Starting /dee2/code/volunteer_pipeline.sh SRR3207689 current disk space = 3058799173632 free memory = 1218846460 SRR3207689 SRAfilesize 46af622693a020cb6c0b4eac1d12b79c SRR3207689.sra SRR3207689.sra file validated SRR3207689 is single end SRR3207689 is conventional basespace SRR3207689 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207689_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9915 34.0 33.0 34.0 31.0 34.0 2 33.1715 34.0 34.0 34.0 31.0 34.0 3 33.28525 34.0 34.0 34.0 31.0 34.0 4 36.5465 37.0 37.0 37.0 35.0 37.0 5 36.4135 37.0 37.0 37.0 35.0 37.0 6 36.4645 37.0 37.0 37.0 35.0 37.0 7 36.45675 37.0 37.0 37.0 35.0 37.0 8 36.5155 37.0 37.0 37.0 35.0 37.0 9 38.284 39.0 39.0 39.0 37.0 39.0 10-11 38.33075 39.0 39.0 39.0 37.0 39.0 12-13 38.336125 39.0 39.0 39.0 37.0 39.0 14-15 40.0035 41.0 40.0 41.0 38.0 41.0 16-17 39.98950000000001 41.0 40.0 41.0 38.0 41.0 18-19 39.943625 41.0 40.0 41.0 38.0 41.0 20-21 39.912499999999994 41.0 40.0 41.0 38.0 41.0 22-23 39.597625 41.0 40.0 41.0 36.5 41.0 24-25 39.84525 41.0 40.0 41.0 38.0 41.0 26-27 39.747749999999996 41.0 40.0 41.0 38.0 41.0 28-29 39.738875 41.0 40.0 41.0 38.0 41.0 30-31 39.570499999999996 41.0 40.0 41.0 37.0 41.0 32-33 39.314375 41.0 40.0 41.0 36.0 41.0 34-35 39.501999999999995 41.0 40.0 41.0 37.0 41.0 36-37 39.47387500000001 41.0 40.0 41.0 37.0 41.0 38-39 39.245625000000004 41.0 39.0 41.0 36.0 41.0 40-41 39.095625 40.0 39.0 41.0 36.0 41.0 42-43 39.19675 40.5 39.0 41.0 36.0 41.0 44-45 39.311125 41.0 39.0 41.0 36.0 41.0 46-47 39.16275 41.0 39.0 41.0 35.5 41.0 48-49 39.012625 40.5 39.0 41.0 35.0 41.0 50-51 39.27825 41.0 39.0 41.0 36.0 41.0 52-53 39.272125 41.0 39.0 41.0 36.0 41.0 54-55 39.09975 41.0 39.0 41.0 35.5 41.0 56-57 38.920249999999996 41.0 39.0 41.0 35.0 41.0 58-59 38.523625 40.5 38.0 41.0 35.0 41.0 60-61 38.5515 40.0 38.0 41.0 35.0 41.0 62-63 38.397000000000006 40.0 37.0 41.0 35.0 41.0 64-65 37.939375 39.5 37.0 41.0 34.0 41.0 66-67 37.691874999999996 39.0 36.0 41.0 34.0 41.0 68-69 37.210750000000004 39.0 36.0 41.0 34.0 41.0 70-71 36.379625 37.5 35.0 40.0 33.0 41.0 72-73 35.937 37.0 35.0 39.0 33.0 41.0 74-75 35.473749999999995 37.0 35.0 39.0 32.5 41.0 76-77 34.527125 36.0 34.5 37.0 31.0 39.0 78-79 34.527249999999995 36.0 35.0 37.0 31.5 39.0 80-81 34.185875 35.0 35.0 37.0 31.5 39.0 82-83 34.050250000000005 35.0 35.0 36.0 32.0 37.0 84-85 33.7515 35.0 35.0 36.0 32.0 37.0 86-87 33.581125 35.0 35.0 36.0 32.0 37.0 88-89 32.99025 35.0 34.0 35.0 29.5 36.0 90-91 33.07625 35.0 34.0 35.0 30.5 36.0 92-93 33.022625000000005 35.0 34.0 35.0 31.0 36.0 94-95 32.9195 35.0 34.0 35.0 31.0 36.0 96-97 32.810874999999996 35.0 34.0 35.0 30.5 35.5 98-99 32.675125 35.0 34.0 35.0 30.5 35.0 100 32.64375 35.0 34.0 35.0 31.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 2.0 10 2.0 11 2.0 12 0.0 13 1.0 14 1.0 15 4.0 16 3.0 17 7.0 18 1.0 19 7.0 20 2.0 21 5.0 22 7.0 23 9.0 24 13.0 25 16.0 26 19.0 27 47.0 28 29.0 29 24.0 30 28.0 31 27.0 32 50.0 33 64.0 34 96.0 35 137.0 36 286.0 37 721.0 38 1787.0 39 602.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.75 16.375 14.899999999999999 41.975 2 18.75 25.525 38.125 17.599999999999998 3 20.424999999999997 26.400000000000002 30.8 22.375 4 21.925 33.475 21.224999999999998 23.375 5 24.275 35.175 22.375 18.175 6 20.1 36.35 23.674999999999997 19.875 7 16.625 19.275000000000002 42.75 21.349999999999998 8 17.8 26.025 30.675 25.5 9 21.825 22.225 31.775 24.175 10-11 22.6 34.699999999999996 22.4875 20.2125 12-13 19.875 27.025 29.212500000000002 23.8875 14-15 19.85 28.8875 28.3625 22.900000000000002 16-17 22.075 27.900000000000002 27.224999999999998 22.8 18-19 22.237499999999997 26.737499999999997 28.287499999999998 22.7375 20-21 22.225 27.3375 28.499999999999996 21.9375 22-23 21.075 30.625000000000004 26.687499999999996 21.6125 24-25 20.4375 28.5625 28.675 22.325 26-27 20.2875 27.237499999999997 28.262500000000003 24.212500000000002 28-29 22.59032379047381 29.091136392049005 26.778347293411674 21.540192524065507 30-31 21.235617808904454 28.214107053526767 28.251625812906454 22.298649324662332 32-33 21.3125 27.9375 28.1125 22.6375 34-35 20.65 29.4125 27.875 22.0625 36-37 22.625 28.349999999999998 27.1375 21.8875 38-39 22.1875 26.787499999999998 28.799999999999997 22.225 40-41 21.675 28.975 27.950000000000003 21.4 42-43 20.599999999999998 27.675 29.4375 22.287499999999998 44-45 22.9875 27.487499999999997 27.35 22.175 46-47 21.712500000000002 28.499999999999996 28.1 21.6875 48-49 21.987499999999997 27.750000000000004 29.325000000000003 20.9375 50-51 21.224999999999998 27.525 27.625 23.625 52-53 22.162499999999998 28.575 28.287499999999998 20.974999999999998 54-55 21.3 27.325 28.962500000000002 22.412499999999998 56-57 21.6625 27.450000000000003 28.6625 22.225 58-59 22.3875 27.150000000000002 29.375 21.087500000000002 60-61 20.6625 27.675 29.049999999999997 22.6125 62-63 23.075000000000003 28.1125 28.487499999999997 20.325 64-65 22.525000000000002 29.325000000000003 27.3375 20.8125 66-67 21.1125 29.849999999999998 27.075 21.9625 68-69 20.4625 30.2125 28.8375 20.4875 70-71 21.2 29.562500000000004 27.712500000000002 21.525 72-73 21.4 29.325000000000003 27.5625 21.712500000000002 74-75 21.4875 28.8875 27.987499999999997 21.637500000000003 76-77 22.400000000000002 29.3375 26.950000000000003 21.3125 78-79 21.712500000000002 29.95 27.8875 20.45 80-81 21.175 29.762499999999996 27.762500000000003 21.3 82-83 21.3 29.175 27.8375 21.6875 84-85 21.0 29.849999999999998 27.650000000000002 21.5 86-87 21.75 29.1625 27.8875 21.2 88-89 21.9375 28.6875 28.7375 20.6375 90-91 22.25 28.449999999999996 27.800000000000004 21.5 92-93 21.6875 29.5375 27.487499999999997 21.2875 94-95 22.787499999999998 28.975 26.85 21.3875 96-97 22.3375 27.925 28.349999999999998 21.3875 98-99 22.3875 28.799999999999997 27.6375 21.175 100 22.225 28.675 27.6 21.5 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 1.0 22 1.0 23 0.0 24 1.5 25 3.0 26 5.5 27 8.5 28 10.0 29 14.0 30 21.0 31 28.0 32 39.0 33 52.0 34 67.5 35 92.0 36 111.5 37 120.0 38 142.0 39 174.5 40 193.0 41 234.5 42 264.5 43 270.0 44 276.0 45 260.0 46 258.0 47 237.0 48 207.0 49 194.5 50 169.0 51 138.0 52 103.0 53 74.5 54 57.5 55 41.5 56 29.0 57 20.5 58 13.5 59 11.0 60 11.5 61 11.0 62 6.5 63 5.0 64 4.5 65 1.5 66 2.0 67 4.0 68 2.5 69 1.0 70 1.5 71 1.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0125 30-31 0.05 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84670413898826 97.7 2 0.1021972406745018 0.2 3 0.02554931016862545 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.02554931016862545 2.025 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGC 81 2.025 TruSeq Adapter, Index 5 (100% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.075 0.0 0.0 0.0 0.0 2 0.075 0.0 0.0 0.0 0.0 3 0.075 0.0 0.0 0.0 0.0 4 0.075 0.0 0.0 0.0 0.0 5 0.075 0.0 0.0 0.0 0.0 6 0.075 0.0 0.0 0.0 0.0 7 0.075 0.0 0.0 0.0 0.0 8 0.075 0.0 0.0 0.0 0.0 9 0.075 0.0 0.0 0.0 0.0 10-11 0.075 0.0 0.0 0.0 0.0 12-13 0.075 0.0 0.0 0.0 0.0 14-15 0.075 0.0 0.0 0.0 0.0 16-17 0.075 0.0 0.0 0.0 0.0 18-19 0.075 0.0 0.0 0.0 0.0 20-21 0.075 0.0 0.0 0.0 0.0 22-23 0.075 0.0 0.0 0.0 0.0 24-25 0.075 0.0 0.0 0.0 0.0 26-27 0.075 0.0 0.0 0.0 0.0 28-29 0.075 0.0 0.0 0.0 0.0 30-31 0.075 0.0 0.0 0.0 0.0 32-33 0.075 0.0 0.0 0.0 0.0 34-35 0.075 0.0 0.0 0.0 0.0 36-37 0.075 0.0 0.0 0.0 0.0 38-39 0.075 0.0 0.0 0.0 0.0 40-41 0.075 0.0 0.0 0.0 0.0 42-43 0.075 0.0 0.0 0.0 0.0 44-45 0.075 0.0 0.0 0.0 0.0 46-47 0.075 0.0 0.0 0.0 0.0 48-49 0.075 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88 0.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATCGGA 15 6.4061093E-4 94.0 1 GAAGAGC 15 6.4061093E-4 94.0 6 TCGGAAG 15 6.4061093E-4 94.0 3 GAGCACA 15 6.4061093E-4 94.0 9 CGGAAGA 15 6.4061093E-4 94.0 4 AGAGCAC 15 6.4061093E-4 94.0 8 ATCGGAA 15 6.4061093E-4 94.0 2 GGAAGAG 15 6.4061093E-4 94.0 5 AAGAGCA 20 0.0020083564 70.5 7 AACTCCA 25 0.0016030063 37.600002 22-23 AAAAAAA 65 2.7971718E-4 21.692308 64-65 >>END_MODULE Read 759870 spots for SRR3207689.sra Written 759870 spots for SRR3207689.sra Read 759870 spots for SRR3207689.sra Written 759870 spots for SRR3207689.sra Read 759870 spots for SRR3207689.sra Written 759870 spots for SRR3207689.sra Read 759870 spots for SRR3207689.sra Written 759870 spots for SRR3207689.sra Read 759870 spots for SRR3207689.sra Written 759870 spots for SRR3207689.sra Read 759870 spots for SRR3207689.sra Written 759870 spots for SRR3207689.sra Read 759870 spots for SRR3207689.sra Written 759870 spots for SRR3207689.sra Read 759870 spots for SRR3207689.sra Written 759870 spots for SRR3207689.sra Read 759870 spots for SRR3207689.sra Written 759870 spots for SRR3207689.sra Read 759870 spots for SRR3207689.sra Written 759870 spots for SRR3207689.sra Read 759870 spots for SRR3207689.sra Written 759870 spots for SRR3207689.sra Read 759870 spots for SRR3207689.sra Written 759870 spots for SRR3207689.sra Read 759870 spots for SRR3207689.sra Written 759870 spots for SRR3207689.sra Read 759870 spots for SRR3207689.sra Written 759870 spots for SRR3207689.sra Read 759870 spots for SRR3207689.sra Written 759870 spots for SRR3207689.sra Read 759870 spots for SRR3207689.sra Written 759870 spots for SRR3207689.sra Read 759870 spots for SRR3207689.sra Written 759870 spots for SRR3207689.sra Read 759877 spots for SRR3207689.sra Written 759877 spots for SRR3207689.sra Read 759870 spots for SRR3207689.sra Written 759870 spots for SRR3207689.sra Read 759870 spots for SRR3207689.sra Written 759870 spots for SRR3207689.sra SRR ids: ['SRR3207689.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_u83vjb34 SRR3207689.sra spots: 15197407 blocks: [[1, 759870], [759871, 1519740], [1519741, 2279610], [2279611, 3039480], [3039481, 3799350], [3799351, 4559220], [4559221, 5319090], [5319091, 6078960], [6078961, 6838830], [6838831, 7598700], [7598701, 8358570], [8358571, 9118440], [9118441, 9878310], [9878311, 10638180], [10638181, 11398050], [11398051, 12157920], [12157921, 12917790], [12917791, 13677660], [13677661, 14437530], [14437531, 15197407]] SRR3207689 file size 3944158 SRR3207689 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207689 SRR3207689_1.fastq Input file: SRR3207689_1.fastq trimmed: SRR3207689-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 12:58:40 2025 >> started Mon Feb 10 12:58:47 2025 >> done (7.430s) 15197407 reads processed; of these: 1180 ( 0.01%) short reads filtered out after trimming by size control 325687 ( 2.14%) empty reads filtered out after trimming by size control 14870540 (97.85%) reads available; of these: 587893 ( 3.95%) trimmed reads available after processing 14282647 (96.05%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 195 0.00% 19 281 0.00% 20 387 0.00% 21 427 0.00% 22 534 0.00% 23 828 0.01% 24 1127 0.01% 25 1503 0.01% 26 1822 0.01% 27 1813 0.01% 28 1745 0.01% 29 1826 0.01% 30 1633 0.01% 31 1785 0.01% 32 1864 0.01% 33 1871 0.01% 34 2013 0.01% 35 2013 0.01% 36 2122 0.01% 37 2263 0.02% 38 2300 0.02% 39 2303 0.02% 40 2406 0.02% 41 2544 0.02% 42 2647 0.02% 43 2723 0.02% 44 2866 0.02% 45 2848 0.02% 46 3078 0.02% 47 3335 0.02% 48 3489 0.02% 49 3739 0.03% 50 3546 0.02% 51 3850 0.03% 52 4163 0.03% 53 4071 0.03% 54 3992 0.03% 55 4085 0.03% 56 4362 0.03% 57 4497 0.03% 58 4623 0.03% 59 5103 0.03% 60 5085 0.03% 61 5067 0.03% 62 5197 0.03% 63 5952 0.04% 64 5200 0.03% 65 5308 0.04% 66 5507 0.04% 67 6086 0.04% 68 7268 0.05% 69 8108 0.05% 70 8187 0.06% 71 6478 0.04% 72 6133 0.04% 73 6288 0.04% 74 6430 0.04% 75 6723 0.05% 76 4707 0.03% 77 5320 0.04% 78 5765 0.04% 79 6357 0.04% 80 6894 0.05% 81 7247 0.05% 82 7790 0.05% 83 8693 0.06% 84 8678 0.06% 85 9323 0.06% 86 9769 0.07% 87 10565 0.07% 88 11495 0.08% 89 12799 0.09% 90 14017 0.09% 91 15425 0.10% 92 17268 0.12% 93 19694 0.13% 94 22868 0.15% 95 26373 0.18% 96 31291 0.21% 97 36273 0.24% 98 42074 0.28% 99 43569 0.29% 100 14282647 96.05% 14870540 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=33.82 fanout-score-rank=8 prefix-density=0.27 prefix-fanout=28.4 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGCCGTCTTCTGCTTGAAAAAA criterion=fanout-score sequence-density=0.04 sequence-density-rank=20 fanout-score=297.28 fanout-score-rank=1 prefix-density=0.41 prefix-fanout=28.9 sequence=TTCTTCTTCTTT Started job on | Feb 10 12:59:06 Started mapping on | Feb 10 12:59:07 Finished on | Feb 10 12:59:27 Mapping speed, Million of reads per hour | 2676.70 Number of input reads | 14870540 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 14145145 Uniquely mapped reads % | 95.12% Average mapped length | 99.01 Number of splices: Total | 4111382 Number of splices: Annotated (sjdb) | 4031163 Number of splices: GT/AG | 4049823 Number of splices: GC/AG | 50570 Number of splices: AT/AC | 4105 Number of splices: Non-canonical | 6884 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.02% Deletion average length | 1.99 Insertion rate per base | 0.02% Insertion average length | 1.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 300364 % of reads mapped to multiple loci | 2.02% Number of reads mapped to too many loci | 68444 % of reads mapped to too many loci | 0.46% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.39% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 425031 425031 425031 N_multimapping 300364 300364 300364 N_noFeature 701021 7320818 7426213 N_ambiguous 149141 25110 25073 UnstrandedReadsAssigned:13294983 PositiveStrandReadsAssigned:6799217 NegativeStrandReadsAssigned:6693859 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207689 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207689-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,870,540 reads, 13,603,970 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,262 rounds 52401 SRR3207689.ke.tsv 34699 SRR3207689.se.tsv 87100 total ==> SRR3207689.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 428.473 25.0883 Potri.005G024800.1.v4.1 1035 936 77 9.24355 Potri.004G059700.1.v4.1 961 862 17 2.21598 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 197.172 7.79003 Potri.016G087400.1.v4.1 270 171 543 356.802 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 36 2.41641 Potri.012G127500.1.v4.1 977 878 1252 160.226 ==> SRR3207689.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1614 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 276 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 19 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 7 SRR3207689 completed mapping pipeline successfully