 29.2965 34.0 27.0 38.0 2.0 39.0 68 29.17875 34.0 28.0 37.0 2.0 39.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 23.0 3 2.0 4 1.0 5 2.0 6 2.0 7 3.0 8 5.0 9 6.0 10 9.0 11 11.0 12 10.0 13 20.0 14 8.0 15 12.0 16 13.0 17 14.0 18 11.0 19 20.0 20 16.0 21 23.0 22 31.0 23 34.0 24 38.0 25 43.0 26 51.0 27 72.0 28 84.0 29 79.0 30 117.0 31 134.0 32 173.0 33 219.0 34 282.0 35 364.0 36 444.0 37 589.0 38 644.0 39 391.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.544303797468356 16.379746835443036 16.075949367088608 44.0 2 18.099999999999998 24.95 40.550000000000004 16.400000000000002 3 22.2 28.749999999999996 27.275 21.775 4 25.35 34.975 20.8 18.875 5 24.025 35.925000000000004 23.05 17.0 6 17.474999999999998 38.65 24.575 19.3 7 16.400000000000002 17.675 45.675 20.25 8 19.425 22.325 30.15 28.1 9 19.775000000000002 21.95 32.65 25.624999999999996 10 19.675 39.95 23.125 17.25 11 24.5 28.599999999999998 21.75 25.15 12 21.125 24.7 29.075 25.1 13 19.475 28.825 31.424999999999997 20.275000000000002 14 20.474999999999998 28.299999999999997 30.325000000000003 20.9 15 20.325 27.875 29.425 22.375 16 21.475 26.924999999999997 29.75 21.85 17 21.15 28.499999999999996 28.675 21.675 18 21.349999999999998 28.225 27.0 23.425 19 21.75 29.575000000000003 28.050000000000004 20.625 20 21.65 29.425 27.250000000000004 21.675 21 22.05 29.425 26.525 22.0 22 21.325 29.375 27.325 21.975 23 22.175 29.45 28.199999999999996 20.175 24 21.125 29.875 27.675 21.325 25 22.1 28.725 28.050000000000004 21.125 26 21.5 29.25 27.150000000000002 22.1 27 21.2 29.375 27.950000000000003 21.475 28 22.15 28.875 28.050000000000004 20.925 29 21.675 28.775000000000002 28.075 21.475 30 21.3 28.425 28.000000000000004 22.275 31 21.725 30.075000000000003 27.775 20.424999999999997 32 21.625 28.375 28.675 21.325 33 21.175 29.099999999999998 27.474999999999998 22.25 34 21.0 28.975 28.525 21.5 35 21.85 27.700000000000003 28.075 22.375 36 21.025 28.4 28.799999999999997 21.775 37 20.9 28.375 29.575000000000003 21.15 38 21.55 28.575 27.500000000000004 22.375 39 20.95 28.175 28.275 22.6 40 21.525 28.749999999999996 28.375 21.349999999999998 41 21.275 29.75 27.825 21.15 42 22.525000000000002 27.474999999999998 28.499999999999996 21.5 43 22.425 28.499999999999996 28.000000000000004 21.075 44 22.15 28.95 27.375 21.525 45 21.025 29.049999999999997 28.775000000000002 21.15 46 23.225 28.025 27.575 21.175 47 21.975 30.4 27.025 20.599999999999998 48 21.175 28.825 27.3 22.7 49 21.325 29.175 28.249999999999996 21.25 50 22.125 28.525 28.625 20.724999999999998 51 21.55 28.999999999999996 27.925 21.525 52 21.6 28.875 29.099999999999998 20.424999999999997 53 20.925 28.675 28.875 21.525 54 21.175 28.625 27.450000000000003 22.75 55 21.725 29.725 26.950000000000003 21.6 56 21.9 28.499999999999996 28.025 21.575 57 23.45 27.975 26.650000000000002 21.925 58 21.825 28.349999999999998 28.549999999999997 21.275 59 22.0 28.525 27.750000000000004 21.725 60 21.55 29.299999999999997 28.000000000000004 21.15 61 21.3 28.925 28.925 20.849999999999998 62 20.9 28.425 28.375 22.3 63 20.8 28.925 27.950000000000003 22.325 64 21.625 30.8 26.375 21.2 65 22.275 29.099999999999998 27.650000000000002 20.974999999999998 66 22.525000000000002 27.700000000000003 28.499999999999996 21.275 67 21.95 28.999999999999996 27.425 21.625 68 22.8 28.249999999999996 27.800000000000004 21.15 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.0 19 0.0 20 2.5 21 5.0 22 5.0 23 9.0 24 11.0 25 9.0 26 13.5 27 28.5 28 39.0 29 47.0 30 57.5 31 60.0 32 77.0 33 105.0 34 116.0 35 138.5 36 189.5 37 218.0 38 245.5 39 260.0 40 293.5 41 340.0 42 342.5 43 350.5 44 356.0 45 354.0 46 337.5 47 323.0 48 288.5 49 219.5 50 185.0 51 170.5 52 135.5 53 115.0 54 91.0 55 67.5 56 68.0 57 54.5 58 34.0 59 27.0 60 21.0 61 12.5 62 10.0 63 7.5 64 5.5 65 4.0 66 2.0 67 4.0 68 4.5 69 3.0 70 1.5 71 1.0 72 2.0 73 2.0 74 2.5 75 3.0 76 1.5 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.5 84 1.0 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.25 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.05 0.0 0.0 0.0 0.0 56 0.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 297637 spots for SRR3207685.sra Written 297637 spots for SRR3207685.sra Read 297637 spots for SRR3207685.sra Written 297637 spots for SRR3207685.sra Read 297637 spots for SRR3207685.sra Written 297637 spots for SRR3207685.sra Read 297637 spots for SRR3207685.sra Written 297637 spots for SRR3207685.sra Read 297637 spots for SRR3207685.sra Written 297637 spots for SRR3207685.sra Read 297637 spots for SRR3207685.sra Written 297637 spots for SRR3207685.sra Read 297637 spots for SRR3207685.sra Written 297637 spots for SRR3207685.sra Read 297637 spots for SRR3207685.sra Written 297637 spots for SRR3207685.sra Read 297637 spots for SRR3207685.sra Written 297637 spots for SRR3207685.sra Read 297637 spots for SRR3207685.sra Written 297637 spots for SRR3207685.sra Read 297637 spots for SRR3207685.sra Written 297637 spots for SRR3207685.sra Read 297637 spots for SRR3207685.sra Written 297637 spots for SRR3207685.sra Read 297637 spots for SRR3207685.sra Written 297637 spots for SRR3207685.sra Read 297637 spots for SRR3207685.sra Written 297637 spots for SRR3207685.sra Read 297637 spots for SRR3207685.sra Written 297637 spots for SRR3207685.sra Read 297637 spots for SRR3207685.sra Written 297637 spots for SRR3207685.sra Read 297648 spots for SRR3207685.sra Written 297648 spots for SRR3207685.sra Read 297637 spots for SRR3207685.sra Written 297637 spots for SRR3207685.sra Read 297637 spots for SRR3207685.sra Written 297637 spots for SRR3207685.sra Read 297637 spots for SRR3207685.sra Written 297637 spots for SRR3207685.sra SRR ids: ['SRR3207685.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_exk9a_1d SRR3207685.sra spots: 5952751 blocks: [[1, 297637], [297638, 595274], [595275, 892911], [892912, 1190548], [1190549, 1488185], [1488186, 1785822], [1785823, 2083459], [2083460, 2381096], [2381097, 2678733], [2678734, 2976370], [2976371, 3274007], [3274008, 3571644], [3571645, 3869281], [3869282, 4166918], [4166919, 4464555], [4464556, 4762192], [4762193, 5059829], [5059830, 5357466], [5357467, 5655103], [5655104, 5952751]] SRR3207685 file size 1249793 SRR3207685 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207685 SRR3207685_1.fastq Input file: SRR3207685_1.fastq trimmed: SRR3207685-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 13:19:46 2025 >> started Mon Feb 10 13:19:49 2025 >> done (2.921s) 5952751 reads processed; of these: 14314 ( 0.24%) short reads filtered out after trimming by size control 6752 ( 0.11%) empty reads filtered out after trimming by size control 5931685 (99.65%) reads available; of these: 486640 ( 8.20%) trimmed reads available after processing 5445045 (91.80%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1479 0.02% 19 2262 0.04% 20 3351 0.06% 21 1115 0.02% 22 1653 0.03% 23 2655 0.04% 24 4276 0.07% 25 7064 0.12% 26 1984 0.03% 27 2569 0.04% 28 3514 0.06% 29 5627 0.09% 30 8511 0.14% 31 2145 0.04% 32 2759 0.05% 33 3880 0.07% 34 5500 0.09% 35 8274 0.14% 36 2130 0.04% 37 2781 0.05% 38 3670 0.06% 39 5626 0.09% 40 8577 0.14% 41 2083 0.04% 42 3133 0.05% 43 4598 0.08% 44 7071 0.12% 45 10962 0.18% 46 2766 0.05% 47 4181 0.07% 48 6349 0.11% 49 10482 0.18% 50 16753 0.28% 51 4345 0.07% 52 6535 0.11% 53 9922 0.17% 54 16237 0.27% 55 29708 0.50% 56 6403 0.11% 57 9178 0.15% 58 13683 0.23% 59 23694 0.40% 60 43770 0.74% 61 8701 0.15% 62 12512 0.21% 63 19472 0.33% 64 34308 0.58% 65 56294 0.95% 66 12218 0.21% 67 19880 0.34% 68 5445045 91.80% 5931685 reads passed initial QC criterion=sequence-density sequence-density=0.03 sequence-density-rank=1 fanout-score=124.80 fanout-score-rank=6 prefix-density=0.23 prefix-fanout=18.0 sequence=AAGAAGAAGAAA criterion=fanout-score sequence-density=0.03 sequence-density-rank=13 fanout-score=185.13 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=20.4 sequence=TTCTTCTTCTTC Started job on | Feb 10 13:20:05 Started mapping on | Feb 10 13:20:05 Finished on | Feb 10 13:20:12 Mapping speed, Million of reads per hour | 3050.58 Number of input reads | 5931685 Average input read length | 66 UNIQUE READS: Uniquely mapped reads number | 5569666 Uniquely mapped reads % | 93.90% Average mapped length | 66.71 Number of splices: Total | 1008323 Number of splices: Annotated (sjdb) | 990350 Number of splices: GT/AG | 992326 Number of splices: GC/AG | 13148 Number of splices: AT/AC | 1237 Number of splices: Non-canonical | 1612 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.01% Deletion average length | 1.74 Insertion rate per base | 0.01% Insertion average length | 1.33 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 201061 % of reads mapped to multiple loci | 3.39% Number of reads mapped to too many loci | 131180 % of reads mapped to too many loci | 2.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.50% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 160958 160958 160958 N_multimapping 201061 201061 201061 N_noFeature 330584 2909800 2956551 N_ambiguous 52457 9307 9317 UnstrandedReadsAssigned:5186625 PositiveStrandReadsAssigned:2650559 NegativeStrandReadsAssigned:2603798 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR3207685 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207685-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 5,931,685 reads, 5,392,914 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,070 rounds 52401 SRR3207685.ke.tsv 34699 SRR3207685.se.tsv 87100 total ==> SRR3207685.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 227 32.1424 Potri.005G024800.1.v4.1 1035 936 101 29.3206 Potri.004G059700.1.v4.1 961 862 7 2.20657 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 103.651 9.90314 Potri.016G087400.1.v4.1 270 171 205 325.751 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 39 6.33049 Potri.012G127500.1.v4.1 977 878 1138 352.189 ==> SRR3207685.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 718 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 104 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 7 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR3207685 completed mapping pipeline successfully