Starting /dee2/code/volunteer_pipeline.sh SRR3207686 current disk space = 3059064803328 free memory = 1299060592 SRR3207686 SRAfilesize 57d224d33cfeafdc30998bce7b10312c SRR3207686.sra SRR3207686.sra file validated SRR3207686 is single end SRR3207686 is conventional basespace SRR3207686 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207686_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 42 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 37.1245 39.0 36.0 40.0 33.0 40.0 2 36.7845 38.0 36.0 40.0 31.0 40.0 3 36.68675 38.0 36.0 40.0 31.0 40.0 4 36.679 38.0 36.0 40.0 31.0 40.0 5 36.64225 39.0 36.0 40.0 31.0 40.0 6 36.83425 39.0 36.0 40.0 31.0 40.0 7 36.733 39.0 36.0 40.0 31.0 40.0 8 36.789 38.0 36.0 40.0 31.0 40.0 9 36.579 38.0 35.0 40.0 31.0 40.0 10 36.63 38.0 35.0 40.0 31.0 40.0 11 36.756 38.0 36.0 40.0 31.0 40.0 12 36.6895 38.0 36.0 40.0 31.0 40.0 13 36.43425 38.0 35.0 40.0 30.0 40.0 14 36.40375 38.0 35.0 39.0 31.0 40.0 15 36.2605 38.0 35.0 39.0 30.0 40.0 16 36.417 38.0 35.0 39.0 31.0 40.0 17 36.10025 38.0 35.0 39.0 30.0 40.0 18 36.13825 38.0 35.0 39.0 30.0 40.0 19 36.02575 38.0 35.0 39.0 29.0 40.0 20 36.04225 38.0 35.0 39.0 29.0 40.0 21 35.9515 38.0 35.0 39.0 30.0 40.0 22 36.349 38.0 35.0 39.0 31.0 40.0 23 35.91525 38.0 35.0 39.0 29.0 40.0 24 36.1765 38.0 35.0 39.0 30.0 40.0 25 35.9315 38.0 35.0 39.0 29.0 40.0 26 35.8795 38.0 35.0 39.0 30.0 40.0 27 35.689 38.0 35.0 39.0 29.0 40.0 28 35.57 38.0 35.0 39.0 29.0 40.0 29 35.3525 38.0 34.0 39.0 28.0 40.0 30 35.281 38.0 34.0 39.0 28.0 40.0 31 35.27575 38.0 35.0 39.0 28.0 40.0 32 34.77925 38.0 33.0 39.0 27.0 40.0 33 34.92275 38.0 33.0 39.0 27.0 40.0 34 34.48425 38.0 33.0 39.0 26.0 40.0 35 34.82425 38.0 33.0 39.0 27.0 40.0 36 34.8835 38.0 34.0 39.0 27.0 40.0 37 34.26675 38.0 33.0 39.0 25.0 40.0 38 34.5995 38.0 33.0 39.0 27.0 40.0 39 34.395 38.0 33.0 39.0 26.0 40.0 40 34.00525 37.0 33.0 39.0 25.0 40.0 41 34.269 38.0 33.0 39.0 26.0 40.0 42 34.2395 37.0 33.0 39.0 26.0 40.0 43 34.31675 37.0 33.0 39.0 26.0 40.0 44 33.89 37.0 33.0 39.0 25.0 40.0 45 34.16225 37.0 33.0 39.0 26.0 40.0 46 34.0995 37.0 33.0 39.0 26.0 40.0 47 34.125 37.0 33.0 39.0 27.0 40.0 48 33.85975 37.0 33.0 39.0 25.0 40.0 49 33.58425 36.0 33.0 39.0 24.0 40.0 50 33.625 36.0 33.0 39.0 25.0 40.0 51 33.5985 37.0 33.0 39.0 25.0 40.0 52 33.451 36.0 33.0 39.0 24.0 40.0 53 33.187 36.0 32.0 39.0 23.0 40.0 54 32.88475 36.0 31.0 39.0 23.0 40.0 55 32.67725 36.0 31.0 39.0 23.0 40.0 56 32.53375 36.0 32.0 39.0 21.0 40.0 57 32.01225 35.0 31.0 38.0 19.0 39.0 58 31.9115 35.0 31.0 38.0 18.0 39.0 59 31.46675 35.0 30.0 38.0 17.0 39.0 60 31.565 35.0 31.0 38.0 17.0 39.0 61 30.95425 35.0 30.0 38.0 8.0 39.0 62 30.58575 35.0 29.0 38.0 6.0 39.0 63 30.59275 35.0 29.0 38.0 2.0 39.0 64 30.1955 35.0 29.0 38.0 2.0 39.0 65 30.10725 34.0 29.0 38.0 2.0 39.0 66 29.8635 35.0 29.0 38.0 2.0 39.0 67 29.702 34.0 29.0 38.0 2.0 39.0 68 29.58475 34.0 29.0 38.0 2.0 39.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 0.0 4 1.0 5 3.0 6 1.0 7 4.0 8 9.0 9 8.0 10 7.0 11 8.0 12 11.0 13 13.0 14 5.0 15 12.0 16 9.0 17 13.0 18 14.0 19 22.0 20 12.0 21 27.0 22 24.0 23 33.0 24 33.0 25 61.0 26 53.0 27 75.0 28 70.0 29 78.0 30 91.0 31 133.0 32 147.0 33 205.0 34 290.0 35 342.0 36 489.0 37 576.0 38 661.0 39 452.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 20.23689516129032 16.028225806451612 19.430443548387096 44.30443548387097 2 18.475 27.400000000000002 37.35 16.775000000000002 3 22.15 29.25 26.474999999999998 22.125 4 23.724999999999998 35.025 20.825 20.424999999999997 5 23.674999999999997 35.575 24.075 16.675 6 17.150000000000002 38.0 24.3 20.549999999999997 7 15.375 16.900000000000002 47.325 20.4 8 19.1 22.5 30.225 28.175 9 20.05 23.1 32.300000000000004 24.55 10 20.075000000000003 40.325 22.900000000000002 16.7 11 25.674999999999997 28.7 20.95 24.675 12 19.6 25.0 30.825000000000003 24.575 13 19.05 28.975 31.324999999999996 20.65 14 19.950000000000003 28.499999999999996 30.2 21.349999999999998 15 20.875 28.799999999999997 28.975 21.349999999999998 16 20.9 28.499999999999996 29.25 21.349999999999998 17 22.475 27.925 28.199999999999996 21.4 18 22.2 28.050000000000004 27.250000000000004 22.5 19 20.7 28.475 28.799999999999997 22.025 20 20.825 27.55 29.65 21.975 21 21.425 27.750000000000004 28.95 21.875 22 20.599999999999998 28.275 27.625 23.5 23 22.025 29.475 27.0 21.5 24 21.625 29.875 27.425 21.075 25 20.7 28.799999999999997 29.125 21.375 26 20.9 28.249999999999996 29.025000000000002 21.825 27 20.724999999999998 28.175 30.025000000000002 21.075 28 20.549999999999997 29.225 28.225 22.0 29 21.725 28.675 27.675 21.925 30 20.65 28.999999999999996 28.299999999999997 22.05 31 20.150000000000002 29.925 28.175 21.75 32 22.225 29.65 27.400000000000002 20.724999999999998 33 21.925 29.675 27.325 21.075 34 20.775 29.075 28.499999999999996 21.65 35 21.375 29.099999999999998 28.15 21.375 36 21.375 29.099999999999998 27.625 21.9 37 20.525 28.749999999999996 29.45 21.275 38 21.180295073768445 27.631907976994246 29.68242060515129 21.50537634408602 39 21.2 28.15 28.349999999999998 22.3 40 21.405351337834457 28.057014253563388 29.08227056764191 21.45536384096024 41 20.674999999999997 29.65 28.65 21.025 42 21.48037009252313 29.632408102025504 26.93173293323331 21.955488872218055 43 20.230057514378593 29.107276819204802 28.182045511377847 22.48062015503876 44 22.7 28.599999999999998 28.000000000000004 20.7 45 21.5 28.525 27.675 22.3 46 19.950000000000003 28.999999999999996 28.025 23.025000000000002 47 21.45 29.549999999999997 28.625 20.375 48 21.45536384096024 29.00725181295324 28.80720180045011 20.730182545636406 49 21.8 28.225 28.549999999999997 21.425 50 21.15 28.375 29.825000000000003 20.65 51 21.725 28.4 27.375 22.5 52 21.325 28.499999999999996 28.249999999999996 21.925 53 21.15 29.725 28.15 20.974999999999998 54 21.975 28.925 28.275 20.825 55 22.025 27.975 27.675 22.325 56 20.474999999999998 29.475 28.375 21.675 57 21.95 27.85 28.7 21.5 58 21.725 28.875 27.85 21.55 59 21.8 28.849999999999998 28.199999999999996 21.15 60 21.475 28.549999999999997 28.599999999999998 21.375 61 21.25 28.299999999999997 28.449999999999996 22.0 62 22.175 29.45 27.900000000000002 20.474999999999998 63 21.575 28.375 28.1 21.95 64 21.85 28.725 28.975 20.45 65 21.15 28.775000000000002 28.775000000000002 21.3 66 21.525 30.3 28.299999999999997 19.875 67 20.775 28.625 29.349999999999998 21.25 68 20.724999999999998 29.049999999999997 28.65 21.575 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 2.0 21 4.5 22 5.0 23 8.5 24 12.0 25 12.0 26 18.0 27 37.5 28 51.0 29 58.5 30 62.5 31 59.0 32 78.0 33 123.0 34 149.0 35 155.5 36 177.5 37 193.0 38 224.5 39 282.5 40 317.5 41 326.0 42 343.0 43 360.5 44 361.0 45 338.0 46 303.5 47 292.0 48 272.0 49 229.0 50 206.0 51 169.0 52 122.0 53 112.0 54 99.5 55 71.5 56 56.0 57 47.0 58 29.0 59 20.0 60 20.5 61 13.0 62 5.0 63 4.5 64 4.0 65 5.0 66 6.0 67 3.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.5 74 1.5 75 2.0 76 1.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.025 39 0.0 40 0.025 41 0.0 42 0.025 43 0.025 44 0.0 45 0.0 46 0.0 47 0.0 48 0.025 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79944848332916 99.52499999999999 2 0.17548257708698922 0.35000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0250689395838556 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGCCGTCTTCTGCTTGAAAAA 5 0.125 TruSeq Adapter, Index 7 (100% over 63bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10 0.025 0.0 0.0 0.0 0.0 11 0.025 0.0 0.0 0.0 0.0 12 0.025 0.0 0.0 0.0 0.0 13 0.025 0.0 0.0 0.0 0.0 14 0.025 0.0 0.0 0.0 0.0 15 0.025 0.0 0.0 0.0 0.0 16 0.025 0.0 0.0 0.0 0.0 17 0.025 0.0 0.0 0.0 0.0 18 0.025 0.0 0.0 0.0 0.0 19 0.025 0.0 0.0 0.0 0.0 20 0.025 0.0 0.0 0.0 0.0 21 0.025 0.0 0.0 0.0 0.0 22 0.025 0.0 0.0 0.0 0.0 23 0.025 0.0 0.0 0.0 0.0 24 0.05 0.0 0.0 0.0 0.0 25 0.05 0.0 0.0 0.0 0.0 26 0.05 0.0 0.0 0.0 0.0 27 0.05 0.0 0.0 0.0 0.0 28 0.05 0.0 0.0 0.0 0.0 29 0.05 0.0 0.0 0.0 0.0 30 0.05 0.0 0.0 0.0 0.0 31 0.05 0.0 0.0 0.0 0.0 32 0.05 0.0 0.0 0.0 0.0 33 0.05 0.0 0.0 0.0 0.0 34 0.05 0.0 0.0 0.0 0.0 35 0.05 0.0 0.0 0.0 0.0 36 0.05 0.0 0.0 0.0 0.0 37 0.05 0.0 0.0 0.0 0.0 38 0.05 0.0 0.0 0.0 0.0 39 0.05 0.0 0.0 0.0 0.0 40 0.05 0.0 0.0 0.0 0.0 41 0.05 0.0 0.0 0.0 0.0 42 0.05 0.0 0.0 0.0 0.0 43 0.05 0.0 0.0 0.0 0.0 44 0.05 0.0 0.0 0.0 0.0 45 0.05 0.0 0.0 0.0 0.0 46 0.05 0.0 0.0 0.0 0.0 47 0.05 0.0 0.0 0.0 0.0 48 0.05 0.0 0.0 0.0 0.0 49 0.05 0.0 0.0 0.0 0.0 50 0.05 0.0 0.0 0.0 0.0 51 0.05 0.0 0.0 0.0 0.0 52 0.05 0.0 0.0 0.0 0.0 53 0.05 0.0 0.0 0.0 0.0 54 0.05 0.0 0.0 0.0 0.0 55 0.05 0.0 0.0 0.0 0.0 56 0.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 202648 spots for SRR3207686.sra Written 202648 spots for SRR3207686.sra Read 202648 spots for SRR3207686.sra Written 202648 spots for SRR3207686.sra Read 202648 spots for SRR3207686.sra Written 202648 spots for SRR3207686.sra Read 202648 spots for SRR3207686.sra Written 202648 spots for SRR3207686.sra Read 202648 spots for SRR3207686.sra Written 202648 spots for SRR3207686.sra Read 202648 spots for SRR3207686.sra Written 202648 spots for SRR3207686.sra Read 202648 spots for SRR3207686.sra Written 202648 spots for SRR3207686.sra Read 202648 spots for SRR3207686.sra Written 202648 spots for SRR3207686.sra Read 202648 spots for SRR3207686.sra Written 202648 spots for SRR3207686.sra Read 202648 spots for SRR3207686.sra Written 202648 spots for SRR3207686.sra Read 202648 spots for SRR3207686.sra Written 202648 spots for SRR3207686.sra Read 202648 spots for SRR3207686.sra Written 202648 spots for SRR3207686.sra Read 202648 spots for SRR3207686.sra Written 202648 spots for SRR3207686.sra Read 202662 spots for SRR3207686.sra Written 202662 spots for SRR3207686.sra Read 202648 spots for SRR3207686.sra Written 202648 spots for SRR3207686.sra Read 202648 spots for SRR3207686.sra Written 202648 spots for SRR3207686.sra Read 202648 spots for SRR3207686.sra Written 202648 spots for SRR3207686.sra Read 202648 spots for SRR3207686.sra Written 202648 spots for SRR3207686.sra Read 202648 spots for SRR3207686.sra Written 202648 spots for SRR3207686.sra Read 202648 spots for SRR3207686.sra Written 202648 spots for SRR3207686.sra SRR ids: ['SRR3207686.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9pmbcs1u SRR3207686.sra spots: 4052974 blocks: [[1, 202648], [202649, 405296], [405297, 607944], [607945, 810592], [810593, 1013240], [1013241, 1215888], [1215889, 1418536], [1418537, 1621184], [1621185, 1823832], [1823833, 2026480], [2026481, 2229128], [2229129, 2431776], [2431777, 2634424], [2634425, 2837072], [2837073, 3039720], [3039721, 3242368], [3242369, 3445016], [3445017, 3647664], [3647665, 3850312], [3850313, 4052974]] SRR3207686 file size 850589 SRR3207686 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207686 SRR3207686_1.fastq Input file: SRR3207686_1.fastq trimmed: SRR3207686-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 13:27:46 2025 >> started Mon Feb 10 13:27:48 2025 >> done (1.934s) 4052974 reads processed; of these: 9424 ( 0.23%) short reads filtered out after trimming by size control 14781 ( 0.36%) empty reads filtered out after trimming by size control 4028769 (99.40%) reads available; of these: 319698 ( 7.94%) trimmed reads available after processing 3709071 (92.06%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 934 0.02% 19 1407 0.03% 20 2113 0.05% 21 735 0.02% 22 1098 0.03% 23 1684 0.04% 24 2854 0.07% 25 4579 0.11% 26 1336 0.03% 27 1686 0.04% 28 2153 0.05% 29 3621 0.09% 30 5665 0.14% 31 1411 0.04% 32 1835 0.05% 33 2572 0.06% 34 3456 0.09% 35 5423 0.13% 36 1411 0.04% 37 1892 0.05% 38 2490 0.06% 39 3695 0.09% 40 5768 0.14% 41 1434 0.04% 42 2130 0.05% 43 3078 0.08% 44 4683 0.12% 45 7413 0.18% 46 1884 0.05% 47 2618 0.06% 48 4176 0.10% 49 6943 0.17% 50 11119 0.28% 51 2883 0.07% 52 4335 0.11% 53 6516 0.16% 54 10646 0.26% 55 19606 0.49% 56 4353 0.11% 57 6004 0.15% 58 9245 0.23% 59 15461 0.38% 60 28519 0.71% 61 5709 0.14% 62 8226 0.20% 63 12630 0.31% 64 22567 0.56% 65 36957 0.92% 66 7918 0.20% 67 12827 0.32% 68 3709071 92.06% 4028769 reads passed initial QC criterion=sequence-density sequence-density=0.03 sequence-density-rank=1 fanout-score=51.42 fanout-score-rank=9 prefix-density=0.14 prefix-fanout=11.6 sequence=AGAAAGAAAGAA criterion=fanout-score sequence-density=0.03 sequence-density-rank=8 fanout-score=195.57 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=21.6 sequence=TTCTTCTTCTTC Started job on | Feb 10 13:28:00 Started mapping on | Feb 10 13:28:01 Finished on | Feb 10 13:28:07 Mapping speed, Million of reads per hour | 2417.26 Number of input reads | 4028769 Average input read length | 66 UNIQUE READS: Uniquely mapped reads number | 3812239 Uniquely mapped reads % | 94.63% Average mapped length | 66.74 Number of splices: Total | 675550 Number of splices: Annotated (sjdb) | 663891 Number of splices: GT/AG | 664926 Number of splices: GC/AG | 8777 Number of splices: AT/AC | 835 Number of splices: Non-canonical | 1012 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.01% Deletion average length | 1.74 Insertion rate per base | 0.01% Insertion average length | 1.33 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 132100 % of reads mapped to multiple loci | 3.28% Number of reads mapped to too many loci | 64439 % of reads mapped to too many loci | 1.60% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.49% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 84430 84430 84430 N_multimapping 132100 132100 132100 N_noFeature 217421 1985804 2019698 N_ambiguous 36651 6156 6384 UnstrandedReadsAssigned:3558167 PositiveStrandReadsAssigned:1820279 NegativeStrandReadsAssigned:1786157 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR3207686 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207686-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 4,028,769 reads, 3,676,472 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,112 rounds 52401 SRR3207686.ke.tsv 34699 SRR3207686.se.tsv 87100 total ==> SRR3207686.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 170 35.4997 Potri.005G024800.1.v4.1 1035 936 63 26.9721 Potri.004G059700.1.v4.1 961 862 8 3.71906 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 74.891 10.5524 Potri.016G087400.1.v4.1 270 171 111 260.122 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 15.4385 3.69573 Potri.012G127500.1.v4.1 977 878 800 365.129 ==> SRR3207686.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 515 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 57 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR3207686 completed mapping pipeline successfully