Starting /dee2/code/volunteer_pipeline.sh SRR3207688 current disk space = 3058770382848 free memory = 1167247568 SRR3207688 SRAfilesize 75ad4db6e854d0099b6e9bb454629890 SRR3207688.sra SRR3207688.sra file validated SRR3207688 is single end SRR3207688 is conventional basespace SRR3207688 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207688_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.91175 34.0 31.0 34.0 31.0 34.0 2 33.05575 34.0 33.0 34.0 31.0 34.0 3 33.188 34.0 34.0 34.0 31.0 34.0 4 36.48425 37.0 37.0 37.0 35.0 37.0 5 36.33475 37.0 37.0 37.0 35.0 37.0 6 36.35675 37.0 37.0 37.0 35.0 37.0 7 36.40875 37.0 37.0 37.0 35.0 37.0 8 36.44375 37.0 37.0 37.0 35.0 37.0 9 38.21425 39.0 39.0 39.0 37.0 39.0 10-11 38.195625 39.0 39.0 39.0 37.0 39.0 12-13 38.205 39.0 39.0 39.0 37.0 39.0 14-15 39.85825 41.0 40.0 41.0 38.0 41.0 16-17 39.858625 41.0 40.0 41.0 37.5 41.0 18-19 39.7815 41.0 40.0 41.0 37.5 41.0 20-21 39.754125 41.0 40.0 41.0 37.0 41.0 22-23 39.271874999999994 41.0 39.5 41.0 36.0 41.0 24-25 39.278875 41.0 40.0 41.0 36.0 41.0 26-27 39.37125 41.0 40.0 41.0 36.5 41.0 28-29 39.542625 41.0 40.0 41.0 37.0 41.0 30-31 39.280375 41.0 39.0 41.0 36.0 41.0 32-33 39.089625 41.0 39.0 41.0 36.0 41.0 34-35 39.231875 41.0 39.0 41.0 36.0 41.0 36-37 39.226125 41.0 39.5 41.0 36.0 41.0 38-39 39.10025 40.5 39.0 41.0 36.0 41.0 40-41 38.936 40.5 39.0 41.0 35.0 41.0 42-43 39.072375 40.5 39.0 41.0 35.5 41.0 44-45 39.10225 41.0 39.0 41.0 36.0 41.0 46-47 38.974000000000004 41.0 39.0 41.0 35.5 41.0 48-49 38.7655 40.0 39.0 41.0 35.0 41.0 50-51 38.97875 41.0 39.0 41.0 35.0 41.0 52-53 39.006875 41.0 39.0 41.0 35.5 41.0 54-55 38.837 41.0 39.0 41.0 35.0 41.0 56-57 38.695375 41.0 38.5 41.0 35.0 41.0 58-59 38.29275 40.0 38.0 41.0 34.0 41.0 60-61 38.281 40.0 38.0 41.0 34.5 41.0 62-63 38.011250000000004 40.0 37.0 41.0 34.0 41.0 64-65 37.421875 39.0 36.0 41.0 33.0 41.0 66-67 37.2325 39.0 36.0 41.0 33.5 41.0 68-69 36.634875 38.5 35.5 41.0 32.5 41.0 70-71 35.764625 37.0 35.0 40.0 31.0 41.0 72-73 35.326375 37.0 35.0 39.0 31.0 41.0 74-75 34.858374999999995 36.5 35.0 39.0 30.5 40.5 76-77 33.939 35.5 34.0 37.0 29.5 39.0 78-79 34.033625 35.5 35.0 37.0 30.5 39.0 80-81 33.730625 35.0 35.0 37.0 30.5 38.5 82-83 33.435249999999996 35.0 35.0 36.0 30.5 37.0 84-85 33.067625 35.0 34.0 36.0 30.0 37.0 86-87 32.616875 35.0 34.0 36.0 29.0 36.5 88-89 31.961 35.0 34.0 35.0 25.0 36.0 90-91 32.068 35.0 34.0 35.0 26.0 36.0 92-93 32.202 35.0 34.0 35.0 28.5 36.0 94-95 32.125249999999994 35.0 34.0 35.0 28.5 36.0 96-97 32.04025 35.0 34.0 35.0 28.0 35.5 98-99 31.921 35.0 34.0 35.0 28.5 35.0 100 31.8495 35.0 34.0 35.0 27.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 2.0 10 3.0 11 1.0 12 1.0 13 1.0 14 5.0 15 4.0 16 2.0 17 14.0 18 6.0 19 4.0 20 4.0 21 5.0 22 12.0 23 13.0 24 19.0 25 20.0 26 32.0 27 61.0 28 36.0 29 41.0 30 46.0 31 36.0 32 62.0 33 87.0 34 100.0 35 151.0 36 241.0 37 665.0 38 1794.0 39 529.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.825 15.475 13.700000000000001 43.0 2 20.474999999999998 26.75 35.8 16.975 3 19.875 25.724999999999998 31.75 22.650000000000002 4 22.675 33.975 19.475 23.875 5 24.056014003500874 35.08377094273568 23.80595148787197 17.05426356589147 6 23.599999999999998 34.1 23.1 19.2 7 16.175 19.475 41.175 23.175 8 18.325 26.5 26.974999999999998 28.199999999999996 9 24.3 21.775 30.525000000000002 23.400000000000002 10-11 23.125 33.1 22.5875 21.1875 12-13 19.8 26.1 30.5 23.599999999999998 14-15 19.325 27.700000000000003 29.075 23.9 16-17 23.825 27.250000000000004 25.724999999999998 23.200000000000003 18-19 20.7 26.325 30.15 22.825 20-21 23.599999999999998 28.375 27.05 20.974999999999998 22-23 21.675 32.1 25.2625 20.962500000000002 24-25 20.740092511563944 27.603450431303912 28.316039504938118 23.340417552194022 26-27 21.7375 27.0625 26.75 24.45 28-29 21.976235146966854 31.45716072545341 25.92870544090056 20.637898686679172 30-31 21.73314993122421 28.010503938977116 27.410278854570464 22.84606727522821 32-33 21.6625 29.099999999999998 26.4125 22.825 34-35 21.9625 27.775 27.987499999999997 22.275 36-37 19.4875 30.5125 26.2875 23.7125 38-39 22.725 28.599999999999998 26.825 21.85 40-41 20.3125 29.025000000000002 29.2 21.462500000000002 42-43 21.712500000000002 27.8125 28.212500000000002 22.2625 44-45 22.0875 27.950000000000003 26.7625 23.200000000000003 46-47 22.05 27.375 28.449999999999996 22.125 48-49 21.712500000000002 28.762500000000003 27.712500000000002 21.8125 50-51 21.425 26.900000000000002 27.525 24.15 52-53 22.8125 28.65 26.924999999999997 21.6125 54-55 20.7875 27.725 28.4125 23.075000000000003 56-57 21.5375 28.6375 28.0875 21.7375 58-59 22.625 28.000000000000004 26.787499999999998 22.5875 60-61 20.3 28.812500000000004 28.6875 22.2 62-63 21.325 26.474999999999998 29.875 22.325 64-65 21.1875 29.375 27.2625 22.175 66-67 21.7875 30.1875 27.9375 20.0875 68-69 20.75 30.9875 27.35 20.9125 70-71 21.7 29.299999999999997 26.5625 22.4375 72-73 22.662499999999998 28.6625 26.474999999999998 22.2 74-75 20.7 30.0375 27.287499999999998 21.975 76-77 21.2 29.349999999999998 28.6875 20.7625 78-79 21.325 27.9125 28.712500000000002 22.05 80-81 22.25 28.4375 26.6625 22.650000000000002 82-83 21.8 27.6875 29.3875 21.125 84-85 22.45 28.8875 27.125 21.5375 86-87 20.9125 29.862499999999997 26.687499999999996 22.537499999999998 88-89 20.7875 29.362500000000004 27.474999999999998 22.375 90-91 23.0125 28.9875 26.2875 21.712500000000002 92-93 21.5375 30.837500000000002 26.3625 21.2625 94-95 22.1375 29.3875 27.537499999999998 20.9375 96-97 22.95 27.8625 26.924999999999997 22.2625 98-99 21.8625 29.325000000000003 26.525 22.287499999999998 100 21.8 28.625 27.875 21.7 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.0 22 0.5 23 0.5 24 1.5 25 2.0 26 2.5 27 4.5 28 8.5 29 17.0 30 20.5 31 22.0 32 29.5 33 41.0 34 55.0 35 73.5 36 93.5 37 116.0 38 137.5 39 158.5 40 189.0 41 233.0 42 260.5 43 256.0 44 274.5 45 278.0 46 259.0 47 250.5 48 224.0 49 194.5 50 168.5 51 145.5 52 132.0 53 97.5 54 59.5 55 48.5 56 38.5 57 25.0 58 16.5 59 13.5 60 10.5 61 9.0 62 6.5 63 3.5 64 2.0 65 2.0 66 3.0 67 3.0 68 2.5 69 1.0 70 0.0 71 0.5 72 1.0 73 0.5 74 0.5 75 1.5 76 1.0 77 0.5 78 0.5 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0125 26-27 0.0 28-29 0.0625 30-31 0.0375 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.95 #Duplication Level Percentage of deduplicated Percentage of total 1 99.55239599789363 94.525 2 0.315955766192733 0.6 3 0.02632964718272775 0.075 4 0.0 0.0 5 0.02632964718272775 0.125 6 0.02632964718272775 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.02632964718272775 1.7500000000000002 >100 0.02632964718272775 2.775 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGC 111 2.775 TruSeq Adapter, Index 4 (100% over 50bp) CGTATGCCGTCTTCTGCTTGAGATCGGAAGAGCACACGTCTGAACTCCAG 70 1.7500000000000002 Illumina Multiplexing PCR Primer 2.01 (100% over 30bp) CGTATGCCGTCTTCTGCTTGAGAACGGAAGAGCACACGTCTGAACTCCAG 6 0.15 Illumina Multiplexing PCR Primer 2.01 (96% over 30bp) AGATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATG 5 0.125 TruSeq Adapter, Index 4 (100% over 49bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.15 0.0 0.0 0.0 0.0 2 0.15 0.0 0.0 0.0 0.0 3 0.15 0.0 0.0 0.0 0.0 4 0.15 0.0 0.0 0.0 0.0 5 0.15 0.0 0.0 0.0 0.0 6 0.15 0.0 0.0 0.0 0.0 7 0.15 0.0 0.0 0.0 0.0 8 0.15 0.0 0.0 0.0 0.0 9 0.15 0.0 0.0 0.0 0.0 10-11 0.15 0.0 0.0 0.0 0.0 12-13 0.15 0.0 0.0 0.0 0.0 14-15 0.15 0.0 0.0 0.0 0.0 16-17 0.15 0.0 0.0 0.0 0.0 18-19 0.15 0.0 0.0 0.0 0.0 20-21 1.0999999999999999 0.0 0.0 0.0 0.0 22-23 2.05 0.0 0.0 0.0 0.0 24-25 2.05 0.0 0.0 0.0 0.0 26-27 2.0625 0.0 0.0 0.0 0.0 28-29 2.075 0.0 0.0 0.0 0.0 30-31 2.075 0.0 0.0 0.0 0.0 32-33 2.075 0.0 0.0 0.0 0.0 34-35 2.1 0.0 0.0 0.0 0.0 36-37 2.1 0.0 0.0 0.0 0.0 38-39 2.1 0.0 0.0 0.0 0.0 40-41 2.1 0.0 0.0 0.0 0.0 42-43 2.1 0.0 0.0 0.0 0.0 44-45 2.1 0.0 0.0 0.0 0.0 46-47 2.1 0.0 0.0 0.0 0.0 48-49 2.125 0.0 0.0 0.0 0.0 50-51 2.125 0.0 0.0 0.0 0.0 52-53 2.125 0.0 0.0 0.0 0.0 54-55 2.125 0.0 0.0 0.0 0.0 56-57 2.125 0.0 0.0 0.0 0.0 58-59 2.125 0.0 0.0 0.0 0.0 60-61 2.125 0.0 0.0 0.0 0.0 62-63 2.1375 0.0 0.0 0.0 0.0 64-65 2.15 0.0 0.0 0.0 0.0 66-67 2.1624999999999996 0.0 0.0 0.0 0.0 68-69 2.175 0.0 0.0 0.0 0.0 70-71 2.1875 0.0 0.0 0.0 0.0 72-73 2.2 0.0 0.0 0.0 0.0 74-75 2.225 0.0 0.0 0.0 0.0 76-77 2.275 0.0 0.0 0.0 0.0 78-79 2.3 0.0 0.0 0.0 0.0 80-81 2.3 0.0 0.0 0.0 0.0 82-83 2.3 0.0 0.0 0.0 0.0 84-85 2.3125 0.0 0.0 0.0 0.0 86-87 2.3875 0.0 0.0 0.0 0.0 88 2.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 772646 spots for SRR3207688.sra Written 772646 spots for SRR3207688.sra Read 772646 spots for SRR3207688.sra Written 772646 spots for SRR3207688.sra Read 772646 spots for SRR3207688.sra Written 772646 spots for SRR3207688.sra Read 772646 spots for SRR3207688.sra Written 772646 spots for SRR3207688.sra Read 772646 spots for SRR3207688.sra Written 772646 spots for SRR3207688.sra Read 772646 spots for SRR3207688.sra Written 772646 spots for SRR3207688.sra Read 772646 spots for SRR3207688.sra Written 772646 spots for SRR3207688.sra Read 772646 spots for SRR3207688.sra Written 772646 spots for SRR3207688.sra Read 772646 spots for SRR3207688.sra Written 772646 spots for SRR3207688.sra Read 772646 spots for SRR3207688.sra Written 772646 spots for SRR3207688.sra Read 772654 spots for SRR3207688.sra Written 772654 spots for SRR3207688.sra Read 772646 spots for SRR3207688.sra Written 772646 spots for SRR3207688.sra Read 772646 spots for SRR3207688.sra Written 772646 spots for SRR3207688.sra Read 772646 spots for SRR3207688.sra Written 772646 spots for SRR3207688.sra Read 772646 spots for SRR3207688.sra Written 772646 spots for SRR3207688.sra Read 772646 spots for SRR3207688.sra Written 772646 spots for SRR3207688.sra Read 772646 spots for SRR3207688.sra Written 772646 spots for SRR3207688.sra Read 772646 spots for SRR3207688.sra Written 772646 spots for SRR3207688.sra Read 772646 spots for SRR3207688.sra Written 772646 spots for SRR3207688.sra Read 772646 spots for SRR3207688.sra Written 772646 spots for SRR3207688.sra SRR ids: ['SRR3207688.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_i0w6frsc SRR3207688.sra spots: 15452928 blocks: [[1, 772646], [772647, 1545292], [1545293, 2317938], [2317939, 3090584], [3090585, 3863230], [3863231, 4635876], [4635877, 5408522], [5408523, 6181168], [6181169, 6953814], [6953815, 7726460], [7726461, 8499106], [8499107, 9271752], [9271753, 10044398], [10044399, 10817044], [10817045, 11589690], [11589691, 12362336], [12362337, 13134982], [13134983, 13907628], [13907629, 14680274], [14680275, 15452928]] SRR3207688 file size 4010650 SRR3207688 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207688 SRR3207688_1.fastq Input file: SRR3207688_1.fastq trimmed: SRR3207688-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 12:58:16 2025 >> started Mon Feb 10 12:58:24 2025 >> done (7.561s) 15452928 reads processed; of these: 3491 ( 0.02%) short reads filtered out after trimming by size control 557750 ( 3.61%) empty reads filtered out after trimming by size control 14891687 (96.37%) reads available; of these: 949170 ( 6.37%) trimmed reads available after processing 13942517 (93.63%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 709 0.00% 19 3448 0.02% 20 115571 0.78% 21 3097 0.02% 22 1161 0.01% 23 3897 0.03% 24 4570 0.03% 25 4391 0.03% 26 6669 0.04% 27 3603 0.02% 28 4329 0.03% 29 7833 0.05% 30 3019 0.02% 31 4933 0.03% 32 3026 0.02% 33 2553 0.02% 34 3249 0.02% 35 3440 0.02% 36 4311 0.03% 37 4731 0.03% 38 5289 0.04% 39 3400 0.02% 40 4309 0.03% 41 3632 0.02% 42 4742 0.03% 43 3860 0.03% 44 4337 0.03% 45 4389 0.03% 46 4168 0.03% 47 4883 0.03% 48 4643 0.03% 49 4512 0.03% 50 4557 0.03% 51 4509 0.03% 52 5970 0.04% 53 5772 0.04% 54 5740 0.04% 55 5475 0.04% 56 6362 0.04% 57 7640 0.05% 58 6955 0.05% 59 6945 0.05% 60 7472 0.05% 61 7851 0.05% 62 9159 0.06% 63 24249 0.16% 64 9091 0.06% 65 8441 0.06% 66 9542 0.06% 67 8488 0.06% 68 11134 0.07% 69 11704 0.08% 70 10393 0.07% 71 8801 0.06% 72 8155 0.05% 73 7855 0.05% 74 7288 0.05% 75 7215 0.05% 76 5387 0.04% 77 5886 0.04% 78 6783 0.05% 79 7627 0.05% 80 7888 0.05% 81 9091 0.06% 82 10191 0.07% 83 12255 0.08% 84 12872 0.09% 85 12205 0.08% 86 12300 0.08% 87 15567 0.10% 88 20759 0.14% 89 32227 0.22% 90 42329 0.28% 91 23509 0.16% 92 20640 0.14% 93 21342 0.14% 94 23998 0.16% 95 29977 0.20% 96 32422 0.22% 97 37705 0.25% 98 43876 0.29% 99 44867 0.30% 100 13942517 93.63% 14891687 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.99 fanout-score-rank=29 prefix-density=0.02 prefix-fanout=3.0 sequence=CAAGCAGAAGACGGCATACGAGATTGGTCAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTAATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGAT criterion=fanout-score sequence-density=0.04 sequence-density-rank=16 fanout-score=254.24 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=26.7 sequence=TTCTTCTTCTTT Started job on | Feb 10 12:58:39 Started mapping on | Feb 10 12:58:39 Finished on | Feb 10 12:58:55 Mapping speed, Million of reads per hour | 3350.63 Number of input reads | 14891687 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 13998386 Uniquely mapped reads % | 94.00% Average mapped length | 98.87 Number of splices: Total | 4136275 Number of splices: Annotated (sjdb) | 4057423 Number of splices: GT/AG | 4074320 Number of splices: GC/AG | 51120 Number of splices: AT/AC | 4040 Number of splices: Non-canonical | 6795 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.02% Deletion average length | 2.02 Insertion rate per base | 0.02% Insertion average length | 1.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 427482 % of reads mapped to multiple loci | 2.87% Number of reads mapped to too many loci | 75460 % of reads mapped to too many loci | 0.51% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.62% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 465819 465819 465819 N_multimapping 427482 427482 427482 N_noFeature 650141 7221408 7331642 N_ambiguous 142283 23578 23448 UnstrandedReadsAssigned:13205962 PositiveStrandReadsAssigned:6753400 NegativeStrandReadsAssigned:6643296 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207688 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207688-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,891,687 reads, 13,522,250 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,123 rounds 52401 SRR3207688.ke.tsv 34699 SRR3207688.se.tsv 87100 total ==> SRR3207688.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 450 26.4503 Potri.005G024800.1.v4.1 1035 936 50 6.02541 Potri.004G059700.1.v4.1 961 862 9 1.17768 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 211.372 8.38321 Potri.016G087400.1.v4.1 270 171 568 374.667 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 50 3.36905 Potri.012G127500.1.v4.1 977 878 1401 179.985 ==> SRR3207688.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1292 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 278 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 15 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR3207688 completed mapping pipeline successfully