Starting /dee2/code/volunteer_pipeline.sh SRR3207690 current disk space = 3058821595136 free memory = 1033660324 SRR3207690 SRAfilesize 98d6e140f0198d6bc631c5546dcb8474 SRR3207690.sra SRR3207690.sra file validated SRR3207690 is single end SRR3207690 is conventional basespace SRR3207690 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207690_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.959 34.0 31.0 34.0 31.0 34.0 2 33.19725 34.0 34.0 34.0 31.0 34.0 3 33.304 34.0 34.0 34.0 31.0 34.0 4 36.5675 37.0 37.0 37.0 35.0 37.0 5 36.37025 37.0 37.0 37.0 35.0 37.0 6 36.38 37.0 37.0 37.0 35.0 37.0 7 36.4665 37.0 37.0 37.0 35.0 37.0 8 36.5035 37.0 37.0 37.0 35.0 37.0 9 38.2585 39.0 39.0 39.0 37.0 39.0 10-11 38.28637500000001 39.0 39.0 39.0 37.0 39.0 12-13 38.292625 39.0 39.0 39.0 37.0 39.0 14-15 39.933499999999995 41.0 40.0 41.0 38.0 41.0 16-17 39.9915 41.0 40.0 41.0 38.0 41.0 18-19 39.944374999999994 41.0 40.0 41.0 38.0 41.0 20-21 39.918375 41.0 40.0 41.0 38.0 41.0 22-23 39.60325 41.0 40.0 41.0 37.5 41.0 24-25 39.8635 41.0 40.0 41.0 38.0 41.0 26-27 39.84175 41.0 40.0 41.0 38.0 41.0 28-29 39.669875 41.0 40.0 41.0 37.0 41.0 30-31 39.54875 41.0 40.0 41.0 37.0 41.0 32-33 39.293875 41.0 40.0 41.0 36.0 41.0 34-35 39.466499999999996 41.0 40.0 41.0 37.0 41.0 36-37 39.45525 41.0 40.0 41.0 37.0 41.0 38-39 39.258875 41.0 39.0 41.0 36.0 41.0 40-41 39.113625 41.0 39.0 41.0 35.5 41.0 42-43 39.18925 40.5 39.0 41.0 35.5 41.0 44-45 39.331375 41.0 39.0 41.0 36.0 41.0 46-47 39.2215 41.0 39.0 41.0 36.0 41.0 48-49 38.99325 41.0 39.0 41.0 35.5 41.0 50-51 39.22825 41.0 39.0 41.0 36.0 41.0 52-53 39.271 41.0 39.0 41.0 36.0 41.0 54-55 39.1275 41.0 39.0 41.0 35.5 41.0 56-57 38.91275 41.0 39.0 41.0 35.0 41.0 58-59 38.62575 40.5 38.0 41.0 35.0 41.0 60-61 38.563874999999996 40.0 38.0 41.0 35.0 41.0 62-63 38.384 40.0 37.0 41.0 35.0 41.0 64-65 38.033875 39.5 37.0 41.0 34.0 41.0 66-67 37.742374999999996 39.0 36.5 41.0 34.0 41.0 68-69 37.333749999999995 39.0 35.5 41.0 34.0 41.0 70-71 36.862625 38.0 35.0 40.0 34.0 41.0 72-73 36.346875 37.0 35.0 39.0 33.0 41.0 74-75 35.91 37.0 35.0 39.0 33.0 41.0 76-77 35.01925 36.0 34.5 37.5 31.5 39.0 78-79 35.013999999999996 36.0 35.0 37.0 32.0 39.0 80-81 34.6605 35.0 35.0 37.0 32.0 39.0 82-83 34.471500000000006 35.0 35.0 36.5 32.0 37.0 84-85 34.135999999999996 35.0 35.0 36.0 32.0 37.0 86-87 34.001875 35.0 35.0 36.0 32.0 36.5 88-89 33.40025 35.0 34.0 35.0 30.5 36.0 90-91 33.527625 35.0 35.0 35.0 31.0 36.0 92-93 33.55525 35.0 35.0 35.0 32.0 36.0 94-95 33.408375 35.0 35.0 35.0 32.0 36.0 96-97 33.274625 35.0 34.0 35.0 31.0 35.5 98-99 33.203375 35.0 34.0 35.0 31.5 35.0 100 33.12925 35.0 34.0 35.0 32.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 1.0 11 1.0 12 2.0 13 1.0 14 3.0 15 3.0 16 8.0 17 3.0 18 5.0 19 3.0 20 1.0 21 0.0 22 2.0 23 6.0 24 9.0 25 8.0 26 15.0 27 38.0 28 23.0 29 21.0 30 25.0 31 38.0 32 59.0 33 71.0 34 95.0 35 131.0 36 254.0 37 717.0 38 1808.0 39 648.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.074999999999996 17.2 16.1 41.625 2 18.575 26.150000000000002 37.425000000000004 17.849999999999998 3 21.5 26.674999999999997 28.1 23.724999999999998 4 21.475 34.175 20.674999999999997 23.674999999999997 5 24.61230615307654 35.89294647323662 21.83591795897949 17.658829414707352 6 19.3 36.675000000000004 24.85 19.175 7 16.275000000000002 18.099999999999998 44.875 20.75 8 18.925 22.225 29.875 28.975 9 19.975 23.45 31.35 25.224999999999998 10-11 22.6125 34.35 22.0 21.0375 12-13 20.75 25.5625 29.9 23.7875 14-15 20.95 28.599999999999998 27.775 22.675 16-17 20.65 28.249999999999996 28.0875 23.0125 18-19 21.725 28.075 27.55 22.650000000000002 20-21 21.625 29.462500000000002 28.000000000000004 20.9125 22-23 21.462500000000002 29.4375 27.450000000000003 21.65 24-25 21.0625 28.175 28.875 21.8875 26-27 21.525 28.1 27.750000000000004 22.625 28-29 22.457150006255475 28.462404604028524 27.67421493807081 21.40623045164519 30-31 21.746746746746748 27.902902902902905 27.352352352352355 22.997997997998 32-33 21.8875 28.462500000000002 27.575 22.075 34-35 21.8875 28.037499999999998 28.225 21.85 36-37 20.95 28.6875 27.6625 22.7 38-39 22.125 27.525 29.25 21.099999999999998 40-41 21.5625 28.825 28.237499999999997 21.375 42-43 21.3625 28.8625 27.987499999999997 21.7875 44-45 22.8 28.287499999999998 27.800000000000004 21.1125 46-47 22.237499999999997 29.037499999999998 27.737499999999997 20.9875 48-49 22.0625 28.1375 28.512500000000003 21.2875 50-51 22.112499999999997 28.449999999999996 27.150000000000002 22.287499999999998 52-53 21.675 27.9375 28.599999999999998 21.7875 54-55 21.5375 28.375 28.275 21.8125 56-57 21.85 28.8625 27.55 21.7375 58-59 21.825 27.5125 28.9875 21.675 60-61 21.875 27.35 28.325 22.45 62-63 21.5375 27.8125 29.062500000000004 21.587500000000002 64-65 21.825 28.575 27.35 22.25 66-67 22.275 28.512500000000003 27.900000000000002 21.3125 68-69 22.3375 29.062500000000004 27.775 20.825 70-71 22.225 28.449999999999996 27.6 21.725 72-73 20.8 29.2875 28.575 21.337500000000002 74-75 21.462500000000002 28.3375 28.725 21.475 76-77 21.9 27.8625 28.025 22.2125 78-79 22.5 26.825 29.4375 21.2375 80-81 22.075 29.25 26.424999999999997 22.25 82-83 22.0125 28.825 27.725 21.4375 84-85 22.725 27.9125 27.962500000000002 21.4 86-87 21.925 28.487499999999997 27.825 21.762500000000003 88-89 21.85 28.075 27.8875 22.1875 90-91 21.6125 28.762500000000003 27.8875 21.7375 92-93 22.15 29.037499999999998 27.450000000000003 21.3625 94-95 21.4125 28.962500000000002 28.249999999999996 21.375 96-97 22.037499999999998 27.725 28.425 21.8125 98-99 22.2125 29.049999999999997 28.000000000000004 20.7375 100 22.475 27.975 27.675 21.875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 1.0 23 1.5 24 2.5 25 3.0 26 4.5 27 8.5 28 10.0 29 11.0 30 14.5 31 28.0 32 33.0 33 36.5 34 64.5 35 86.0 36 96.0 37 126.5 38 149.5 39 160.5 40 193.0 41 243.5 42 247.5 43 255.0 44 286.5 45 284.5 46 266.0 47 251.0 48 230.5 49 189.5 50 153.0 51 123.0 52 107.0 53 89.0 54 64.0 55 46.0 56 34.0 57 22.0 58 20.5 59 17.5 60 7.0 61 4.5 62 4.0 63 4.0 64 5.5 65 3.0 66 2.0 67 3.0 68 2.0 69 1.0 70 0.5 71 1.0 72 1.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.08750000000000001 30-31 0.1 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84879032258065 99.05000000000001 2 0.12600806451612903 0.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025201612903225805 0.7000000000000001 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGC 28 0.7000000000000001 TruSeq Adapter, Index 6 (100% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.1 0.0 0.0 0.0 0.0 2 0.1 0.0 0.0 0.0 0.0 3 0.1 0.0 0.0 0.0 0.0 4 0.1 0.0 0.0 0.0 0.0 5 0.1 0.0 0.0 0.0 0.0 6 0.1 0.0 0.0 0.0 0.0 7 0.1 0.0 0.0 0.0 0.0 8 0.1 0.0 0.0 0.0 0.0 9 0.1 0.0 0.0 0.0 0.0 10-11 0.1 0.0 0.0 0.0 0.0 12-13 0.1 0.0 0.0 0.0 0.0 14-15 0.1 0.0 0.0 0.0 0.0 16-17 0.1 0.0 0.0 0.0 0.0 18-19 0.1 0.0 0.0 0.0 0.0 20-21 0.1 0.0 0.0 0.0 0.0 22-23 0.1 0.0 0.0 0.0 0.0 24-25 0.1 0.0 0.0 0.0 0.0 26-27 0.1 0.0 0.0 0.0 0.0 28-29 0.1 0.0 0.0 0.0 0.0 30-31 0.1 0.0 0.0 0.0 0.0 32-33 0.1 0.0 0.0 0.0 0.0 34-35 0.1 0.0 0.0 0.0 0.0 36-37 0.1 0.0 0.0 0.0 0.0 38-39 0.1 0.0 0.0 0.0 0.0 40-41 0.1 0.0 0.0 0.0 0.0 42-43 0.1 0.0 0.0 0.0 0.0 44-45 0.1 0.0 0.0 0.0 0.0 46-47 0.1 0.0 0.0 0.0 0.0 48-49 0.1 0.0 0.0 0.0 0.0 50-51 0.1 0.0 0.0 0.0 0.0 52-53 0.1125 0.0 0.0 0.0 0.0 54-55 0.125 0.0 0.0 0.0 0.0 56-57 0.125 0.0 0.0 0.0 0.0 58-59 0.15 0.0 0.0 0.0 0.0 60-61 0.15 0.0 0.0 0.0 0.0 62-63 0.16249999999999998 0.0 0.0 0.0 0.0 64-65 0.2 0.0 0.0 0.0 0.0 66-67 0.2 0.0 0.0 0.0 0.0 68-69 0.2375 0.0 0.0 0.0 0.0 70-71 0.25 0.0 0.0 0.0 0.0 72-73 0.2625 0.0 0.0 0.0 0.0 74-75 0.3125 0.0 0.0 0.0 0.0 76-77 0.3375 0.0 0.0 0.0 0.0 78-79 0.375 0.0 0.0 0.0 0.0 80-81 0.4125 0.0 0.0 0.0 0.0 82-83 0.475 0.0 0.0 0.0 0.0 84-85 0.5625 0.0 0.0 0.0 0.0 86-87 0.65 0.0 0.0 0.0 0.0 88 0.725 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 647045 spots for SRR3207690.sra Written 647045 spots for SRR3207690.sra Read 647045 spots for SRR3207690.sra Written 647045 spots for SRR3207690.sra Read 647045 spots for SRR3207690.sra Written 647045 spots for SRR3207690.sra Read 647045 spots for SRR3207690.sra Written 647045 spots for SRR3207690.sra Read 647045 spots for SRR3207690.sra Written 647045 spots for SRR3207690.sra Read 647045 spots for SRR3207690.sra Written 647045 spots for SRR3207690.sra Read 647045 spots for SRR3207690.sra Written 647045 spots for SRR3207690.sra Read 647045 spots for SRR3207690.sra Written 647045 spots for SRR3207690.sra Read 647045 spots for SRR3207690.sra Written 647045 spots for SRR3207690.sra Read 647045 spots for SRR3207690.sra Written 647045 spots for SRR3207690.sra Read 647045 spots for SRR3207690.sra Written 647045 spots for SRR3207690.sra Read 647050 spots for SRR3207690.sra Written 647050 spots for SRR3207690.sra Read 647045 spots for SRR3207690.sra Written 647045 spots for SRR3207690.sra Read 647045 spots for SRR3207690.sra Written 647045 spots for SRR3207690.sra Read 647045 spots for SRR3207690.sra Written 647045 spots for SRR3207690.sra Read 647045 spots for SRR3207690.sra Written 647045 spots for SRR3207690.sra Read 647045 spots for SRR3207690.sra Written 647045 spots for SRR3207690.sra Read 647045 spots for SRR3207690.sra Written 647045 spots for SRR3207690.sra Read 647045 spots for SRR3207690.sra Written 647045 spots for SRR3207690.sra Read 647045 spots for SRR3207690.sra Written 647045 spots for SRR3207690.sra SRR ids: ['SRR3207690.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_an2wm_gc SRR3207690.sra spots: 12940905 blocks: [[1, 647045], [647046, 1294090], [1294091, 1941135], [1941136, 2588180], [2588181, 3235225], [3235226, 3882270], [3882271, 4529315], [4529316, 5176360], [5176361, 5823405], [5823406, 6470450], [6470451, 7117495], [7117496, 7764540], [7764541, 8411585], [8411586, 9058630], [9058631, 9705675], [9705676, 10352720], [10352721, 10999765], [10999766, 11646810], [11646811, 12293855], [12293856, 12940905]] SRR3207690 file size 3356923 SRR3207690 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207690 SRR3207690_1.fastq Input file: SRR3207690_1.fastq trimmed: SRR3207690-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 13:00:30 2025 >> started Mon Feb 10 13:00:37 2025 >> done (6.664s) 12940905 reads processed; of these: 883 ( 0.01%) short reads filtered out after trimming by size control 132715 ( 1.03%) empty reads filtered out after trimming by size control 12807307 (98.97%) reads available; of these: 504019 ( 3.94%) trimmed reads available after processing 12303288 (96.06%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 162 0.00% 19 201 0.00% 20 242 0.00% 21 335 0.00% 22 437 0.00% 23 655 0.01% 24 881 0.01% 25 1201 0.01% 26 1455 0.01% 27 1531 0.01% 28 1512 0.01% 29 1468 0.01% 30 1420 0.01% 31 1532 0.01% 32 1646 0.01% 33 1653 0.01% 34 1775 0.01% 35 1672 0.01% 36 1748 0.01% 37 1860 0.01% 38 1882 0.01% 39 1973 0.02% 40 1964 0.02% 41 2112 0.02% 42 2308 0.02% 43 2360 0.02% 44 2448 0.02% 45 2474 0.02% 46 2680 0.02% 47 2742 0.02% 48 2851 0.02% 49 2956 0.02% 50 2814 0.02% 51 3101 0.02% 52 3187 0.02% 53 3416 0.03% 54 3414 0.03% 55 3525 0.03% 56 3675 0.03% 57 3915 0.03% 58 3957 0.03% 59 4279 0.03% 60 4350 0.03% 61 4320 0.03% 62 4596 0.04% 63 4580 0.04% 64 4639 0.04% 65 4745 0.04% 66 4787 0.04% 67 5150 0.04% 68 5761 0.04% 69 6351 0.05% 70 5865 0.05% 71 5184 0.04% 72 5311 0.04% 73 5424 0.04% 74 5706 0.04% 75 5803 0.05% 76 4109 0.03% 77 4726 0.04% 78 5065 0.04% 79 5654 0.04% 80 5824 0.05% 81 6289 0.05% 82 6598 0.05% 83 7484 0.06% 84 7531 0.06% 85 7961 0.06% 86 8583 0.07% 87 9179 0.07% 88 10058 0.08% 89 10886 0.08% 90 12230 0.10% 91 13401 0.10% 92 15083 0.12% 93 17138 0.13% 94 19936 0.16% 95 22748 0.18% 96 27435 0.21% 97 31693 0.25% 98 36489 0.28% 99 37928 0.30% 100 12303288 96.06% 12807307 reads passed initial QC criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=53.76 fanout-score-rank=4 prefix-density=0.59 prefix-fanout=38.3 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGCCGTCTTCTGCTTGAAAAAAAA criterion=fanout-score sequence-density=0.04 sequence-density-rank=17 fanout-score=270.66 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=28.3 sequence=TTCTTCTTCTTT Started job on | Feb 10 13:01:05 Started mapping on | Feb 10 13:01:05 Finished on | Feb 10 13:01:19 Mapping speed, Million of reads per hour | 3293.31 Number of input reads | 12807307 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 12292630 Uniquely mapped reads % | 95.98% Average mapped length | 98.91 Number of splices: Total | 3599386 Number of splices: Annotated (sjdb) | 3531322 Number of splices: GT/AG | 3546076 Number of splices: GC/AG | 43772 Number of splices: AT/AC | 3507 Number of splices: Non-canonical | 6031 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.02% Deletion average length | 2.00 Insertion rate per base | 0.01% Insertion average length | 1.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 256690 % of reads mapped to multiple loci | 2.00% Number of reads mapped to too many loci | 99609 % of reads mapped to too many loci | 0.78% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.23% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 257987 257987 257987 N_multimapping 256690 256690 256690 N_noFeature 576875 6334879 6450369 N_ambiguous 127142 21545 21507 UnstrandedReadsAssigned:11588613 PositiveStrandReadsAssigned:5936206 NegativeStrandReadsAssigned:5820754 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207690 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207690-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,807,307 reads, 11,894,431 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,183 rounds 52401 SRR3207690.ke.tsv 34699 SRR3207690.se.tsv 87100 total ==> SRR3207690.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 351 23.9463 Potri.005G024800.1.v4.1 1035 936 72 10.0708 Potri.004G059700.1.v4.1 961 862 10 1.5188 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 182.043 8.38014 Potri.016G087400.1.v4.1 270 171 401 307.012 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 50 3.9104 Potri.012G127500.1.v4.1 977 878 716 106.764 ==> SRR3207690.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1440 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 203 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 19 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 9 SRR3207690 completed mapping pipeline successfully