Starting /dee2/code/volunteer_pipeline.sh SRR3207687 current disk space = 3058760617984 free memory = 1402112760 SRR3207687 SRAfilesize 05c11576051a70c8f20f75a780bf4f4f SRR3207687.sra SRR3207687.sra file validated SRR3207687 is single end SRR3207687 is conventional basespace SRR3207687 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207687_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 37.0095 39.0 36.0 40.0 33.0 40.0 2 36.76275 38.0 36.0 40.0 31.0 40.0 3 36.665 38.0 36.0 40.0 31.0 40.0 4 36.59425 38.0 36.0 40.0 31.0 40.0 5 36.60725 39.0 36.0 40.0 31.0 40.0 6 36.7815 39.0 36.0 40.0 31.0 40.0 7 36.7485 39.0 36.0 40.0 31.0 40.0 8 36.65275 38.0 36.0 40.0 31.0 40.0 9 36.56375 38.0 35.0 40.0 31.0 40.0 10 36.54725 38.0 35.0 40.0 31.0 40.0 11 36.76225 38.0 36.0 40.0 32.0 40.0 12 36.68275 38.0 35.0 40.0 31.0 40.0 13 36.474 38.0 35.0 39.0 31.0 40.0 14 36.472 38.0 35.0 40.0 30.0 40.0 15 36.3905 38.0 35.0 39.0 31.0 40.0 16 36.42725 38.0 35.0 40.0 30.0 40.0 17 36.1775 38.0 35.0 39.0 30.0 40.0 18 36.1515 38.0 35.0 39.0 30.0 40.0 19 36.19175 38.0 35.0 40.0 30.0 40.0 20 36.25925 38.0 35.0 39.0 30.0 40.0 21 36.05425 38.0 35.0 39.0 29.0 40.0 22 36.296 38.0 35.0 40.0 30.0 40.0 23 36.02425 38.0 35.0 39.0 29.0 40.0 24 36.08975 38.0 35.0 39.0 30.0 40.0 25 36.07575 38.0 35.0 39.0 29.0 40.0 26 35.9805 38.0 35.0 39.0 30.0 40.0 27 35.772 38.0 35.0 39.0 29.0 40.0 28 35.70975 38.0 35.0 39.0 29.0 40.0 29 35.501 38.0 35.0 39.0 29.0 40.0 30 35.415 38.0 34.0 39.0 28.0 40.0 31 35.302 38.0 35.0 39.0 28.0 40.0 32 34.75275 38.0 33.0 39.0 27.0 40.0 33 34.87525 38.0 33.0 39.0 27.0 40.0 34 34.55925 38.0 33.0 39.0 26.0 40.0 35 34.79675 38.0 33.0 39.0 27.0 40.0 36 34.57275 38.0 33.0 39.0 26.0 40.0 37 34.33975 38.0 33.0 39.0 26.0 40.0 38 34.463 38.0 33.0 39.0 26.0 40.0 39 34.372 38.0 33.0 39.0 26.0 40.0 40 33.96825 37.0 33.0 39.0 25.0 40.0 41 34.27525 38.0 33.0 39.0 26.0 40.0 42 34.21825 37.0 33.0 39.0 26.0 40.0 43 34.3095 38.0 33.0 39.0 26.0 40.0 44 33.809 36.0 33.0 39.0 24.0 40.0 45 34.215 37.0 33.0 39.0 26.0 40.0 46 34.05175 37.0 33.0 39.0 26.0 40.0 47 33.8765 37.0 33.0 39.0 25.0 40.0 48 33.706 37.0 33.0 39.0 25.0 40.0 49 33.4805 36.0 32.0 39.0 23.0 40.0 50 33.48775 36.0 32.0 39.0 24.0 40.0 51 33.54975 36.0 33.0 39.0 25.0 40.0 52 33.3455 36.0 33.0 39.0 23.0 40.0 53 33.15875 36.0 32.0 39.0 23.0 40.0 54 32.64875 36.0 31.0 39.0 22.0 40.0 55 32.5425 36.0 31.0 38.0 23.0 40.0 56 32.49325 36.0 32.0 39.0 20.0 40.0 57 31.884 35.0 30.0 38.0 18.0 39.0 58 31.85425 35.0 31.0 38.0 18.0 39.0 59 31.40925 35.0 30.0 38.0 17.0 39.0 60 31.48825 35.0 30.0 38.0 17.0 39.0 61 31.0645 35.0 30.0 38.0 8.0 39.0 62 30.7255 35.0 29.0 38.0 5.0 39.0 63 30.5585 35.0 29.0 38.0 2.0 39.0 64 30.3625 35.0 29.0 38.0 2.0 39.0 65 30.272 35.0 29.0 38.0 2.0 39.0 66 29.9385 35.0 29.0 38.0 2.0 39.0 67 29.5985 34.0 29.0 38.0 2.0 39.0 68 29.54975 34.0 29.0 38.0 2.0 39.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 0.0 4 1.0 5 1.0 6 4.0 7 4.0 8 3.0 9 5.0 10 7.0 11 8.0 12 9.0 13 14.0 14 13.0 15 12.0 16 15.0 17 21.0 18 17.0 19 17.0 20 25.0 21 21.0 22 27.0 23 32.0 24 32.0 25 38.0 26 65.0 27 59.0 28 84.0 29 80.0 30 105.0 31 108.0 32 157.0 33 195.0 34 270.0 35 317.0 36 469.0 37 613.0 38 716.0 39 427.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.917995444191344 16.80587193115667 18.98253606681853 40.29359655783346 2 20.375 24.349999999999998 36.8 18.475 3 21.525 29.075 27.775 21.625 4 23.425 34.375 20.575 21.625 5 25.424999999999997 35.375 22.325 16.875 6 18.375 37.325 24.5 19.8 7 15.975 18.45 45.25 20.325 8 18.725 22.625 30.7 27.950000000000003 9 20.225 22.775000000000002 31.924999999999997 25.074999999999996 10 18.95 39.324999999999996 23.5 18.224999999999998 11 25.05 28.7 21.55 24.7 12 20.549999999999997 25.825 29.2 24.425 13 18.625 29.099999999999998 31.15 21.125 14 20.474999999999998 28.125 29.975 21.425 15 21.0 28.999999999999996 27.224999999999998 22.775000000000002 16 21.275 28.125 28.275 22.325 17 21.575 28.9 28.9 20.625 18 20.9 29.099999999999998 28.199999999999996 21.8 19 22.025 27.400000000000002 27.925 22.650000000000002 20 21.2 28.9 28.675 21.224999999999998 21 21.65 29.25 27.325 21.775 22 20.1 30.3 28.925 20.674999999999997 23 22.7 29.675 27.650000000000002 19.975 24 21.875 27.675 28.499999999999996 21.95 25 21.125 28.825 27.925 22.125 26 21.349999999999998 29.65 28.199999999999996 20.8 27 22.375 28.050000000000004 27.800000000000004 21.775 28 21.825 28.475 27.700000000000003 22.0 29 21.7 28.849999999999998 27.950000000000003 21.5 30 21.349999999999998 29.075 27.900000000000002 21.675 31 22.025 28.825 27.775 21.375 32 20.4 29.549999999999997 27.500000000000004 22.55 33 21.2 28.95 27.825 22.025 34 22.125 28.225 28.249999999999996 21.4 35 21.425 29.099999999999998 27.05 22.425 36 21.325 28.325 28.225 22.125 37 21.6 29.45 27.675 21.275 38 21.025 29.075 27.625 22.275 39 21.95 28.749999999999996 27.675 21.625 40 21.405351337834457 27.70692673168292 28.982245561390346 21.905476369092273 41 21.3 27.35 28.65 22.7 42 21.85 28.65 29.5 20.0 43 21.099999999999998 29.725 27.175 22.0 44 21.025 29.5 28.1 21.375 45 21.025 28.249999999999996 29.549999999999997 21.175 46 21.675 28.375 28.675 21.275 47 21.775 27.900000000000002 27.950000000000003 22.375 48 21.555388847211805 29.782445611402853 26.981745436359088 21.680420105026258 49 20.8 28.599999999999998 28.7 21.9 50 22.175 28.15 27.800000000000004 21.875 51 20.599999999999998 30.049999999999997 27.450000000000003 21.9 52 20.825 27.975 29.025000000000002 22.175 53 21.5 28.199999999999996 29.075 21.224999999999998 54 20.775 28.7 28.799999999999997 21.725 55 21.5 28.175 27.500000000000004 22.825 56 20.8 28.849999999999998 29.4 20.95 57 21.5 28.075 28.799999999999997 21.625 58 22.775000000000002 28.599999999999998 26.700000000000003 21.925 59 21.25 28.525 28.525 21.7 60 20.599999999999998 29.75 28.7 20.95 61 22.075 28.175 28.65 21.099999999999998 62 22.3 27.925 27.800000000000004 21.975 63 21.2 27.775 28.15 22.875 64 21.5 28.225 28.849999999999998 21.425 65 23.150000000000002 29.425 27.900000000000002 19.525000000000002 66 22.175 28.075 27.150000000000002 22.6 67 21.525 28.749999999999996 28.875 20.849999999999998 68 21.575 29.049999999999997 28.65 20.724999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 1.0 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 1.0 17 0.5 18 1.5 19 3.0 20 3.0 21 4.5 22 6.0 23 6.0 24 10.5 25 15.0 26 19.5 27 27.5 28 31.0 29 41.0 30 59.5 31 68.0 32 77.0 33 104.5 34 123.0 35 143.5 36 194.0 37 224.0 38 233.5 39 267.0 40 312.0 41 333.0 42 350.0 43 342.5 44 318.0 45 320.5 46 320.0 47 317.0 48 297.5 49 229.0 50 180.0 51 165.5 52 134.5 53 118.0 54 103.0 55 72.0 56 56.0 57 49.0 58 35.5 59 29.0 60 25.5 61 14.5 62 7.0 63 7.0 64 6.0 65 5.0 66 5.0 67 4.0 68 3.0 69 3.0 70 2.5 71 2.0 72 2.0 73 2.0 74 1.0 75 0.0 76 0.0 77 0.5 78 1.0 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.225 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.025 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.025 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62349397590361 99.225 2 0.3514056224899598 0.7000000000000001 3 0.0251004016064257 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.1 0.0 0.0 0.0 0.0 2 0.1 0.0 0.0 0.0 0.0 3 0.1 0.0 0.0 0.0 0.0 4 0.1 0.0 0.0 0.0 0.0 5 0.1 0.0 0.0 0.0 0.0 6 0.1 0.0 0.0 0.0 0.0 7 0.1 0.0 0.0 0.0 0.0 8 0.1 0.0 0.0 0.0 0.0 9 0.1 0.0 0.0 0.0 0.0 10 0.1 0.0 0.0 0.0 0.0 11 0.1 0.0 0.0 0.0 0.0 12 0.1 0.0 0.0 0.0 0.0 13 0.1 0.0 0.0 0.0 0.0 14 0.1 0.0 0.0 0.0 0.0 15 0.1 0.0 0.0 0.0 0.0 16 0.1 0.0 0.0 0.0 0.0 17 0.1 0.0 0.0 0.0 0.0 18 0.1 0.0 0.0 0.0 0.0 19 0.1 0.0 0.0 0.0 0.0 20 0.1 0.0 0.0 0.0 0.0 21 0.1 0.0 0.0 0.0 0.0 22 0.1 0.0 0.0 0.0 0.0 23 0.1 0.0 0.0 0.0 0.0 24 0.1 0.0 0.0 0.0 0.0 25 0.1 0.0 0.0 0.0 0.0 26 0.1 0.0 0.0 0.0 0.0 27 0.1 0.0 0.0 0.0 0.0 28 0.1 0.0 0.0 0.0 0.0 29 0.1 0.0 0.0 0.0 0.0 30 0.1 0.0 0.0 0.0 0.0 31 0.1 0.0 0.0 0.0 0.0 32 0.1 0.0 0.0 0.0 0.0 33 0.1 0.0 0.0 0.0 0.0 34 0.1 0.0 0.0 0.0 0.0 35 0.1 0.0 0.0 0.0 0.0 36 0.1 0.0 0.0 0.0 0.0 37 0.1 0.0 0.0 0.0 0.0 38 0.1 0.0 0.0 0.0 0.0 39 0.1 0.0 0.0 0.0 0.0 40 0.1 0.0 0.0 0.0 0.0 41 0.1 0.0 0.0 0.0 0.0 42 0.1 0.0 0.0 0.0 0.0 43 0.1 0.0 0.0 0.0 0.0 44 0.1 0.0 0.0 0.0 0.0 45 0.1 0.0 0.0 0.0 0.0 46 0.1 0.0 0.0 0.0 0.0 47 0.1 0.0 0.0 0.0 0.0 48 0.1 0.0 0.0 0.0 0.0 49 0.1 0.0 0.0 0.0 0.0 50 0.1 0.0 0.0 0.0 0.0 51 0.1 0.0 0.0 0.0 0.0 52 0.1 0.0 0.0 0.0 0.0 53 0.125 0.0 0.0 0.0 0.0 54 0.125 0.0 0.0 0.0 0.0 55 0.125 0.0 0.0 0.0 0.0 56 0.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 228686 spots for SRR3207687.sra Written 228686 spots for SRR3207687.sra Read 228686 spots for SRR3207687.sra Written 228686 spots for SRR3207687.sra Read 228686 spots for SRR3207687.sra Written 228686 spots for SRR3207687.sra Read 228686 spots for SRR3207687.sra Written 228686 spots for SRR3207687.sra Read 228686 spots for SRR3207687.sra Written 228686 spots for SRR3207687.sra Read 228686 spots for SRR3207687.sra Written 228686 spots for SRR3207687.sra Read 228686 spots for SRR3207687.sra Written 228686 spots for SRR3207687.sra Read 228686 spots for SRR3207687.sra Written 228686 spots for SRR3207687.sra Read 228686 spots for SRR3207687.sra Written 228686 spots for SRR3207687.sra Read 228686 spots for SRR3207687.sra Written 228686 spots for SRR3207687.sra Read 228686 spots for SRR3207687.sra Written 228686 spots for SRR3207687.sra Read 228686 spots for SRR3207687.sra Written 228686 spots for SRR3207687.sra Read 228686 spots for SRR3207687.sra Written 228686 spots for SRR3207687.sra Read 228686 spots for SRR3207687.sra Written 228686 spots for SRR3207687.sra Read 228686 spots for SRR3207687.sra Written 228686 spots for SRR3207687.sra Read 228686 spots for SRR3207687.sra Written 228686 spots for SRR3207687.sra Read 228693 spots for SRR3207687.sra Written 228693 spots for SRR3207687.sra Read 228686 spots for SRR3207687.sra Written 228686 spots for SRR3207687.sra Read 228686 spots for SRR3207687.sra Written 228686 spots for SRR3207687.sra Read 228686 spots for SRR3207687.sra Written 228686 spots for SRR3207687.sra SRR ids: ['SRR3207687.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2kvm0gsx SRR3207687.sra spots: 4573727 blocks: [[1, 228686], [228687, 457372], [457373, 686058], [686059, 914744], [914745, 1143430], [1143431, 1372116], [1372117, 1600802], [1600803, 1829488], [1829489, 2058174], [2058175, 2286860], [2286861, 2515546], [2515547, 2744232], [2744233, 2972918], [2972919, 3201604], [3201605, 3430290], [3430291, 3658976], [3658977, 3887662], [3887663, 4116348], [4116349, 4345034], [4345035, 4573727]] SRR3207687 file size 960024 SRR3207687 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207687 SRR3207687_1.fastq Input file: SRR3207687_1.fastq trimmed: SRR3207687-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 12:55:13 2025 >> started Mon Feb 10 12:55:15 2025 >> done (2.157s) 4573727 reads processed; of these: 10946 ( 0.24%) short reads filtered out after trimming by size control 8262 ( 0.18%) empty reads filtered out after trimming by size control 4554519 (99.58%) reads available; of these: 366723 ( 8.05%) trimmed reads available after processing 4187796 (91.95%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1133 0.02% 19 1698 0.04% 20 2679 0.06% 21 854 0.02% 22 1240 0.03% 23 2042 0.04% 24 3288 0.07% 25 5396 0.12% 26 1446 0.03% 27 1984 0.04% 28 2631 0.06% 29 4155 0.09% 30 6523 0.14% 31 1678 0.04% 32 2134 0.05% 33 3008 0.07% 34 4203 0.09% 35 6327 0.14% 36 1588 0.03% 37 2121 0.05% 38 2906 0.06% 39 4409 0.10% 40 6710 0.15% 41 1703 0.04% 42 2430 0.05% 43 3541 0.08% 44 5425 0.12% 45 8597 0.19% 46 2085 0.05% 47 3089 0.07% 48 4673 0.10% 49 7979 0.18% 50 12723 0.28% 51 3315 0.07% 52 5035 0.11% 53 7385 0.16% 54 12087 0.27% 55 22378 0.49% 56 4899 0.11% 57 6857 0.15% 58 10360 0.23% 59 17673 0.39% 60 32869 0.72% 61 6497 0.14% 62 9397 0.21% 63 14428 0.32% 64 25570 0.56% 65 41955 0.92% 66 9197 0.20% 67 14423 0.32% 68 4187796 91.95% 4554519 reads passed initial QC criterion=sequence-density sequence-density=0.04 sequence-density-rank=1 fanout-score=0.00 fanout-score-rank=41 prefix-density=0.00 prefix-fanout=1.0 sequence=AGTATGGCCCGGGGGATCCT criterion=fanout-score sequence-density=0.03 sequence-density-rank=12 fanout-score=169.39 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=20.3 sequence=TTCTTCTTCTTC Started job on | Feb 10 12:55:30 Started mapping on | Feb 10 12:55:30 Finished on | Feb 10 12:55:35 Mapping speed, Million of reads per hour | 3279.25 Number of input reads | 4554519 Average input read length | 66 UNIQUE READS: Uniquely mapped reads number | 4290034 Uniquely mapped reads % | 94.19% Average mapped length | 66.72 Number of splices: Total | 764178 Number of splices: Annotated (sjdb) | 750718 Number of splices: GT/AG | 752173 Number of splices: GC/AG | 9819 Number of splices: AT/AC | 972 Number of splices: Non-canonical | 1214 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.01% Deletion average length | 1.71 Insertion rate per base | 0.01% Insertion average length | 1.33 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 143738 % of reads mapped to multiple loci | 3.16% Number of reads mapped to too many loci | 96498 % of reads mapped to too many loci | 2.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.52% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 120747 120747 120747 N_multimapping 143738 143738 143738 N_noFeature 256572 2244753 2273754 N_ambiguous 42229 7083 7096 UnstrandedReadsAssigned:3991233 PositiveStrandReadsAssigned:2038198 NegativeStrandReadsAssigned:2009184 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR3207687 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207687-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 4,554,519 reads, 4,142,430 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,129 rounds 52401 SRR3207687.ke.tsv 34699 SRR3207687.se.tsv 87100 total ==> SRR3207687.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 152 28.8053 Potri.005G024800.1.v4.1 1035 936 42 16.3184 Potri.004G059700.1.v4.1 961 862 8 3.3751 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 77.2454 9.8775 Potri.016G087400.1.v4.1 270 171 147 312.626 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 23.4576 5.09604 Potri.012G127500.1.v4.1 977 878 628 260.117 ==> SRR3207687.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 723 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 79 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 6 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR3207687 completed mapping pipeline successfully